Team:KIT-Kyoto/Notebook/Protocol
From 2014.igem.org
(Difference between revisions)
Line 710: | Line 710: | ||
<li>Mix DNA sample and DNA ligase in a sample tube gently | <li>Mix DNA sample and DNA ligase in a sample tube gently | ||
</li> | </li> | ||
- | <li>Ligation for | + | <li>Ligation for 15 minutes at room temperature |
</li> | </li> | ||
</ul> | </ul> |
Revision as of 08:39, 14 October 2014
Protocol
Miniprep
Materials
Buffer 1 | 250μL |
Buffer 2 | 250μL |
Buffer 3 | 350μL |
Buffer 4 | 500μL |
Buffer 5 | 700μL |
Distilled water | 100μL |
Sample |
Procedure
- Suspend the sample in buffer 1 (1.5 ml sample tube)
- Add buffer 2 to the sample and mix it
- Add buffer 3 to the sample and mix it
- Centrifuge for 5 minutes at 13,000 rpm and apply the supernatants to the column
- Add buffer 4 and centrifuge for 1 minute at 13,000 rpm then throw away the filter paper
- Add buffer 5 and centrifuge for 1 minute at 13,000 rpm then throw away the filter paper
- Centrifuge again for 1 minute at 13,000 rpm
- Place the column on a new sample tube and add 100 microL distilled water
- Centrifuge for 1 minute at 6,000 rpm
Recipes for Buffer
Buffer 1 (Suspension Buffer) | 50 mM Tris-HCl and 10 mM EDTA, pH 8.0 (25°C) 50 μg/ml RNase A |
Buffer 2 (Lysis Buffer) | 0.2 M NaOH and 1% SDS |
Buffer 3 (Neutralization and Binding Buffer) | 4 M guanidine hydrochloride and 0.5 M potassium acetate, pH 4.2 |
Buffer 4 (Wash Buffer) | 5 M guanidine hydrochioride and 0.5 M potassium acetate, pH 4.2 |
Buffer 5 (Wash Buffer) | 20 mM NaCl, 2 mM Tris-HCl, pH 7.5 (25°C) [final conentrations after addition of ethanol] with 80% ethanol |
PCR-1
Materials
Buffer for KOD-FX-NEO | 50μL |
dNTP | 20μL |
Primer mix | 1.0μL |
Template DNA | 0.5μL |
KOD-FX-NEO (TOYOBO) | 2.0μL |
H2O | 26.5μL |
Total | 100μL |
---|
Procedure
- Add buffer, dNTP, primer mix, Template DNA, KOD-FX-NEO and distilled water to an Eppendorf tube and mix
- Place the PCR tubes into the PCR machine and set the program
PCR Profile for KOD-FX-NEO
Predenature | Denature | Annealing | Extension | Final Extension |
98.0°C KOD-FX-NEO | 98.0°C | 51.0°C | 68.0°C | 68.0°C |
2 minutes | 10 seconds | 30 seconds | 1 minutes | 2 minutes |
1 cycle | 30 cycles | 1 cycle |
PCR Primer Design
Lot.No | Oligo | Base Number | Sequence |
---|---|---|---|
T14F190235 | pGEX6P-2F1 | 30 | CACACAGGAACTAGTATTCATGTCCCCTAT |
T14F190236 | pGEX6P-2F2 | 30 | GGATCTGGAAGTTCTGTTCCACTAGTCCCT |
T14F190237 | pGEX6P-2R | 29 | TCATCACCGAAACGCTCGAGGCAGATCGT |
PCR-2
Materials
Buffer for KOD-FX-NEO | 50μL |
dNTP | 20μL |
Primer mix | 1.0μL |
Template DNA | 0.5μL |
KOD-FX-NEO (TOYOBO) | 2.0μL |
H2O | 26.5μL |
Total | 100μL |
---|
Procedure
- Add buffer, dNTP, primer mix, Template DNA, KOD-FX-NEO and distilled water to an Eppendorf tube and mix
- Place the PCR tubes into the PCR machine and set the program
PCR Profile for KOD-FX-NEO
Predenature | Denature | Annealing | Extension | Final Extension |
---|---|---|---|---|
98.0°C KOD-FX-NEO | 98.0°C | 51.0°C | 68.0°C | 68.0°C |
2 minutes | 10 seconds | 30 seconds | 1 minutes | 2 minutes |
1 cycle | 30 cycles | 1 cycle |
Restriction Digest
Materials
DNA sample | 6μL |
Buffer | 1μL |
Restriction Enzyme | 0.5μL |
Distilled water | 2.5μL |
Procedure
- Add all materials to a tube and mix them gently
- Incubate at 37˚C for the enzyme reaction for 15 minutes
AGE
Materials
Sample | 5μL |
Agarose gel | |
2X Loading Buffer Triple Dye (NIPPON GENE) | 5μL |
1X TAE Buffer |
Procedure
- Set an agarose gel on an electrophoresis chamber
- Add 1X TAE buffer to the electrophoresis chamber
Note: Do not generate bubbles under the gel - Add 2X loading buffer to electrophoresis samples
- Apply samples on agarose gel wells
- Set an appropriate voltage (100v) and run the electrophoresis
- Stop the electrophoresis when the BPB reaches 2/3 of the gel
- Soak the gel in EtBr (ethidium bromide) and dye it for 20 minutes
- Place plastic cooking wrap on the trans-illuminator and irradiate UV to the gel on the wrap
- Take photographs of the gel by using a trans-illuminator
Agarose Concentration Versus Optical Range of DNA Size
Agarose Concentration (%) | DNA (kbp) |
0.3 | 5-60 |
0.6 | 1-20 |
1.0 | 0.3-7 |
1.5 | 0.2-4 |
2.0 | 0.1-2 |
DNA RefinementⅠ
Materials
DNA sample | 200μL |
distilled H2O | 400μL |
CH3COONa | 50μL |
Phe/Chl | 700μL |
Isopropyl alcohol | 700μL |
75% Ethanol | 1000μL |
Procedure
- Add materials (DNA, H2O, CH3COONa, and Phe/Chl) to sample tube and vortex
- Centrifuge at 14,500 rpm for 10 minutes at room temperature
- Transfer the supernatant to a new sample tube
- Add 750 μL of isopropyl alcohol to the sample tube and vortex
- Centrifuge at 14,500 rpm for 10 minutes at 4°C
- Remove isopropyl alcohol gently so that the pellet will not break
- Add 1,000μL of 75% ethanol and centrifuge at 14,500 rpm for 5 minutes at 4°C
- Dry it by aspirator for 10 minutes
- Add 25μL of distilled H2O and mix
Note
- Phe/Chl composition Phenol:Chloroform:Isoamyl alcohol=25:24:1
Ligation
Materials
DNA sample | 5μL |
DNA ligase (Ligation High from Nippon gene) | 5μL |
Procedure
- Mix DNA sample and DNA ligase in a sample tube gently
- Ligation for 15 minutes at room temperature
Transformation (E.coli)
Materials
DNA Sample | 10μL |
Competent cell | 50μL |
Procedure
- Thaw the competent cells on ice
- Add 10 μL of sample into thawed competent cells
- Cool the sample tube, which contains competent cells and DNA samples, with ice for 1 hour, then Heat shock the cells by immersion in pre-hearted water bath at 42°C for 30 seconds
- Place the tube on ice for 2 minutes to cool it down
- At a clean bench, add 1.0 ml of LB medium into the tube and suspend it
- Incubate the tube at 37°C for 35 minutes
- Harvest the cells by centrifuge
- Spread the transformed competent cells onto the agar plate and incubate it at 37°C overnight
Pre-culture
Materials
Sample | |
Medium | 20ml |
Procedure
- Scrape samples from the agar plate and inoculate them on medium
- Cultivate at 37°C in a shaken culture overnight
Main Culture
Materials
LB medium with appropriate antibiotics (20 ml) | 100ml |
Sample (E.coli cells) |
Procedure
- Scrape samples from the agar plate and inoculate them in liquid media
- Cultivate overnight (37˚C, 120 rpm)
Protein Extraction (E.coli)
Materials
Sample | |
Fast Break Cell Lysis Reagent, 10X (Promega) | |
50mM potassium phosphate buffer (=pH6.8) | |
SDS sample buffer |
Procedure
- Separate samples into two and harvest by centrifuge
- Add potassium phosphate buffer, then mix and remove medium completely
- Add Fast Break Cell Lysis Reagent, 10X at the ratio of Fast Break Buffer Cell Lysis Reagent,10X: Samples=1:9 and extract protein for 15 minutes at room temperature
Protein Extraction (Saccharomyces cerevisiae)
Materials
Glass Beads | |
50 mM potassium phosphate buffer (pH6.8) | |
SDS sample buffer |
Procedure
- Harvest yeast cells by centrifuge at 3,000 rpm for 4 minutes at room temperature
- Wash cells once with potassium phosphate buffer
- Cool down the sample tube on ice for 1 minute
- Add the same amount of glass beads as the sample then add 20 μL of potassium phosphate buffer and mix
- Disrupt the cells by FastPrep 24 (MP Biochemicals) for 45 seconds at speed 4.5
- Cool down the sample tube on ice for 1 minute
- Add 80 µl of potassium phosphate buffer, cool it down and centrifuge for 5 minutes at 14,500 rpm at 4°C
- Transfer 40 µl of the supernatant and mix with 8 µl of SDS sample buffer
- Treat the sample with heat for 5 minutes at 100˚C
Colony Sweep
Materials
Sample | |
Phenol/Chloroform water-saturated solution (Phe/Chl) | |
Cracking solution 3% w/v SDS, 50 mM Tris-base, pH12.6 |
Procedure
- Dispense cracking solution (50 μL) each into sample tubes
- Collect the sample and suspend it into cracking solution
- Incubate at 65°C for 10 minutes
- Add Phe/Chl and BPB pigment and vortex
- Centrifuge at 14,000 rpm for 5 minutes
- Apply the samples (upper layer) to agarose gel with loading dye
- Check the bands by agar gel electrophoresis
SDS-PAGE
Materials
Sample | |
Separating Gel | |
Stacking Gel |
Procedure
- Place stacking gel on separating gel
- Rinse the wells of gel with distilled water
- Load prepared samples into wells
- Run the electrophoresis (25 mA for 75 min)
- Check the bands with CBB stain
Separating Gel
Acylamide (%) | 7.5 | 10 | 12.5 | 15 | 17.5 |
MiliQ H2O (ml) | 3.89 | 3.22 | 2.55 | 1.87 | 1.2 |
Acrylamide/Bis-acrylamide (30%/0.8% w/v) | 1.99 | 2.7 | 3.38 | 4.04 | 4.7 |
1.5M Tris-HCl(pH8.8) (ml) | 2 | 2 | 2 | 2 | 2 |
10% (w/v)SDS (μl) | 80 | 80 | 80 | 80 | 80 |
10% (w/v) ammonium persulfate (AP) (μl) | 27 | 27 | 27 | 27 | 27 |
TEMED (μl) | 4 | 4 | 4 | 4 | 4 |
Stacking Gel
MiliQ H2O (ml) | 2.89 |
30% (w/v) acrylamide (ml) | 0.79 |
0.5M Tris-HCl(pH6.8) (ml) | 1.25 |
10% SDS (μl) (ml) | 50 |
10% APS (μl) (ml) | 17 |
TEMED (μl) (ml) | 5 |
Western Blotting
Materials
BufferⅠ | |
BufferⅡ | |
BufferⅢ | |
Distilled water | 2ml |
PBS | |
PBS-S | |
PBS-T | |
PBS-TS | |
PonceauS | |
PVDF membrane | 1 sheet |
Whatman paper | 6 sheets |
Hybridization bag | 1 |
Peroxidase Stain Kit (Nacalai Tesque) | one drop for each |
antiglutathione S - transferase (和光純薬工業株式会社製) | 1μL |
Procedure
- Cut the gel in appropriate size
- Add BufferⅢ and gel then shake it gently
- Soak the membrane on ethanol then soak it in BufferⅢ and percolate
- 2, 1, 3 Whatman papers (all in the same size) on BufferⅠ, BufferⅡ, BufferⅢ respectively. wet the surface of the blotter
- Blot at the constant current of membrane's area ×2.5 mA
- Dye the membrane with Ponceau S for 5 minutes rinse it with distilled water and scan it
- Shake and wash with PBS-TS (3 minutes ×3 times)
- Put the membrane in a hybridization bag add PBS-S antiglutathione S-transferase and shake it for one hour at room temperature
- Shake and wash with PBS-T twice (5 min/10 min)
- Shake and wash with PBS twice (5 min/5 min)
- Add one drip of 3 Peroxidase Stain Kits and distilled water
- Scan it
Reagent
- BufferⅠ: bring to 300 ml with Tris base 10.9g, MetOH60ml/H2O
- BufferⅡ: bring to 300 ml with Tris base 0.9g, MetOH60ml/H2O
- BufferⅢ: bring to 300 ml with Tris base 0.91g, Boric acid10.5mg, MetOH60ml/H2O
- PBS-S: PBS with 1% SkimMilk
- PBS-T: PBS with 0.05% Tween20
- PBS-TS: PBS with 0.05% Tween20+1% SkimMilk
LB Broth/ LB Medium
Materials
Tryptone | final concentration: 1%(w/v) |
Yeast Extract | final concentration: 0.5%(w/v) |
NaCl | final concentration: 1%(w/v) |
5M NaOH |
Procedure
- Dissolve Tryptone (1.0 g), Yeast Extract (500 mg) and NaCl (1.0 g) in distilled water (90 ml)
- Adjust pH to 7.0 by adding 20μL of 5M NaOH
- Fill up to 100 ml with distilled water
- Autoclave
Note
- To make agar plate, add agar powder at the final concentration of 2 %(w/v) in Procedure 2
YPD Broth/YPD Medium
Materials
Peptone | final concentration: 2%(w/v) |
Yeast extract | final concentration: 1%(w/v) |
Glucose | final concentration: 2%(w/v) |
Procedure
- Dissolve peptone (2.0 g), yeast extract (1.0 g) and glucose (2.0 g) to distilled water (90 ml)
- Fill up to 100 ml with distilled water
- Sterilize by autoclave
Note
- To make agar plate, add agar powder (final concentration: 2.0%) at procedure 1.
SD Broth
Materials
Yeast nitrogen base | 0.67%(w/v) |
Glucose | 2% (w/v) |
Adenine | 0.004% (w/v) |
Histidine | 0.002% (w/v) |
Leucine | 0.006% (w/v) |
Lysine | 0.003% (w/v) |
Methionine | 0.002% (w/v) |
Tryptophan | 0.004% (w/v) |
Procedure
- Dissolve yeast nitrogen base (6.7 g), adenine (40 mg), histidine (20 mg), leucine (60 mg), lysine (30mg), tryptophan (40mg) and methionine (20mg) into 40 ml of distilled H2O, and then fill up to 50 ml with H2O.
- Dissolve glucose (20.0 g) into 40 ml of distilled H2O, and then fill up to 50 ml with H2O.
- Sterilize each solution by autoclave.
- Mix solutions after cooling it down.
Note
- Autoclave glucose and agar plate separately from other materials