Transposon

Transposons, known as mobile elements or transposable elements, are DNA sequences able to move randomly within the genome. This phenomenon is based on different transposition mechanisms. One of them, the cut-and-paste mechanism, requires an enzyme named transposase. Transposases bind to the end of transposons sequences, which consist of inverted repeats and then catalyze the excision and insertion of the transposons into the genome.

Fig. 1 General transposon mechanism
1. The transposable element, surrounded by IS sequence is "cut-and-paste" from a locus to another thanks to the transposase (arrow). 2. Insertion of the transposon occurs randomly in the genome

Transposase Tn10 / IS10

The complex Tn10/IS10 is involved in the non-replicative cut-and-paste mechanism. The transposable segment is excised at its ends and is then re-inserted randomly in a DNA site.

The Tn10 transposase protein is made of 402 amino-acids, which recognises inverted repeats insertion sequence; Is10-right and Is10-left. The Tn10 protein expression is strongly regulated by various positive and negative regulation mechanisms.

IS 10 is an insertion sequence composing the transposon Tn10. The two IS10 elements, IS10-Right and IS10-Left, contain all of the Tn10 encoded genetic determinants; as the coding region of the transposase protein Tn10. The two ends of IS-10 have a similar terminal inverted repeat of 23 bp, corresponding to the transposase binding site. However, some genetic drifts occurring between both of these sequences caused variation in their functionality. Indeed, IS10-right is fully functional while IS10-left is partially functional.

Our project

We tested different plasmids and methods to transform Pseudovibrio denitrificans but yet unsuccessfully. Thus, the integration in the genome was tested. Doctor Brian Jester gave us the pNK2 plasmid and DH5α pir cells. In fact, the plasmid pNK2 contains a particular origin of replication OriVR6Kgamma. This ORI VR6K gamma is controlled by the pi protein, which is encoded by the pir gene. Indeed, the pi protein allows the replication of the plasmid by binding a particular site in the ORI sequence. Hence, the oriVR6K gamma can only be replicated in a bacterial strain producing the pi protein. This ori was already used in the iGEM competition in 2009 by a french team. The gamma origin is adjacent to the pi protein binding site and other sites bounded by the host cell proteins involved in its own reproduction.

Fig. 2 Plasmid map of pNK2-CRPIIh
The plasmid is 6,356 bp long and annotated. It contains the transposase Tn10 and the origin of replication oriVR6K. The sequence including the antibiotic resistance cassette kanR, and the mGFP gene is surrounded by IS sites. Restriction sites used by the registry are encircled by red rectangle.

Insertion of transposon

1. Transformation Pseudovibrio denitrificans with pNK2
   
   The plasmid pNK2 is tested in Pseudovibrio denitrificans. For this the cells is transformed by electroporation. The selection of cells is made in medium marine broth 1X with kanamycine 50µg/mL. In fact Pseudovibrio denitrificans can survive with kanamycine 25µg/mL. (Sensitivity to antibiotics)
   
   
   
2. Phenotypic verification
   
   
   
   Fig. 3 Image of Pseudovibrio denetrificans colonies in a petridish containing kanamycin. Pseudovibrio denetrificans were previously transformed with the pNK2-CRPIIh plasmid.
   A kinetic of Pseudovibrio transformed is made.
   
   
   
3. Genotypic verification
   
   
   a) Amplification of transposon
   
   The transposon in pNK2 there is kanamycin gene. So we used PCR to amplify this gene.
   There is an amplification of the gene in the cells transformed. All sequences them amplified come from ADNg and not from plasmid.
   We obtains this gel for 15 colonies of Pseudovibrio denitrificans.
   It's first verification.
   
   
   b) Sequencing of 16S
   
   The amplification of transformed cells with primer 16S, which amplified the sequence of the ribosome 16S. The PCR product is purified and send to sequence.
   This sequencing proves that it's Pseudovibrio which is transformed, and which have integrated the transposon.
   
   
   c) Amplification of specific sequence of Pseudovibrio denitrificans
   After the results of sequencing of Pseudovibrio denitrificans, a specific sequence of this strain have been discovered.
   This sequence is the following (read of 1000 bp):
   
   
   GACGGTGTCATTGATCTGGATAATGTCAACGAGCAGACCGGATCTTATCAGTTTGTCGGTGATGATGGGTTTGATACGGCAGGGCGCAGTATCTCTTCAGCTGGTGATG
   TTGATGGTGATGGTAAGGATGATCTGCTCATCGGTGCTGCGAATGCTAATGGTAGTGGTGCCAACCAAGGATCCGCTTCAGGGGCTGCTTATCTGATGACGGCTTCTGCACTA
   GCAGCCGCTGATGCCGCTGACGGCACCACTGATGGTGTTATTGATTTGGGTAATGTCAATGAGCAGACTGGATCTTATCAGTTCAATGGTACAGAAGTAATGGACCAAGCCGG
   AACTCGTGTAACATCTGCAGGCGATGTGGATGGCGATGGCAAAGATGATGTCTTTATCAGCAGCATTTTTGCAGATGATGGCGGCTCCAGTTCTGGTGAAGCATATTTGCTGA
   CAGCTGCTGCTATGGCTTCAGCTGATGCCGCTGACGGCACTACTGACGGCATCATTGATTTGGACAATGTCAATGAGCAAACCAACTCTTATCAGTTTGTTGGCACCCAAGCA
   GATGACCTGGCCGGCATTGATATCTCAGCTGCTGGTGATGTTGATGGCGATGGCAAAAATGACTTCTTGATCGGTGCTCGGGCAGCAGATGGTGGCGGCGCTGGCTCGGGTGA
   GGCCTATCTGTTGACTGCAGCAGCACTTGCTTCAGCTGATGCAGCTGATGGCACCACTGATGGGATTATCGATCTAGATAATGTCAATGAGCAGACTAACTCTTATCAGTTCG
   TTGGTACGGAAGTTGGCGATGATGCGGGAATTAGCGTGTCATTTGTCGGTGATGTTGACAATGATGGTAAGGACGATCTGTTGATTGGTGCACGTAATGCTGACGGCGGTGGC
   TCCAACTCTGGTGAAGCCTATCTAATGTCTATTGCTTCACTGGCGACTGCTGATGCAGCTGATGGCACCATTGATGGTGTTATCGATTTGGAT
   
   d) Integration of transposon in Pseudovibrio denitrificans
   Dans cette partie nous cherchons à montrer qu'il y a bien eut une intégration de manière aléatoire dans le génome.Pour cela la technique d'inverse PCR est utilisée.
   paragraphe romain sur l'image
   
   
   The transformation of Pseudovibrio denitrificans have been verified by the phenotype and the genotype. Now we know that transposas is fonctionel for our bacteria. c
   
   
   

   Creation of Transposon Plasmid

   The second part consists in introduce our construction in this plasmid. The probleme is that our plasmid have some biobrick restriction site. So we decided to build our plasmid name Transposon plasmid without biobrick restriction site.
   Voici le schema de notre projet.
   Il s'agit de construire un merge entre pSB1C3 et pNK2. Cela permettra d'amplifier notre plasmide de la transposas dans des cellules non pir, mais aussi d'envoyer notre plasmide sous format biobrick. Le plasmide pSB1C3 nous sert ici de backbone.
   Pour séparer les 2 plasmides ont pourra digérer le merge avec BglII et extraire sur gel notre Transposon Plasmid. Ce dernier plasmid ne contient que les éléments essentiel pour la transposition. Entre les 2 élèment transposeble iS10 nous intégrons le prefix et suffix iGEM afin de pouvoir intégrer dans le génome toutes les biobricks.
   
   Premièrement il s'agira d'amplifier et d'assembler chaque éléments par Golden Gate.
   
   1. Mutation de l'oRiVR6Kgamma Le premier soucis est que l'origine de réplication OriVR6Kgamma contient un site de restriction XbaI. Aussi avant de l'amplifier avec les overahang golden gate, il s'agira de muter ce site dans le plasmide directement par PCR mutagenese.
      Le plasmid pNK2 est donc amplifier avec des primers permettant de modifier le site XbaI : 5' TCTAGA 3' en 5' ACTAGA 3'.
      Après amplification du plasmid, purification du produit de PCR et transformation plusieurs colonies sont obtenues. Plusieurs colonies sont mis en culture en milieu de sélection Kanamycine (50µg/mL) et le plasmide pNK2 est extrait. Ces plasmides sont digéré par XbaI afin de vérifier si le site a été muté.