"
Team:LZU-China/wetlab2
From 2014.igem.org
(Difference between revisions)
(Created page with "- →This is wetlab2: ") |
|||
| Line 1: | Line 1: | ||
| - | /* | + | <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> |
| + | <html xmlns=" http://www.w3.org/1999/xhtml"> | ||
| + | <head> | ||
| + | <meta http-equiv="Content-Type" content="text/html; charset=gb2312" /> | ||
| + | <title>LZU-China 2014</title> | ||
| + | <style type="text/css"> | ||
| + | |||
| + | body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;} | ||
| + | img{border:0px;} | ||
| + | .picList{width:100%;float:left;} | ||
| + | .picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;} | ||
| + | .picList .col img,.col a{position:absolute;top:0px;left:0px;} | ||
| + | .picList .col img{width:100%;} | ||
| + | .picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;} | ||
| + | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;} | ||
| + | |||
| + | .picList2{width:100%;float:left;} | ||
| + | .picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;} | ||
| + | .picList2 .col img,.col a{position:absolute;top:0px;left:0px;} | ||
| + | .picList2 .col img{width:100%;} | ||
| + | .picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;} | ||
| + | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;} | ||
| + | |||
| + | .picList3{width:100%;float:left;} | ||
| + | .picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;} | ||
| + | .picList3 .col img,.col a{position:absolute;top:0px;left:0px;} | ||
| + | .picList3 .col img{width:100%;} | ||
| + | .picList3 .col a{ | ||
| + | display:block; | ||
| + | width:580; | ||
| + | height:377px; | ||
| + | top:357px; | ||
| + | background:rgba(0,0,0,0.7); | ||
| + | color:white; | ||
| + | font-style:normal; | ||
| + | line-height:25px; | ||
| + | padding:10px; | ||
| + | opacity:0.8; | ||
| + | text-decoration:none; | ||
| + | } | ||
| + | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;} | ||
| + | |||
| + | .picList4{width:100%;float:left;} | ||
| + | .picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;} | ||
| + | .picList4 .col img,.col a{position:absolute;top:0px;left:0px;} | ||
| + | .picList4 .col img{width:100%;} | ||
| + | .picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;} | ||
| + | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;} | ||
| + | |||
| + | .picList5{width:100%;float:left;} | ||
| + | .picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;} | ||
| + | .picList5 .col img,.col a{position:absolute;top:0px;left:0px;} | ||
| + | .picList5 .col img{width:100%;} | ||
| + | .picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;} | ||
| + | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;} | ||
| + | |||
| + | .picList6{width:100%;float:left;} | ||
| + | .picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;} | ||
| + | .picList6 .col img,.col a{position:absolute;top:0px;left:0px;} | ||
| + | .picList6 .col img{width:100%;} | ||
| + | .picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;} | ||
| + | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;} | ||
| + | |||
| + | .picList7{width:100%;float:left;} | ||
| + | .picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;} | ||
| + | .picList7 .col img,.col a{position:absolute;top:0px;left:0px;} | ||
| + | .picList7 .col img{width:100%;} | ||
| + | .picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;} | ||
| + | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;} | ||
| + | |||
| + | .picList8{width:100%;float:left;} | ||
| + | .picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;} | ||
| + | .picList8 .col img,.col a{position:absolute;top:0px;left:0px;} | ||
| + | .picList8 .col img{width:100%;} | ||
| + | .picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;} | ||
| + | .msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;} | ||
| + | |||
| + | *{margin:0px;padding:0px;} | ||
| + | body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;} | ||
| + | b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;} | ||
| + | #accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;} | ||
| + | #accordian li {width:50px; height:300px; float:left; | ||
| + | -moz-transition: 0.7s; | ||
| + | -ms-transition: 0.7s; | ||
| + | -o-transition: 0.7s; | ||
| + | -webkit-transition: 0.7s; | ||
| + | transition: 0.7s; | ||
| + | } | ||
| + | #accordian div {width:530px; height:300px; position:relative;} | ||
| + | #accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000; | ||
| + | } | ||
| + | #accordian div span a {color:#fff;} | ||
| + | #accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);} | ||
| + | #accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6); | ||
| + | transform: rotate(-90deg); | ||
| + | transform-origin:bottom left; | ||
| + | -ms-transform: rotate(-90deg); | ||
| + | -ms-transform-origin:bottom left; | ||
| + | -webkit-transform: rotate(-90deg); | ||
| + | -webkit-transform-origin:bottom left; | ||
| + | -moz-transform: rotate(-90deg); | ||
| + | -moz-transform-origin:bottom left; | ||
| + | -o-transform: rotate(-90deg); | ||
| + | -o-transform-origin:bottom left; | ||
| + | } | ||
| + | #accordian li div > a b {*left:0;} | ||
| + | #accordian li img {display:block; float:left;} | ||
| + | #accordian li.p1 {width:530px;} | ||
| + | #accordian li.p1 div span {bottom:0;} | ||
| + | #accordian li a.a1 {background:#b33866; border-left:1px solid #682;} | ||
| + | #accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;} | ||
| + | #accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;} | ||
| + | #accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;} | ||
| + | #accordian li a.a5 {background:#187adb; border-left:1px solid #28b;} | ||
| + | #p1:target ~ #accordian li {width:50px;} | ||
| + | #p1:target ~ #accordian li div span {bottom:300px;} | ||
| + | #p1:target ~ #accordian li.p1 {width:530px;} | ||
| + | #p1:target ~ #accordian li.p1 div span {bottom:0;} | ||
| + | #p2:target ~ #accordian li {width:50px;} | ||
| + | #p2:target ~ #accordian li div span {bottom:300px;} | ||
| + | #p2:target ~ #accordian li.p2 {width:530px;} | ||
| + | #p2:target ~ #accordian li.p2 div span {bottom:0;} | ||
| + | #p3:target ~ #accordian li {width:50px;} | ||
| + | #p3:target ~ #accordian li div span {bottom:300px;} | ||
| + | #p3:target ~ #accordian li.p3 {width:530px;} | ||
| + | #p3:target ~ #accordian li.p3 div span {bottom:0;} | ||
| + | #p4:target ~ #accordian li {width:50px;} | ||
| + | #p4:target ~ #accordian li div span {bottom:300px;} | ||
| + | #p4:target ~ #accordian li.p4 {width:530px;} | ||
| + | #p4:target ~ #accordian li.p4 div span {bottom:0;} | ||
| + | #p5:target ~ #accordian li {width:50px;} | ||
| + | #p5:target ~ #accordian li div span {bottom:300px;} | ||
| + | #p5:target ~ #accordian li.p5 {width:530px;} | ||
| + | #p5:target ~ #accordian li.p5 div span {bottom:0;} | ||
| + | |||
| + | |||
| + | #contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/ | ||
| + | |||
| + | .firstHeading { | ||
| + | width: 975px; | ||
| + | margin: 0px auto; | ||
| + | padding-top: 100px; | ||
| + | margin-bottom: 20px; | ||
| + | font-family: Georgia, Times, "Times New Roman", serif; | ||
| + | } | ||
| + | |||
| + | h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;} | ||
| + | |||
| + | #top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/ | ||
| + | background-color: #383838; | ||
| + | border: 0 none; | ||
| + | height: 14px; | ||
| + | z-index: 100; | ||
| + | top: 0; | ||
| + | position: fixed; | ||
| + | width: 975px; | ||
| + | left: 50%; | ||
| + | margin-left: -487px; | ||
| + | } | ||
| + | |||
| + | #top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/ | ||
| + | background-color: #383838; | ||
| + | height: 14px; | ||
| + | display: block; | ||
| + | z-index: 10; | ||
| + | position: fixed; | ||
| + | width: 100%; | ||
| + | top: 0; | ||
| + | } | ||
| + | |||
| + | #menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/ | ||
| + | color: #727272; | ||
| + | text-decoration: none; | ||
| + | background-color: transparent; | ||
| + | } | ||
| + | |||
| + | body { | ||
| + | background-color: #fff; | ||
| + | } | ||
| + | |||
| + | #globalWrapper, #content { /*-- changes default wiki settings --*/ | ||
| + | width: 100%; | ||
| + | height: 100%; | ||
| + | border: 0px; | ||
| + | background-color: transparent; | ||
| + | margin: 0px; | ||
| + | padding: 0px; | ||
| + | } | ||
| + | |||
| + | html, body, .wrapper { /*-- changes default wiki settings --*/ | ||
| + | width: 100%; | ||
| + | height: 100%; | ||
| + | background-color: transparent; | ||
| + | } | ||
| + | |||
| + | #contentcontainer { /*-- creates container for all content on page --*/ | ||
| + | font-family: Arial, Helvetica, sans-serif; | ||
| + | font-weight: normal; | ||
| + | font-size: 14px; | ||
| + | color: #414141; | ||
| + | width: 960px; | ||
| + | margin-left: auto; | ||
| + | margin-right: auto; | ||
| + | background-color: #transparent; | ||
| + | margin-top: 0px; | ||
| + | } | ||
| + | |||
| + | .sidemenu, .sidemenu li { | ||
| + | list-style-type: none; | ||
| + | list-style-image: none; | ||
| + | font-family: verdana; | ||
| + | text-decoration: none; | ||
| + | color:#000; | ||
| + | font-size: 14px; | ||
| + | } | ||
| + | |||
| + | .sidemenu li {display: block;} | ||
| + | |||
| + | .sidemenu a { | ||
| + | text-decoration:none; | ||
| + | color: #000; | ||
| + | display: block; | ||
| + | width: 180px; | ||
| + | height: 100%; | ||
| + | padding: 3px 5px; | ||
| + | transition: .25s ease-in-out; | ||
| + | -moz-transition: .25s ease-in-out; | ||
| + | -webkit-transition: .25s ease-in-out; | ||
| + | } | ||
| + | |||
| + | .sidemenu a.greyout { color: #909090; } | ||
| + | |||
| + | .sidemenu a:hover { | ||
| + | color:#666; | ||
| + | background-color: #d9f5aa; | ||
| + | } | ||
| + | |||
| + | .sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;} | ||
| + | .sub-sidemenu a {color: #666;} | ||
| + | |||
| + | div.underconst | ||
| + | { | ||
| + | padding:10px; | ||
| + | border-radius:5px; | ||
| + | background-color:pink; | ||
| + | text-align:center; | ||
| + | } | ||
| + | |||
| + | a.anchor{display: block; position: relative; top: -80px; visibility: hidden;} | ||
| + | |||
| + | .contentpara {margin-bottom: 30px;} | ||
| + | |||
| + | span.email{font-family: monospace; font-weight: normal;} | ||
| + | |||
| + | fieldset {border: 1px solid #337f53;} | ||
| + | |||
| + | .greyout {color: #A0A0A0;} | ||
| + | .highlightme {background-color: #FFFF00;} | ||
| + | |||
| + | #alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;} | ||
| + | #annContainer {margin-left: 8px;} | ||
| + | #newsContainer {border: 1px solid #ccc;} | ||
| + | |||
| + | .newsTitle { | ||
| + | display: block; | ||
| + | color: #414141; | ||
| + | font-size: 25px; | ||
| + | font-family: Georgia, Times, "Times New Roman", serif; | ||
| + | padding: 10px 15px 5px 10px; | ||
| + | border-bottom: 1px solid #ccc; | ||
| + | margin-bottom: 0px; | ||
| + | } | ||
| + | |||
| + | .newsItem { | ||
| + | border-bottom: 1px solid #ccc; | ||
| + | display: block; | ||
| + | padding: 5px 15px 0px 10px; | ||
| + | margin-bottom: 0px; | ||
| + | } | ||
| + | |||
| + | .newsItem h3 { | ||
| + | width: auto; | ||
| + | display: inline; | ||
| + | font-size: 14px; | ||
| + | font-family: Arial, Helvetica, sans-serif; | ||
| + | padding: 0px; | ||
| + | margin: 0px; | ||
| + | } | ||
| + | |||
| + | .newsItem img { | ||
| + | float: right; | ||
| + | clear: right; | ||
| + | width: 80px; | ||
| + | padding-left: 15px; | ||
| + | display: inline-block; | ||
| + | } | ||
| + | |||
| + | .newsItem .newsDate { | ||
| + | font-style: italic; | ||
| + | font-size: 14px; | ||
| + | display: inline-block; | ||
| + | color: #999; | ||
| + | float: right; | ||
| + | padding: 0px 0px 10px 15px; | ||
| + | } | ||
| + | |||
| + | .newsItem p, .newsItem ul, .newsItem li { | ||
| + | padding: 0px; | ||
| + | margin-left: 20px; | ||
| + | font-size: 12px; | ||
| + | line-height: 1.2; | ||
| + | } | ||
| + | |||
| + | .newsItem p {margin-top: 10px;} | ||
| + | |||
| + | .annItem { | ||
| + | border: 2px solid #49b677; | ||
| + | display: block; | ||
| + | padding: 0px 15px 10px 10px; | ||
| + | margin-bottom: 18px; | ||
| + | position: relative; | ||
| + | height: 160px; | ||
| + | vertical-align: middle; | ||
| + | } | ||
| + | |||
| + | .annItem .annCentered { | ||
| + | display: table-cell; | ||
| + | vertical-align: middle; | ||
| + | height: 160px; | ||
| + | } | ||
| + | |||
| + | .annCentered h3 { | ||
| + | padding: 0px; | ||
| + | display: block; | ||
| + | margin-left: auto; | ||
| + | margin-right: auto; | ||
| + | text-align: center; | ||
| + | } | ||
| + | |||
| + | .annItem ul, .annItem li {padding: 0px; margin: 0px;} | ||
| + | .annItem li {list-style: none; margin: 5px} | ||
| + | |||
| + | @charset "utf-8"; | ||
| + | body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{ | ||
| + | margin:0; | ||
| + | padding:0; | ||
| + | font-size: 14px; | ||
| + | text-align: left; | ||
| + | } | ||
| + | html{background-color:#e9ecec} | ||
| + | table{table-layout:fixed;border-collapse:collapse} | ||
| + | section,article,aside,header,footer,nav,dialog,figure{display:block} | ||
| + | .clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both} | ||
| + | body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53} | ||
| + | h1,h2,h3,h4,h5,h6{font-size:100%} | ||
| + | address,cite,dfn,em,var{font-style:normal} | ||
| + | code,kbd,pre,samp{font-family:courier new,courier,monospace} | ||
| + | small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C} | ||
| + | a:hover{text-decoration:underline;color:#06C} | ||
| + | sup{vertical-align:text-top} | ||
| + | sub{vertical-align:text-bottom} | ||
| + | legend{color:#000} | ||
| + | fieldset,img{border:0 none} | ||
| + | button,input,select,textarea{font-size:100%} | ||
| + | table{ | ||
| + | border-collapse:collapse; | ||
| + | border-spacing:0; | ||
| + | text-align: center; | ||
| + | } | ||
| + | input:focus{outline:none} | ||
| + | .hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333} | ||
| + | .f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat} | ||
| + | .hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0} | ||
| + | .hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000} | ||
| + | .hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0} | ||
| + | .hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7} | ||
| + | .hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6} | ||
| + | .hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)} | ||
| + | .hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline} | ||
| + | .hd-main .navs{padding:0 0 3px 25px;height:45px;float:left} | ||
| + | .hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8} | ||
| + | .hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f} | ||
| + | .hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px} | ||
| + | .hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px} | ||
| + | .hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px} | ||
| + | .hd-main .navs .def-nav .app-url .arrow{left:140px} | ||
| + | .hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px} | ||
| + | .hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333} | ||
| + | .hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center} | ||
| + | .hd-main .navs .app-url .li:hover{background-color:#e0e1e5} | ||
| + | .hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat} | ||
| + | .hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')} | ||
| + | .hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0} | ||
| + | .hd-main .navs .app-url .xiangce .icon{background-position:-100px 0} | ||
| + | .hd-main .navs .app-url .note .icon{background-position:-150px 0} | ||
| + | .hd-main .navs .app-url .duanxin .icon{background-position:-200px 0} | ||
| + | .hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0} | ||
| + | .hd-main .navs .app-url .youxi .icon{background-position:-300px 0} | ||
| + | .hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"} | ||
| + | .hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D} | ||
| + | .hd-main .navs .pulldown-nav{position:relative} | ||
| + | .hd-main .navs .pulldown-nav em{ | ||
| + | position:absolute; | ||
| + | display:block; | ||
| + | left:99px; | ||
| + | top:18px; | ||
| + | height:12px; | ||
| + | width:12px; | ||
| + | font-size:0; | ||
| + | background-position:-89px -45px | ||
| + | } | ||
| + | .hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px} | ||
| + | .hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px} | ||
| + | .hd-main .navs .current:hover{color:#ECECEC} | ||
| + | .hd-main .navs .current .hover{background-color:#dedede;color:#333;} | ||
| + | .hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap} | ||
| + | .hd-main .info a{color:#d8d8d8} | ||
| + | .hd-main .info a:hover{color:#FFF;text-decoration:underline} | ||
| + | .hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"} | ||
| + | .hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0} | ||
| + | .hd-main .info .has-pulldown{padding-right:28px} | ||
| + | .hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px} | ||
| + | .hd-main .info .no-separate{border:none} | ||
| + | .hd-main .info .user-name{position:relative;padding-left:24px} | ||
| + | .hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom} | ||
| + | .hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px} | ||
| + | .hd-main .info .user-name .is-vip{background-position:-89px -68px} | ||
| + | .hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/ | ||
| + | .hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal} | ||
| + | .hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/ | ||
| + | .hd-main .info .user-info .arrow{left:70px;*left:-32px} | ||
| + | .hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px} | ||
| + | .hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none} | ||
| + | .hd-main .info .more-info .content{height:150px} | ||
| + | .hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888} | ||
| + | .hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5} | ||
| + | .hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px} | ||
| + | .hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid} | ||
| + | .hd-main .info .more-info{right:0} | ||
| + | .hd-main .info .more-info .arrow{left:94px;*left:-8px} | ||
| + | #apDiv1 { | ||
| + | position:absolute; | ||
| + | left:3px; | ||
| + | top:4px; | ||
| + | width:100%; | ||
| + | height:900px; | ||
| + | z-index:0; | ||
| + | background-color: #66CCFF; | ||
| + | } | ||
| + | /*<![CDATA[*/ | ||
| + | body { | ||
| + | margin:0; | ||
| + | padding:0 10px 0 10px; | ||
| + | border:0; | ||
| + | height:100%; | ||
| + | overflow:auto; | ||
| + | background-color: #FFF; | ||
| + | } | ||
| + | #menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);} | ||
| + | * html #menu {position:absolute; right:16px; top:0;}/*only for ie*/ | ||
| + | html {overflow:auto !important; overflow:hidden;} | ||
| + | |||
| + | #apDiv2 { | ||
| + | position:absolute; | ||
| + | left:0; | ||
| + | top:50px; | ||
| + | width:100%; | ||
| + | height:265px; | ||
| + | z-index:0; | ||
| + | background-color: #187BDB; | ||
| + | } | ||
| + | #apDiv3 { | ||
| + | position:absolute; | ||
| + | left:0px; | ||
| + | top:328px; | ||
| + | width:100%; | ||
| + | height:150px; | ||
| + | z-index:0; | ||
| + | } | ||
| + | #apDiv3 table tr td p { | ||
| + | font-size: 15px; | ||
| + | text-align: left; | ||
| + | } | ||
| + | #apDiv4 { | ||
| + | position:absolute; | ||
| + | left:0; | ||
| + | top:9704px; | ||
| + | width:100%; | ||
| + | height:56px; | ||
| + | z-index:0; | ||
| + | } | ||
| + | #apDiv5 { | ||
| + | position:absolute; | ||
| + | left:0; | ||
| + | top:6288px; | ||
| + | width:100%; | ||
| + | height:25; | ||
| + | z-index:1; | ||
| + | background-color: #5FC1C5; | ||
| + | } | ||
| + | #apDiv3 div { | ||
| + | font-size: 46px; | ||
| + | text-align: center; | ||
| + | } | ||
| + | #apDiv4 table tr td div { | ||
| + | font-size: 45px; | ||
| + | color: #000; | ||
| + | text-align: left; | ||
| + | } | ||
| + | #apDiv4 table tr td table tr td { | ||
| + | font-size: 16px; | ||
| + | line-height: 30px; | ||
| + | } | ||
| + | body,td,th { | ||
| + | color: #000; | ||
| + | } | ||
| + | #apDiv6 { | ||
| + | position:absolute; | ||
| + | left:575px; | ||
| + | top:6177px; | ||
| + | width:220px; | ||
| + | height:221px; | ||
| + | z-index:2; | ||
| + | } | ||
| + | #apDiv2 table tr td p { | ||
| + | font-size: 45px; | ||
| + | text-align: center; | ||
| + | color: #FFF; | ||
| + | font-weight: bold; | ||
| + | } | ||
| + | #apDiv7 { | ||
| + | position:absolute; | ||
| + | left:50%; | ||
| + | top:226px; | ||
| + | width:257px; | ||
| + | height:151px; | ||
| + | z-index:auto; | ||
| + | } | ||
| + | #apDiv3 div { | ||
| + | font-size: 14px; | ||
| + | } | ||
| + | #apDiv8 { | ||
| + | position:absolute; | ||
| + | left:0; | ||
| + | top:680px; | ||
| + | width:100%; | ||
| + | height:470px; | ||
| + | z-index:0; | ||
| + | } | ||
| + | #apDiv4 table tr td table tr td p { | ||
| + | font-size: 18px; | ||
| + | line-height: 32px; | ||
| + | } | ||
| + | #apDiv8 table tr td table tr td { | ||
| + | font-size: 45px; | ||
| + | } | ||
| + | #apDiv8 table tr td table tr td p { | ||
| + | font-size: 18px; | ||
| + | line-height: 31px; | ||
| + | } | ||
| + | #apDiv9 { | ||
| + | position:absolute; | ||
| + | left:0px; | ||
| + | top:6251px; | ||
| + | width:100%; | ||
| + | height:55px; | ||
| + | z-index:4; | ||
| + | } | ||
| + | #apDiv9 table tr td table tr td table tr td { | ||
| + | font-size: 35px; | ||
| + | } | ||
| + | #apDiv9 table tr td table tr td table tr td p { | ||
| + | font-size: 18px; | ||
| + | line-height: 31px; | ||
| + | } | ||
| + | #apDiv4 table tr td table tr td div div { | ||
| + | font-size: 15px; | ||
| + | } | ||
| + | #apDiv4 table tr td table tr td table tr td { | ||
| + | font-size: 15px; | ||
| + | } | ||
| + | #apDiv4 table tr td table tr td table tr td { | ||
| + | font-size: 15px; | ||
| + | } | ||
| + | #apDiv8 table tr td table tr td table tr td { | ||
| + | font-size: 18px; | ||
| + | } | ||
| + | #apDiv10 { | ||
| + | position:absolute; | ||
| + | left:0; | ||
| + | top:6956px; | ||
| + | width:1004px; | ||
| + | height:539px; | ||
| + | z-index:5; | ||
| + | } | ||
| + | #apDiv9 table tr td table tr td table tr td table tr td { | ||
| + | font-size: 18px; | ||
| + | } | ||
| + | #apDiv11 { | ||
| + | position:absolute; | ||
| + | left:0; | ||
| + | top:7440px; | ||
| + | width:100%; | ||
| + | height:140px; | ||
| + | z-index:5; | ||
| + | } | ||
| + | #apDiv11 table tr td table tr td { | ||
| + | font-size: 35px; | ||
| + | } | ||
| + | #apDiv11 table tr td table tr td p { | ||
| + | font-size: 18px; | ||
| + | line-height: 32px; | ||
| + | } | ||
| + | #apDiv11 table tr td table tr td table tr td { | ||
| + | font-size: 18px; | ||
| + | } | ||
| + | #apDiv3 table tr td { | ||
| + | font-size: 18px; | ||
| + | line-height: 32px; | ||
| + | } | ||
| + | #apDiv8 table tr td table tr td div { | ||
| + | text-align: center; | ||
| + | } | ||
| + | #apDiv8 table tr td table tr td div { | ||
| + | } | ||
| + | </style> | ||
| + | </head> | ||
| + | |||
| + | <body id="" class=""> | ||
| + | <div id="apDiv2"> | ||
| + | <table width="100%" border="0" > | ||
| + | <tr> | ||
| + | <td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td> | ||
| + | <td width="100%" height="199" bgcolor="#187ADB"> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td height="70"> </td> | ||
| + | </tr> | ||
| + | </table> | ||
| + | </div> | ||
| + | <div id="apDiv3"> | ||
| + | <table width="100%" border="0"> | ||
| + | <tr> | ||
| + | <td width="25%"> </td> | ||
| + | <td><p> </p> | ||
| + | <p> </p> | ||
| + | <p> "Rome was not built in a day." No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <div><a href="https://2014.igem.org/Team:LZU-China/Notebook"><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /></a> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /></a><a href="https://2014.igem.org/Team:LZU-China/NotebookC"><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></a></div> | ||
| + | <p> </p></td> | ||
| + | <td width="25%"> </td> | ||
| + | </tr> | ||
| + | </table> | ||
| + | <p> </p> | ||
| + | </div> | ||
| + | <p> </p> | ||
| + | <table width="100%" border="0" align="center"> | ||
| + | <tr> | ||
| + | <td width="20%"> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td width="20%"> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td width="20%"> </td> | ||
| + | </tr> | ||
| + | </table> | ||
| + | </div> | ||
| + | <div id="apDiv5"> | ||
| + | <table width="1365" border="0""> | ||
| + | <tr> | ||
| + | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td> | ||
| + | </tr> | ||
| + | </table> | ||
| + | </div> | ||
| + | <div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div> | ||
| + | <div id="apDiv8"> | ||
| + | <p> </p> | ||
| + | <table width="100%" border="0"> | ||
| + | <tr> | ||
| + | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p> </p> | ||
| + | <p> </p> | ||
| + | <table width="100%" border="0" > | ||
| + | <tr> | ||
| + | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" > THE NOTEBOOK OF WET LAB GROUP A</td> | ||
| + | </tr> | ||
| + | </table></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0"> | ||
| + | <tr> | ||
| + | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"> </td> | ||
| + | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p> </p> | ||
| + | <p> </p> | ||
| + | <p> 2014.5.16-5.23<br /> | ||
| + | The pre-experience of the growth of three strains(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li’s lab )in different PNP concentration and Cr(VI) concentration.</p> | ||
| + | <p> </p> | ||
| + | <p> <img src="https://static.igem.org/mediawiki/2014/f/f5/Z.da1.png" width="700" height="173" /></p> | ||
| + | <div><img src="file:///E|/[iGEM]/wiki/2014logomin.png" width="358" height="40" /></div> | ||
| + | <p> </p> | ||
| + | <p> <img src="file:///E|/https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="301" height="251" /></p> | ||
| + | <div><img src="file:///E|/[iGEM]/wiki/partpic2.png" width="301" height="251" /></div> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> 2014.5.24-5.31<br /> | ||
| + | Measurement for three strains’(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li’s lab ) Cr(VI) reduction activity.</p> | ||
| + | <div><img src="file:///E|/[iGEM]/wiki/dblbluebar.jpg" alt="" width="1365" height="463" /></div> | ||
| + | <p> </p> | ||
| + | <p> <img src="https://static.igem.org/mediawiki/2014/thumb/d/dc/Z.a2.png/463px-Z.a2.png" width="467" height="605" /></p> | ||
| + | <p> </p> | ||
| + | <p> 2014.6.1-2014.6.8<br /> | ||
| + | 1.Another measurement for three strains’(as above said) Cr(VI) reduction activity.</p> | ||
| + | <p> <img src="https://static.igem.org/mediawiki/2014/a/a6/Z.a3.png" width="569" height="482" /></p> | ||
| + | <p> </p> | ||
| + | <p> 2.Construction of the phylogeny tree containing the LZU-3 </p> | ||
| + | <p> <img src="https://static.igem.org/mediawiki/2014/5/52/Z.4.png" width="654" height="503" /></p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> 2014.6.8-2014.7.24<br /> | ||
| + | The PCR cycling for BBa_I723020 and BBa_I723133</p> | ||
| + | <p> </p> | ||
| + | <p> 1. The primers(synthesized by BGI,shenzhen)</p> | ||
| + | <p> 1.1 Promoter of BBa_I723133 <br /> | ||
| + | The forward primer (5’ TATACTAGTCTGGGGCGAGAGGCGACGAC 3’) contained a SpeI cutsite <br /> | ||
| + | The reverse primer (5’ GGGGAATTCTAGAATGTGGGCTGCTTGGTG 3’) contained a EcoRI and XbaI cutsite. <br /> | ||
| + | 2313bp</p> | ||
| + | <p> 1.2 BBa_I723020<br /> | ||
| + | The forward primer (5’GGTGCTGCAGACTAGTATTGAAGGGTCACCACTATTTTTATTTTA 3’) containes SpeI and PstI cutsites <br /> | ||
| + | the reverse primer (5’ ATGAATTCTCTAGACCTGCTGGAGGGCGTGAAC 3’) containes EcoRI and XbaI cutsites. <br /> | ||
| + | 340bp</p> | ||
| + | <p> </p> | ||
| + | <p> 2.The PCR system</p> | ||
| + | <p> 0.2μL ExTaq.<br /> | ||
| + | 1μL bacterial liquid<br /> | ||
| + | 1μL dNTP<br /> | ||
| + | 1μL forward primer<br /> | ||
| + | 1μL reverse primer<br /> | ||
| + | 2.5μL 10x Buffer<br /> | ||
| + | 18.5μL ddH2O</p> | ||
| + | <p> </p> | ||
| + | <p> 2014.7.31-8.1<br /> | ||
| + | Pre-experience for the function of BBa_K381001.<br /> | ||
| + | BBa_K381001 transformation to E.coli DH5 alpha<br /> | ||
| + | There are two groups to test the green fluorescence under microscope:<br /> | ||
| + | (These groups' total sizes are all 20μL, had been shaken for 2hours before observation,400x)<br /> | ||
| + | a.bacterial liquid with 10mM PNP concentration.<br /> | ||
| + | b.bacterial liquid with 20mM PNP concentration.<br /> | ||
| + | </p> | ||
| + | <p> <img src="https://static.igem.org/mediawiki/2014/2/2d/Z.5.png" width="704" height="307" /></p> | ||
| + | <p> </p> | ||
| + | <p> 2014.8.2-2014.8.6<br /> | ||
| + | Pre-experience for the function of BBa_K381001.<br /> | ||
| + | BBa_K381001 transformation to E.coli DH5 alpha<br /> | ||
| + | There are four groups to test the green fluorescence under microscope:<br /> | ||
| + | (These groups' total sizes are all 20μL, had been shaken for 2hours before observation,1000x)<br /> | ||
| + | a.bacterial liquid with 10mM PNP concentration.b.<br /> | ||
| + | b.bacterial liquid with ddH2O<br /> | ||
| + | c.bacterial liquid with 10mM KNO3<br /> | ||
| + | d.bacterial liquid with 10mM KCl.<br /> | ||
| + | </p> | ||
| + | <p> <img src="https://static.igem.org/mediawiki/2014/4/41/Z.a6.png" width="455" height="340" /></p> | ||
| + | <p> </p> | ||
| + | <p> 2014.8.25-9.21<br /> | ||
| + | 1.Construction of BBa_K1523101<br /> | ||
| + | </p> | ||
| + | <p> <img src="https://static.igem.org/mediawiki/2014/2/28/Z.a7.png" width="489" height="90" /></p> | ||
| + | <p> </p> | ||
| + | <p> The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5'---TTCCCATCTATAATCCTCCCTGATTCTTCG---3';anti-sense:5'---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3'). From the gel picture we can see the size is right.</p> | ||
| + | <p> <img src="https://static.igem.org/mediawiki/2014/c/cf/Z.a8.png" width="643" height="305" /></p> | ||
| + | <p> </p> | ||
| + | <p> 2.Construction of BBa_K1523024(yieF) and BBa_K1523005(chrR)</p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> 2014.9.21-10.2<br /> | ||
| + | Construction of BBa_K1523021(<em>nahR</em>), K1523022(<em>nahE</em>) and K1523023(<em>nahG</em>).</p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> </p> | ||
| + | <p> | ||
| + | <p> | ||
| + | <p> | ||
| + | <p> | ||
| + | <p> | ||
| + | <p> | ||
| + | <p> </td> | ||
| + | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%"> </td> | ||
| + | </tr> | ||
| + | </table></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p> </p> | ||
| + | <p> </p></td> | ||
| + | </tr> | ||
| + | </table> | ||
| + | </div> | ||
| + | <div > | ||
| + | <div style=" height:890px;"> </div> | ||
| + | <div id="menu"> | ||
| + | <script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script> | ||
| + | <script type="text/javascript"> | ||
| + | $(document).ready(function(){ | ||
| + | $(".def-nav,.info-i").hover(function(){ | ||
| + | $(this).find(".pulldown-nav").addClass("hover"); | ||
| + | $(this).find(".pulldown").show(); | ||
| + | },function(){ | ||
| + | $(this).find(".pulldown").hide(); | ||
| + | $(this).find(".pulldown-nav").removeClass("hover"); | ||
| + | }); | ||
| + | }); | ||
| + | </script> | ||
| + | <div class="hd-main clearfix" id="header"> | ||
| + | <a class="logo" href="https://2014.igem.org/Team:LZU-China"></a> | ||
| + | <div class="navs"> | ||
| + | <a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a> | ||
| + | <span class="separate"></span> | ||
| + | <div class="def-nav current has-pulldown-special"> | ||
| + | <a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a> | ||
| + | <div class="pulldown app-url"> | ||
| + | <div class="content"> | ||
| + | <a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"> | ||
| + | <span class="icon"></span> | ||
| + | <span class="text">Background</span> | ||
| + | </a> | ||
| + | <a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"> | ||
| + | <span class="icon"></span> | ||
| + | <span class="text">Wet Lab</span> | ||
| + | </a> | ||
| + | <a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"> | ||
| + | <span class="icon"></span> | ||
| + | <span class="text">Dry Lab</span> | ||
| + | </a> | ||
| + | <a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"> | ||
| + | <span class="icon"></span> | ||
| + | <span class="text">Parts</span> | ||
| + | </a> | ||
| + | <a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"> | ||
| + | <span class="icon"></span> | ||
| + | <span class="text">Interlab</span> | ||
| + | </a> | ||
| + | <a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"> | ||
| + | <span class="icon"></span> | ||
| + | <span class="text">Future Work</span> | ||
| + | </a> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | <span class="separate"></span> | ||
| + | <a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a> | ||
| + | <span class="separate"></span> | ||
| + | <a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a> | ||
| + | <span class="separate"></span> | ||
| + | <a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a> | ||
| + | </div> | ||
| + | <div class="info"> | ||
| + | <ul> | ||
| + | <li class="info-i user-name has-pulldown"> | ||
| + | <em class="f-icon pull-arrow"></em> | ||
| + | <a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a> | ||
| + | <span class="name top-username">Our Team</span> | ||
| + | <div class="pulldown user-info"> | ||
| + | <em class="arrow"></em> | ||
| + | <div class="content"> | ||
| + | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span> | ||
| + | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span> | ||
| + | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span> | ||
| + | <span class="separate-li no-height"></span> | ||
| + | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span> | ||
| + | <span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span> | ||
| + | <span class="separate-li no-height"></span> | ||
| + | </div> | ||
| + | </div> | ||
| + | </li> | ||
| + | <li class="info-i no-separate default-text has-pulldown"> | ||
| + | <em class="f-icon pull-arrow"></em> | ||
| + | <span class="more" hideFocus="hideFocus">More</span> | ||
| + | <div class="pulldown more-info"> | ||
| + | <em class="arrow"></em> | ||
| + | <div class="content"> | ||
| + | <span class="separate-li no-height"></span> | ||
| + | <span class="li"><a href="">Team Profile</a></span> | ||
| + | <span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span> | ||
| + | <span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span> | ||
| + | </div> | ||
| + | </div> | ||
| + | </li> | ||
| + | </ul> | ||
| + | </div> | ||
| + | </div> | ||
| + | <div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"> | ||
| + | <div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"> | ||
| + | </div> | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | </div> | ||
| + | </div> | ||
| + | </body> | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | <script type="text/javascript"> | ||
| + | function MM_showHideLayers() { //v9.0 | ||
| + | var i,p,v,obj,args=MM_showHideLayers.arguments; | ||
| + | for (i=0; i<(args.length-2); i+=3) | ||
| + | with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2]; | ||
| + | if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; } | ||
| + | obj.visibility=v; } | ||
| + | } | ||
| + | </script> | ||
Revision as of 03:01, 17 October 2014
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
|
"Rome was not built in a day." No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.
  
|
 |
|
|||
|
|||
|
