"
Team:Heidelberg/Toolbox Guide/Circularization
From 2014.igem.org
| (5 intermediate revisions not shown) | |||
| Line 7: | Line 7: | ||
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}} | {{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/wikipage}} | ||
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/scrollTo}} | {{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/scrollTo}} | ||
| + | {{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/knockout}} | ||
<html> | <html> | ||
| - | |||
<style type="text/css"> | <style type="text/css"> | ||
#myContainer { | #myContainer { | ||
| Line 75: | Line 75: | ||
<html> | <html> | ||
<div class="container main" style="color: white;"> | <div class="container main" style="color: white;"> | ||
| - | + | <div class="row"> | |
| - | + | <div class="col-lg-8"> | |
| - | + | <div class="row"> | |
| - | + | <div class="col-lg-12"> | |
| - | + | <span class="middle">use the <span class="red-text">intein</span></span> | |
| - | + | </div> | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
</div> | </div> | ||
| - | <div class=" | + | <div class="row"> |
| - | < | + | <div class="col-lg-12" style="position: relative; top: -20px;"> |
| + | <span class="large">TOOLBOX </span><span class="middle" >to</span> | ||
| + | </div> | ||
</div> | </div> | ||
| - | + | </div> | |
| - | + | <div class="col-lg-4 toolbox-icons-bar"> | |
| - | + | <div class="col-lg-6 col-md-6 col-sm-6 col-xs-12"> | |
| - | + | <a href="https://2014.igem.org/Team:Heidelberg/Toolbox/Circularization"><img src="/wiki/images/5/58/Heidelberg_Toolbox_Circularization.png" class="img-responsive" />CIRCULARIZE</a> | |
| - | + | ||
| - | + | ||
| - | <div class="col-lg- | + | |
| - | <a href="https://2014.igem.org/Team:Heidelberg/Toolbox/ | + | |
</div> | </div> | ||
</div> | </div> | ||
| + | </div> | ||
<div class="col-lg-12" style="color:white;"> | <div class="col-lg-12" style="color:white;"> | ||
<h3>Please go to <a href="http://www.rcsb.org/">www.rcsb.org</a> and get a pdb file of your protein. If the 3D structure of your protein is known, we will be able to provide you an appropriate linker.</h3> | <h3>Please go to <a href="http://www.rcsb.org/">www.rcsb.org</a> and get a pdb file of your protein. If the 3D structure of your protein is known, we will be able to provide you an appropriate linker.</h3> | ||
| Line 444: | Line 436: | ||
</div> | </div> | ||
<script type="text/javascript"> | <script type="text/javascript"> | ||
| + | $(document).ready(function(){ | ||
var vm = new CircularizationViewModel(window.location.hash); | var vm = new CircularizationViewModel(window.location.hash); | ||
ko.applyBindings(vm); | ko.applyBindings(vm); | ||
| + | }); | ||
</script> | </script> | ||
</html> | </html> | ||
{{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/toolboxguide}} | {{:Team:Heidelberg/Templates/IncludeJS|:Team:Heidelberg/js/toolboxguide}} | ||
Latest revision as of 01:45, 18 October 2014
CIRCULARIZEPlease go to www.rcsb.org and get a pdb file of your protein. If the 3D structure of your protein is known, we will be able to provide you an appropriate linker.
If the 3D structure is unknown, we will help you to find a set of potentially suitable linkers.
Do you want to use split inteins or sortase to circularize your protein?
- Successfully used in our project
- High efficiency
- In vivo circularization
- In vitro more efficient
- Reversible
- Not successfully tested by us
Can your protein be easily expressed in E. coli?
Which exteins do you want to use? They will remain as scars in your circular protein.
If you want to save time, check manually whether the ends are close together (approx. Å or closer). For example, you can use the Swiss-PdbViewer or PyMOL.
NILS – hier könnte dein instruction-file-ersatz stehen
NILS – hier auch
NILS – hier immernoch
NILS – hier ebnfalls und auch gerne noch umfangreicher
Please save this link:
https://2014.igem.org/#
Copy to clipboardHello again. What is the result of ?
Have you decided to use one linker or try different linkers?
How large is your protein?
Protocol:
Get BBa_K1362000123 NpuDnaE intein RFC Sortase A circularization construct (with FLAG and Smt3)(with His6)(with Smt3 and His6) from the registry.
Get the DNA of the protein you want to circularize.
We recommend you to try circularization without a linker and with flexible GS-linkers of different lenghts up to 81015202530 amino acids (including exteins).
Backtranslate the amino acid sequence of your linkers to a nucleic acid sequence. Be aware of:- Balanced GC-content
- Restriction sites (especially PstI)
- Codon usage
- Avoid self annealing
Design and order primers for your protein insert.
In 5'-3' direction, the forward primer should have the following sequence:
CT GGTCTCA CAACGGGTTGCTGGGAATGCTTCAACTGC + binding part (=additional random nucleotides, BsaI site, RFC E overhang, CWE, CFN, Cys)
In 5'-3' direction, the reverse primer should have the following sequence:
CT GGTCTCT + binding part (=additional random nucleotides, BsaI site) CT GGTCTCT AGCAGAAG TTTACCACG GGTACCACGATATTCCGC + linker sequence (reverse complement) + binding part (=additional random nucleotides, BsaI site, RFC Boverhang , RGK, RGT, AEY reverse complement)
-
For any additional linker you want to test, you just need one additional reverse primer with the corresponding reverse complement linker DNA sequence.
The Tm values of the binding parts should be between 60 °C and 70 °C and as similar as possible.
Design and order oligos for your linker inserts.-
In 5'-3' direction, the forward oligostrand should have the following sequence:
Last 4 nucleotides of your protein + linker sequence + CGTGGTAAA (=RGK)CGTGGTACC (=RGT)GCGGAATAT (=AEY)
-
In 5'-3' direction, the reverse oligostrand should have the following sequence:
AGCAGAAG TTTACCACGGGTACCACGATATTCCGC + linker sequence (reverse complement) (=RFC B overhang , RGK), RGT, AEYreverse complement)
Anneal your linker inserts as described here -LINK ZU MAT/MET ANNEALING-.
Use a Touchdown-Twostep PCR -LINK ZU MAT/MET TOUCHDOWNTWOSTEPPCR- to create your protein insert and purify it.
Use Golden Gate assembly –LINK ZU MAT/MET GOLDEN GATE ASSEMBLY (CYCLING) to replace the mRFP selection marker in the circularization construct with your insert.both your protein insert and your linker inserts.Because your annealed oligos are not 5'-phosphorylated, you have to add T4-polynucleotide kinase to the Golden Gate reaction.
Since there is a BsaI site in your protein, you have to religate – LINK ZU MAT/MET RELIGATION after the Golden Gate reaction.
Add an inducible promotor by standard biobrick cloning or use one of our pSBX vectors –LINK ZU PSBX VECTOR-TEXT.
Express your circular protein. If you are using our pSBX vectors, you can follow this protocol –LINK ZU PROTOKOLL EXPRESSION
SILVAN SCHREIBT HIER NOCH WAS ZU SORTASE
