Team:Aix-Marseille/Parts

From 2014.igem.org

(Difference between revisions)
 
(16 intermediate revisions not shown)
Line 2: Line 2:
<html>
<html>
 +
  <script>
 +
  // Function to handle the movement of the sidebar in the Project
 +
      $(document).ready(function () { 
 +
          var sidebar = $('#sidebar-project');
 +
          var sidebarContainer = $('#sidebar-project-div');
 +
 +
          $(window).scroll(function (event) {
 +
              var ypos = $(this).scrollTop();
 +
              var scrollTop = $(window).scrollTop(),
 +
                              elementOffset = sidebar.offset().top,
 +
                              distance = (elementOffset - scrollTop);
 +
 +
              var collision_top = sidebar.overlaps($('#stop_top'));
 +
              var collision_bot = sidebar.overlaps($('#stop_bot'));
 +
 +
              if (collision_top.hits.length) {  /* Collision TOP */
 +
                // To fix at the top of the .row div 
 +
                  sidebar.css({  top: '',
 +
                                  bottom: '',
 +
                                  position: '',
 +
                                  width: ''
 +
                              });
 +
                  sidebarContainer.css({  position:'',
 +
                                          bottom: '',
 +
                                          right: ''
 +
                                      });
 +
                  if (distance < 141) {
 +
                    // To fix at the top of the page while scrolling
 +
                      sidebar.css({  top: '141px',
 +
                                      bottom: '',
 +
                                      position: 'fixed',
 +
                                      width: '262.5px'
 +
                                  });
 +
                      sidebarContainer.css({  position: '',
 +
                                              bottom: '',
 +
                                              right: ''
 +
                                          });
 +
                  }
 +
              }
 +
              else if (collision_bot.hits.length) {  /* Collision BOTTOM */
 +
                // To fix at the bottom of the .row div
 +
                  sidebar.css({  bottom: '',
 +
                                  top: '',
 +
                                  position: '',
 +
                                  width: ''
 +
                              });
 +
                  sidebarContainer.css({  position: 'absolute',
 +
                                          bottom: '0px',
 +
                                        right: '0px'
 +
                                      });
 +
                  if (distance > 141) {
 +
                    // To fix at the top of the page while scrolling
 +
                      sidebar.css({  top: '141px',
 +
                                      bottom: '',
 +
                                      position: 'fixed',
 +
                                      width: '262.5px'
 +
                                  });
 +
                      sidebarContainer.css({  position: '',
 +
                                              bottom: '',
 +
                                              right: ''
 +
                                          });
 +
                  }
 +
              }
 +
              else if (distance <= 141) {
 +
                // To fix at the top of the page while scrolling
 +
                  sidebar.css({  top: '141px',
 +
                                  bottom: '',
 +
                                  position: 'fixed',
 +
                                  width: '262.5px'
 +
                              });
 +
                  sidebarContainer.css({  position: '',
 +
                                          bottom: '',
 +
                                          right: ''
 +
                                      });
 +
              }
 +
          });
 +
 +
       
 +
      });
 +
  </script>
 +
 +
 +
   <div class="container">
   <div class="container">
     <h1 class="project-title">Our parts</h1>
     <h1 class="project-title">Our parts</h1>
-
    <br><br><br>
 
-
    <i>The list will be updated each time we'll create or modify a part</i>
 
-
    <br><br><br>
 
-
<div class="project-section">
 
-
      <span class="project-tag" id="details"></span>
 
-
      <h1>Part BBa_K1349000</h1>
 
      
      
-
       <div class="project-subsection">
+
    <div class="row" style="position:relative;">
-
        <span class="project-tag" id="serine_part"></span>
+
       <!-- Content -->
-
        <h3 class="subtitle">Short description</h3>
+
      <!-- ******* -->
-
        <div class="project-details">
+
      <div class="col-md-9 project">
-
           <img class="img-rounded" src="https://static.igem.org/mediawiki/2014/1/1a/AMU_Team-serine_part_schema.png">
+
     
 +
        <div class="project-section">
 +
          <span class="project-tag" id="fav_parts"></span>
 +
          <h1>Favorite parts</h1>
 +
         
 +
          <div class="project-subsection">
 +
            <span class="project-tag" id="part001"></span>
 +
            <h2 class="subtitle">Part BBa_K1349001</h3>
 +
            <p><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349001" target="_blank">Link to registry</a></p>
 +
            <div class="parts-subsection">
 +
              <h3><i>relA</i></h3>
 +
            </div>
 +
           
 +
            <h4>Description</h4>
 +
            <p>The <i>relA</i> gene encodes a ppGpp synthetase. In bacteria, ppGpp (guanosine 3'-diphosphate 5-' diphosphate) acts as a signaling molecule that regulates a variety of cellular metabolisms in response to changes in the nutritional state of the cells. The relA sequence amplified from <i>E. coli</i> W3110 was mutated by site-directed mutagenesis to remove the PstI site.</p>
 +
           </div>
 +
         
 +
          <div class="project-subsection">
 +
            <span class="project-tag" id="part002"></span>
 +
            <h2 class="subtitle">Part BBa_K1349002</h3>
 +
            <p><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349002" target="_blank">Link to registry</a></p>
 +
            <div class="parts-subsection">
 +
              <h3>CusR box</h3>
 +
            </div>
 +
 
 +
            <h4>Description</h4>
 +
            <p>The CusR box allow the binding of the CusR regulator. In <i>E. coli</i>, the CusR/CusS two-component system induces expression of genes involved in metal efflux under condition of elevated Cu concentration. Phosphorylated CusR specifically bind to CusR-dependent promoters.</p>
 +
          </div>
 +
 
 +
          <div class="project-subsection">
 +
            <span class="project-tag" id="part003"></span>
 +
            <h2 class="subtitle">Part BBa_K1349004</h3>
 +
            <p><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349004" target="_blank">Link to registry</a></p>
 +
            <div class="parts-subsection">
 +
              <h3><i>mesh1</i></h3>
 +
            </div>
 +
           
 +
            <h4>Description</h4>
 +
            <p>Mesh1 is a SpoT orthologs in metazoa. It catalyzes hydrolysis of ppGpp (guanosine 3'-diphosphate 5-' diphosphate).</p>
 +
          </div>
         </div>
         </div>
-
         <p>SerA_mut</p>
+
 
-
      </div>
+
       
-
   
+
         <div class="project-section">
-
      <div class="project-subsection">
+
          <span class="project-tag" id="o_parts"></span>
-
        <span class="project-tag" id="serine_part"></span>
+
          <h1>Other parts</h1>
-
        <h3 class="subtitle">DNA Sequence</h3>
+
         
-
        <div class="project-details">
+
          <h3 class="subtitle">Part BBa_K1349000  -  <i>serA_troncated</i>(1-->1008nt)</h3>
-
           <img class="img-rounded" src="https://static.igem.org/mediawiki/2014/1/1a/AMU_Team-serine_part_schema.png">
+
          <p class="parts-subsection"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349000" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349003  -  P<i>cusC</i></h3>
 +
          <p class="parts-subsection"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349003" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349005  - (SH3)x1</h3>
 +
          <p class="parts-subsection"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349005" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349006  -  <i>cheA</i></h3>
 +
          <p class="parts-subsection"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349006" target="_blank">Link to registry</a></p>
 +
         
 +
           <h3 class="subtitle">Part BBa_K1349007  - CusR-L-LZA</h3>
 +
          <p class="parts-subsection"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349007" target="_blank">Link to registry</a></p>
 +
         
 +
          <h3 class="subtitle">Part BBa_K1349008  -  (SH3pep)-L-LZA</h3>
 +
          <p class="parts-subsection"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1349008" target="_blank">Link to registry</a></p>
         </div>
         </div>
-
        <p>ATGGCAAAGGTATCGCTGGAGAAAGACAAGATTAAGTTTCTGCTGGTAGAAGGCGTGCACCAAAAGGCGC TGGAAAGCCTTCGTGCAGCTGGTTACACCAACATCGAATTTCACAAAGGCGCGCTGGATGATGAACAATT AAAAGAATCCATCCGCGATGCCCACTTCATCGGCCTGCGATCCCGTACCCATCTGACTGAAGACGTGATC AACGCCGCAGAAAAACTGGTCGCTATTGGCTGTTTCTGTATCGGAACAAACCAGGTTGATCTGGATGCGG CGGCAAAGCGCGGGATCCCGGTATTTAACGCACCGTTCTCAAATACGCGCTCTGTTGCGGAGCTGGTGAT TGGCGAACTGCTGCTGCTATTGCGCGGCGTGCCGGAAGCCAATGCTAAAGCGCACCGTGGCGTGTGGAAC AAACTGGCGGCGGGTTCTTTTGAAGCGCGCGGCAAAAAGCTGGGTATCATCGGCTACGGTCATATTGGTA CGCAATTGGGCATTCTGGCTGAATCGCTGGGAATGTATGTTTACTTTTATGATATTGAAAATAAACTGCC GCTGGGCAACGCCACTCAGGTACAGCATCTTTCTGACCTGCTGAATATGAGCGATGTGGTGAcgctGCAT GTACCAGAGAATCCGTCCACCAAAAATATGATGGGCGCGAAAGAAATTTCACTAATGAAGCCCGGCTCGC TGCTGATTAATGCTTCGCGCGGTACTGTGGTGGATATTCCGGCGCTGTGTGATGCGCTGGCGAGCAAACA TCTGGCGGGGGCGGCAATCGACGTATTCCCGACGGAACCGGCGACCAATAGCGATCCATTTACCTCTCCG CTGTGTGAATTCGACAACGTCCTTCTGACGCCACACATTGGCGGTTCGACTCAGGAAGCGCAGGAGAATA TCGGCCTGGAAGTTGCGGGTAAATTGATCAAGTATTCTGACAATGGCTCAACGCTCTCTGCGGTGAACTT CCCGGAAGTCTCGCTGCCACTGCACGGT</p>
+
      </div> <!-- /Content -->
-
       </div>
+
     
-
   
+
     
-
       <div class="project-subsection">
+
       <!-- Table of Contents -->
-
         <span class="project-tag" id="serine_part"></span>
+
      <!-- ***************** -->
-
         <h3 class="subtitle">Logic and explanation for part and construction</h3>
+
       <div class="col-md-3" id="sidebar-project-div">
-
        <div class="project-details">
+
         <div id="stop_top" style="height:50px"></div>
-
          <img class="img-rounded" src="https://static.igem.org/mediawiki/2014/1/1a/AMU_Team-serine_part_schema.png">
+
         <div id="sidebar-project">
 +
          <ul class="nav">
 +
            <li class="active">
 +
              <a data-scroll href="#fav_parts">Favorite parts</a>
 +
              <ul class="nav">
 +
                <li><a data-scroll href="#part001">BBa_K1349001</a></li>
 +
                <li><a data-scroll href="#part002">BBa_K1349002</a></li>
 +
                <li><a data-scroll href="#part003">BBa_K1349004</a></li>
 +
              </ul>
 +
            </li>
 +
            <li>
 +
              <a data-scroll href="#o_parts">Other parts</a>
 +
            </li>
 +
          </ul>
         </div>
         </div>
-
        <p>This construct encodes a truncated version of E. coli W3110 SerA ( D-3-phosphoglycerate dehydrogenase), missing the last 75 aa of the full sequence, and without stop codon. SerA is requiered for serine biosynthesis. Following the work of Peters-Wendisch et al. 2005, this mutated version of the enzyme is expected to be no-longer inhibited by Serine, and to allow the production of a high serine concentration. </p>
 
       </div>
       </div>
-
   
 
-
      <div class="project-subsection">
 
-
        <span class="project-tag" id="serine_part"></span>
 
-
        <h3 class="subtitle">Purpose</h3>
 
-
        <div class="project-details">
 
-
          <img class="img-rounded" src="https://static.igem.org/mediawiki/2014/1/1a/AMU_Team-serine_part_schema.png">
 
-
        </div>
 
-
        <p>This part is designed to allow the synthesis of serine in E. coli without the normal feedback inhibition, thus permitting the accumulation of high concentrations.</p>
 
-
      </div>
 
-
   
 
-
      <div class="project-subsection">
 
-
        <span class="project-tag" id="serine_part"></span>
 
-
        <h3 class="subtitle">Origin and method of construction</h3>
 
-
        <div class="project-details">
 
-
          <img class="img-rounded" src="https://static.igem.org/mediawiki/2014/1/1a/AMU_Team-serine_part_schema.png">
 
-
        </div>
 
-
        <p>The part was obtained by PCR from E.coli strain W3110 and SLIC assembly. The construction removed the EcoR1 restriction site in the gene by the silent mutations of a GAA codon to a GAG codon.</p>
 
-
      </div>
 
-
   
 
-
      <div class="project-subsection">
 
-
        <span class="project-tag" id="serine_part"></span>
 
-
        <h3 class="subtitle">Propreties expected and validation</h3>
 
-
        <div class="project-details">
 
-
          <img class="img-rounded" src="https://static.igem.org/mediawiki/2014/1/1a/AMU_Team-serine_part_schema.png">
 
-
        </div>
 
-
        <p>We designed this sequence that in an E.coli mutant strain unable to catabolise serine correctly and without a serine import system, production of this coding sequence will lead to serine secretion into the growth media. The sequence does not contain a stop codon so it should be incorporated into composite bricks for testing synthesis and activity.</p>
 
-
      </div>
 
-
   
 
-
      <div class="project-subsection">
 
-
        <span class="project-tag" id="serine_part"></span>
 
-
        <h3 class="subtitle">Current backbone</h3>
 
-
        <div class="project-details">
 
-
          <img class="img-rounded" src="https://static.igem.org/mediawiki/2014/1/1a/AMU_Team-serine_part_schema.png">
 
-
        </div>
 
-
        <p>pSB1C3</p>
 
-
      </div>
 
-
   
 
-
      <div class="project-subsection">
 
-
        <span class="project-tag" id="serine_part"></span>
 
-
        <h3 class="subtitle">Sequenced clone</h3>
 
-
        <div class="project-details">
 
-
          <img class="img-rounded" src="https://static.igem.org/mediawiki/2014/1/1a/AMU_Team-serine_part_schema.png">
 
-
        </div>
 
-
        <p>ok SerA Cm1</p>
 
-
      </div>
 
-
   
 
     </div>
     </div>
 +
    <div id="stop_bot"></div>
   </div>
   </div>
</html>
</html>
{{Team:Aix-Marseille/footer}}
{{Team:Aix-Marseille/footer}}

Latest revision as of 12:03, 16 October 2014

Our parts

Favorite parts

Part BBa_K1349001

Link to registry

relA

Description

The relA gene encodes a ppGpp synthetase. In bacteria, ppGpp (guanosine 3'-diphosphate 5-' diphosphate) acts as a signaling molecule that regulates a variety of cellular metabolisms in response to changes in the nutritional state of the cells. The relA sequence amplified from E. coli W3110 was mutated by site-directed mutagenesis to remove the PstI site.

Part BBa_K1349002

Link to registry

CusR box

Description

The CusR box allow the binding of the CusR regulator. In E. coli, the CusR/CusS two-component system induces expression of genes involved in metal efflux under condition of elevated Cu concentration. Phosphorylated CusR specifically bind to CusR-dependent promoters.

Part BBa_K1349004

Link to registry

mesh1

Description

Mesh1 is a SpoT orthologs in metazoa. It catalyzes hydrolysis of ppGpp (guanosine 3'-diphosphate 5-' diphosphate).

Other parts

Part BBa_K1349000 - serA_troncated(1-->1008nt)

Link to registry

Part BBa_K1349003 - PcusC

Link to registry

Part BBa_K1349005 - (SH3)x1

Link to registry

Part BBa_K1349006 - cheA

Link to registry

Part BBa_K1349007 - CusR-L-LZA

Link to registry

Part BBa_K1349008 - (SH3pep)-L-LZA

Link to registry

Contact us

Email : equipe.igem.amu@gmail.com

Follow us

iGEM_AMU   iGEM.AMU

Our sponsors

   

Retrieved from "http://2014.igem.org/Team:Aix-Marseille/Parts"