Aug 24

Sensor construction bphR2/PbphR1 :

Miniprep of pSB1C3 was done => 68,9ng/µl and the plasmid was digested with EcoRI-HF and pstI.
Digestion products of pSB1C3 and bphr2 has been migrated on gel 1X agarosis. Bands expected were:

• for pSB1C3: one band at 2069bp (vector) and one band at 1070bp (insert)
  
• for bphr2: one band at 946 pb (insert) and one band at 1300bp (vector)

We obtained the good bands so an extraction on gel was done to recover only pSB1C3 without its insert and only bphr2 gene.

Aug 23

Transformation plate observation:
- BBa_E1010: 50-60 colonies
- BBa_J23114: 150-200 colonies
- BBa_B0015: 40-50 colonies
- PSB1C3G3: > 1000 red colonies

A PCR was performed on 8 colonies for BBa_J23115 (K823012) following the protocol Table 3 and 4.
Samples are loaded on a 1% agarose gel, 10 µL of sample + 2 µl of loading dye 6X per well. Gel ran 45 minutes at 100 mV.


Sensor construction bphR2/PbphR1 :
One colony of the transformation of pSB1C3 was incubated in 3ml LB + 3µL Cam, at 37°C, overnight

Aug 22

Sensor construction bphR2/PbpR1
BBa_J23114 was resuspended with 10 µL sterile water in order to obtain a DNA concentration around 0.2 ng/µl (according to the registry). Solution was transferred into one 1 ml eppendorf tube and stored at -20°C.
Transformations of constitutive promoter BBa_J23114, RFP BBa_E1010 and terminator BBa_B0015 and vector pSB1C3G3 was done on DH5alpha as followed:

1. Remove E. coli competent tubes from -80°C and keep it on ice
2. Add 3 µl of template (here solubilized plasmids from the registry distribution kit) and mix gently
3. Incubate 10 minutes on ice
4. Perform an heat shock 30 seconds at 42°C
5. Incubate 2 minutes on ice
6. Add 2 ml of LB medium and incubate 60 minutes at 37°C with an agitation at 200 rpm
7. Plate 200 µl of pSB1C3G3, BBa_B0015 and E1010 on a chloramphenicol LB agar plate and ampicilline LB agar plate for BBa_J23114
8. Incubate plate overnight at 37°C

We received primers.

pSB1C3 was digested with EcoRI and pstI and a ligation with bphR2 was done before the transformation in DH5a.
50 µL were plated on Cam Lb plate and incubated at 37°C overnight

Aug 21

Sensor construction bphR2/PbphR1
We received sequencing reads: that match perfectly to the registry sequence.
26DJ54
AATAGGCGTTATCACGAGGCAGAANTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATGTCCCTGG GTGACATGCGTGATTTGGCCGCCACGCGGATCGCGCTCGAGAGCGAAGCGTTACGCCAAAGCGTGCTGAATGGTGACGCTGAATGGGAGGCGCGGATCGTCAGTTC GTTTCACCGACTGTCATTGATTGAAGAGCCCACGATGCGGGATCCGGCTCGCTGGTTTAATGAGTGGGAGCCAGTCAACCGCGGTTTTCACGAAGCTCTTATCTCT GCCTGTTCGTCCGTCTGGATCCGGCGGTTCCTGTCCATCCTGTATGTGCATATGGAGCGCTACCGCCGATTGACTGCTTACTAGTAGCGGCCGCTGCAGTCCGGCA AAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTC GGCTGCGGCGAGCGGTATCA GCTCACTCAGGG

26DJ55
CGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGTTTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGC AGCGGCCGCTACTAGTAAGCAGTCAATCGGCGGTAGCGCTCCATATGCACATACAGGATGGACAGGAACCGCCGGATCCAGACGGACGAACAGGCAGAGATAAGAG CTTCGTGAAAACCGCGGTTGACTGGCTCCCACTCATTAAACCAGCGAGCCGGATCCCGCATCGTGGGCTCTTCAATCAATGACAGTCGGTGAAACGAACTGACGAT CCGCGCCTCCCATTCAGCGTCACCATTCAGCACGCTTTGGCGTAACGCTTCGCTCTCGAGCGCGATCCGCGTGGCGGCCAAATCACGCATGTCACCCAGGGACATC TCTAGAAGCGGCCGCGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGGATTTTTTTTATCTGAAATTCTGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCA TGATAATAATGGTTTCTTAGA


Plasmid with bphR2 gene was purified with NucleoSpin Plamsid protocol (Macherey-Nagel) => we obtained 227,5ng/µL
This plasmid was digested according this protocol:

1. Add:
   • sterilized water: qsp 20µL
   • template DNA : 500ng
   • buffer 2.1: 2µL
   • BSA: 0,2µL
   • EcoRI: 1µL
   • PstI: 1µL
2. Reverse for mix
3. Incubate at 37°C during 45mn
4. Incubate at 80°C during 20mn
5. Ligation was not possible because pSB1C3 plasmid was not digested so the digested plasmid (bphR2 gene) was stored at -20°C

Survival test on E.coli BL21:
Bacteria survive again for different concentrations but they were very concentrated

A dilution of the medium has been done for the positive control and the six different concentrations:

Aug 20

Sensor construction bphR2/PbphR1:
A colony after the DH5a transformation was cultured in 3mL of LB + 3µL Amp, at 37°C, 200rpm, overnight

Survival test on E.coli BL21:
Bacteria continue to grow for all concentrations of 2 hydroxy-3',4'dichlorobiphenyl.

Aug 19

Sensor construction bphR2/PbphR1:

bphR2 gene, synthetized by Eurofins in a plasmid, was dissolved in 23,5µL of elution buffer because it was lyophilized.
Concentration obtained = 200ng/µL

DH5a chimiocompetents were transformed with this plasmid according to this protocol:

1. Remove DH5a from -80°C (about 200µL) and let them on the ice
2. Add 100ng of plasmid at DH5a and let during 30mn on ice
3. Make a heat shock by putting bacteria at 42°C during 30s-1mn
4. Let 1h at 37°C
5. Plate 100µL of the culture on LB-agar-Amp
6. Incubate at 37°C overnight, 200rpm

Aug 18

Aug 17

Survival test on E.coli BL21:

After the incubation of 15th July, bacteria had grown:

Aug 16

Cell culture of E.coli received from registry
BBa_K1031211 (Pr-DmpR )
BBa_K1031221 (P0-RBS B0031-GFP)
BBa_k1031222 (P0-RBS B0032-GFP)
Liquid : 3ml of Luria Broth 1x + 34µg/L Chloramphenicol in a 15ml falcon at 37°C shaking
On plate : 25ml LB 1x + 25ml Agarose 1x + 34µg/L Chloramphenicol
Observation: DmpR bacteria have difficulties to grow compared with GFP bacteria

Left : BBa_K1031221 (P0-RBS B0031-GFP)
Right : BBa_k1031222 (P0-RBS B0032-GFP)

Aug 15

Survival test on E.coli BL21:

1. Serial dilution of compound was made from 10(-2) mol/L to 10(-8) mol/L
   
2. 300µL of E.coli BL21 were added in each eppendorf tube.
   We had 2 control tubes:
   
   • A negative control which contains 2,7mL of M9 medium + 300µL of compound
   • A positive control which contains 2,7mL of M9 medium + 300µL of E.coli BL21
   
   
3. Tubes were incubated at 37°C overnight, 200rpm
   Aug 15

Survival test on E.coli BL21:

This test allowed to know if E.coli can survive at different concentrations of 2 hydroxy-3',4'dichlorobiphenyl

1. For that, BL21 culture was removed from the -80°C and culturing in 4 mL of LB
2. E.coli was incubated overnight at 37°C, 200rpm

Aug 14

Survival test on E.coli BL21:
10mg of 2 hydroxy,3'-4'dichlorobiphenyl have been received. The compound was lyophilized so it's has been dissolved in 17mL of DMSO in order to have a final concentration of 10(-2)M
The compound was stored at -20°C, in the dark because the DMSO is sensitive to the light.

Aug 13

Aug 12

Aug 11

Aug 10

Aug 9

Aug 8

Aug 7

Aug 6