Team:Evry/Biology/Transposons

From 2014.igem.org

(Difference between revisions)
Line 109: Line 109:
<div align="center">d) Integration of transposon in Pseudovibrio <i>denitrificans</i></div>
<div align="center">d) Integration of transposon in Pseudovibrio <i>denitrificans</i></div>
 +
Dans cette partie nous cherchons à montrer qu'il y a bien eut une intégration de manière aléatoire dans le génome.Pour cela la technique d'inverse PCR est utilisée. 
<img src="https://static.igem.org/mediawiki/2014/a/af/Evry_Genome_cut_religated.JPG"/><br>
<img src="https://static.igem.org/mediawiki/2014/a/af/Evry_Genome_cut_religated.JPG"/><br>
 +
paragraphe romain sur l'image
</ul>
</ul>
Line 124: Line 126:
<h4> <b>Creation of Transposon Plasmid </b></h4>
<h4> <b>Creation of Transposon Plasmid </b></h4>
</FONT>
</FONT>
-
The second part consists in introduce our construction in this plasmid. The probleme is that our plasmid have some biobrick restriction site. So we decided to build our plasmid name Transposon plasmid.  
+
The second part consists in introduce our construction in this plasmid. The probleme is that our plasmid have some biobrick restriction site. So we decided to build our plasmid name Transposon plasmid without biobrick restriction site.  

Revision as of 23:27, 17 October 2014

IGEM Evry 2014

Biology - Transposons

Transposon


A transposon is a sequence of DNA able to move by itself within the genome preferentially in genic regions; characterized as mobile genetic element or transposable element. This event occur according differents transposition mechanism. One of them called cut-and-paste mechanism require an enzyme : transposase. Thienzyme is encoded within some transposons. Transposase binds to the end of the transposon, which is consist of inverted repeats and catalyze the movement of transposon for insertion and excision.

Transposas Tn10 / Is10


The complex Tn10/IS10 is involved in the non-replicative cut-and-paste mechanism.; the transposable segment is excised by cleavage at the transposon ends and then re-inserted in a target DNA site.

Tn10 transposase protein is made up of 402 amino-acid, which recognise inverted repeats insertion sequence; Is10-right and Is10-left. Tn10 is a composite bacterial transposon subject to a strong positive and negative regulation.

IS 10 is an insertion sequence composing the transposon Tn10. The two Is10 elements, Is10-Right and Is10-Left, contain all of the Tn10 encoded genetic determinants; as the coding region for the transposase protein Tn10. The two ends of IS-10 have a similar terminal inverted repeat of 23bp, correspond to the transposase-binding site. However some genetic drift between both result in different functionality; Is10-right is fully functional while Is10-left is partially functional.



Our project



We tested some plasmids, and some methods to transform Pseudovibrio denitrificans but unsuccessfully. So the integration in the genome was tested. For it the researcher Brian Jester gave us the plasmide pNK2 as well as cells DH5α pir.In fact the plasmid pNK2 contains a particular origine of replication OriVR6Kgamma. The ori VR6K gamma is controlled by pi protein, which is encoded by pir gene and binds to site and allowing the replication.Hence, the oriVR6K gamma can only be replicated in strain with pi protein. This ori was already used in iGEM competition in 2009 by a french team. The gamma origin is adjacent to pi protein binding site and other site bound by proteins from the host bacterial cell, which includes in its own reproduction.




Insertion of transposon


  1. Transformation Pseudovibrio denitrificans with pNK2

    The plasmid pNK2 is tested in Pseudovibrio denitrificans. For this the cells is transformed by electroporation. The selection of cells is made in medium marine broth 1X with kanamycine 50µg/mL. In fact Pseudovibrio denitrificans can survive with kanamycine 25µg/mL. (Sensitivity to antibiotics)


  2. Phenotypic verification



    In this image we can see that only the transformed cells can survive at this concentration of antibiotic. This is a phenotypic verification that there is integration of transposons.

    A kinetic of Pseudovibrio transformed is maked.

  3. Genotypic verification

    a) Amplification of transposon

    The transposon in pNK2 there is kanamycin gene. So we used PCR to amplify this gene.
    There is an amplification of the gene in the cells transformed. All sequences them amplified come from ADNg and not from plasmid.
    We obtains this gel for 15 colonies of Pseudovibrio denitrificans.
    It's first verification.

    b) Sequencing of 16S

    The amplification of transformed cells with primer 16S, which amplified the sequence of the ribosome 16S. The PCR product is purified and send to sequence.
    This sequencing proves that it's Pseudovibrio which is transformed, and which have integrated the transposon.

    c) Amplification of specific sequence of Pseudovibrio denitrificans
    After the results of sequencing of Pseudovibrio denitrificans, a specific sequence of this strain have been discovered.
    This sequence is the following (read of 1000 bp):


    GACGGTGTCATTGATCTGGATAATGTCAACGAGCAGACCGGATCTTATCAGTTTGTCGGTGATGATGGGTTTGATACGGCAGGGCGCAGTATCTCTTCAGCTGGTGATG
    TTGATGGTGATGGTAAGGATGATCTGCTCATCGGTGCTGCGAATGCTAATGGTAGTGGTGCCAACCAAGGATCCGCTTCAGGGGCTGCTTATCTGATGACGGCTTCTGCACTA
    GCAGCCGCTGATGCCGCTGACGGCACCACTGATGGTGTTATTGATTTGGGTAATGTCAATGAGCAGACTGGATCTTATCAGTTCAATGGTACAGAAGTAATGGACCAAGCCGG
    AACTCGTGTAACATCTGCAGGCGATGTGGATGGCGATGGCAAAGATGATGTCTTTATCAGCAGCATTTTTGCAGATGATGGCGGCTCCAGTTCTGGTGAAGCATATTTGCTGA
    CAGCTGCTGCTATGGCTTCAGCTGATGCCGCTGACGGCACTACTGACGGCATCATTGATTTGGACAATGTCAATGAGCAAACCAACTCTTATCAGTTTGTTGGCACCCAAGCA
    GATGACCTGGCCGGCATTGATATCTCAGCTGCTGGTGATGTTGATGGCGATGGCAAAAATGACTTCTTGATCGGTGCTCGGGCAGCAGATGGTGGCGGCGCTGGCTCGGGTGA
    GGCCTATCTGTTGACTGCAGCAGCACTTGCTTCAGCTGATGCAGCTGATGGCACCACTGATGGGATTATCGATCTAGATAATGTCAATGAGCAGACTAACTCTTATCAGTTCG
    TTGGTACGGAAGTTGGCGATGATGCGGGAATTAGCGTGTCATTTGTCGGTGATGTTGACAATGATGGTAAGGACGATCTGTTGATTGGTGCACGTAATGCTGACGGCGGTGGC
    TCCAACTCTGGTGAAGCCTATCTAATGTCTATTGCTTCACTGGCGACTGCTGATGCAGCTGATGGCACCATTGATGGTGTTATCGATTTGGAT
    d) Integration of transposon in Pseudovibrio denitrificans
    Dans cette partie nous cherchons à montrer qu'il y a bien eut une intégration de manière aléatoire dans le génome.Pour cela la technique d'inverse PCR est utilisée.
    paragraphe romain sur l'image

    The transformation of Pseudovibrio denitrificans have been verified by the phenotype and the genotype. Now we know that transposas is fonctionel for our bacteria. c


    Creation of Transposon Plasmid

    The second part consists in introduce our construction in this plasmid. The probleme is that our plasmid have some biobrick restriction site. So we decided to build our plasmid name Transposon plasmid without biobrick restriction site.