Team:Evry/Interlab Study/Used Devices

From 2014.igem.org

Revision as of 02:16, 18 October 2014 by JulieZ (Talk | contribs)

IGEM Evry 2014

Interlab study - Used devices

Construction way


IMAGE


Constructions were built using classical Biobrick restriction sites.

  • Required device 1: originally this device was carried by PSB1K3 and was sud-cloned onto PSB1C3.
    • Vector: digestion of PSB1C3 and PSB1K3 carrying I20260 via EcoRi and PstI
    • Insert: digestion of PSB1K3 carrying I20260 via EcoRi and PstI
    • Ligation with T4 DNA ligase (New England Biolabs)

  • Required device 2, 3 and the 19 constructions for the entire Anderson library: promoters were inserted into PSB1C3 carrying E0240. Process is described on following figure 1.
    • Vector: digestion of PSB1C3 carrying E0240 via EcoRI and XbaI
    • Insert: digestion of PSB1C3 carrying K823012* and J61002 carrying J23100 to J23119 via EcoRI and SpeI
    • Ligation with T4 DNA ligase (New England Biolabs)
* BBa_K823012 corresponds to BBa_J23115 that contains 2 missmatched basepairs.

Constructions were first designed in a software(Geneious v. 6.1.6), Plasmid 1 and 2 below, and then relized on web lab using iGEM 2014 Distribution kit. Verifications were made by eletrophoresis gel analytic PCR amplification and sequencing. Glycerol stock of 3 colonies per constructions were conserved and used for the measurments of GFP expression.

IMAGE

Plasmid map 1: Final construction of PSB1C3 containing E0240 and J23113( EcoRI, PstI, SpeI and XbaI). Constructions carrying J23100 to J23119 and K823012 were similar to this.

IMAGE
Plasmid map 2: Final construction of PSB1C3 containing I20260( EcoRI, PstI, SpeI and XbaI).


Analysis protocol


Our team decided to test the fluorescence with a TECAN infiniteM200 in 96 well plates. Each assay were performed after a 16 - 18 h preculture on 5 ml of LB medium at 37°C with 220 rpm agitation. Cultures were distributed 200 µl per well. Three strains per constructions were tested in five replicates. Two controls were added on plates: LB with chloramphenicol and the strain carrying the promoterless vector on LB with chloramphenicol.
Fluorescence data were analyzed via following formula that come from 2010 De Jong et al Experimental and computational validation of models of fluorescent and luminescent reporter genes in bacteria .

IMAGE

Equation A: A(t) is the corrected absorbance of DH5 alpha with the functional reporter system, Au(t)the uncorrected absorbance of DH5 alpha with the functional reporter system and Ab(t)the background absorbance corresponding to LB with chloramphenicol medium absorbance.
Equation B: B(t) is the absorbance of the strain carrying the promoterless vector, Iu(t) the uncorrected fluorescence intensity of DH5 alpha with the functional reporter system and Ib(t) the background fluorescence intensity of LB chloramphenicol medium with the DH5 alpha carrying the promoterless vector.


Used Biobricks and plasmids


IMAGE

Plasmid map 3: BBa_J61002 plasmid map with restriction sites and J23101 promoter ( EcoRI, PstI, SpeI and XbaI). Plasmids carrying J23100 to J23119 were similar to this.
IMAGE
Plasmid map 4: PSB1C3 carrying BBa_E0240 map with restriction sites and J23101 promoter ( EcoRI, PstI, SpeI and XbaI).


Promoter name, plate and well location into the iGEM distribution kit 2014, vector, resistance cassette, part size in bp, used primers and PCR product profile.


Sequencing results


Device I20260 Forward

AGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGTTTTAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTATTATTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCTGTTACAAACTCAAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGATTGTGTGGACAGGTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATTGGAGTATTTTGTTGATAATGGTCTGCTAGTTGAACGCTTCCATCTTCAATGTTGTGTCTAATTTTGAAGTTAACTTTGATTCCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTATTCCAATTTGTGTCCAAGAATGTTTCCATCTTCTTTAAAATCAATACCTTTTAACTCGATTCTATTAACAAGGGTATCACCTTCAAACTTGACTTCAGCACGTGTCTTGTAGTTCCCGTCATCTTTGAAAAATATAGTTCTTTCCTGTACATAACCTTCGGGCATGGCACTCTTGAAAAAGTCATGCTGTTTCATATGATCTGGGTATCTCGCANAGCATTGAACACCATAACCGAAAGTAGTGACAAGTGTTGGCCATGGAACAGGTAGTTTTCCAGTAGTGCAAATAAATTTAAGGGTAAGTTTTCCGTATGTTGCATCACCTTCACCCTCTCCACTGACAGAAAATTTGTGCCCATTAACATCACCATCTAATTCAACAAGAATTGGGACAACTCCAGTGAAAAGTTCTTCTCCTTTACGCATCTAGTACTTTCCTGTGTGACTCTAGTAGCTAGCATAATACCTAGGACTGAGCTNNNTGTAAACTCTNNNANCGGCC 


Device I20260 Reverse
TAGGCGTATNANGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCTACTAGAGTCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAANAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAANATTACTTCNCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGNACGG