Team:Duke/Parts
From 2014.igem.org
Construction Background
During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.
Sequence | Ungated Mean | Fluorescence Relative to Reporter-Only |
Reporter | 43.7 | 1 |
DH5alpha ZI | 0.16 | 0.003661327231 |
dCas9 | 42.73333333 | 0.9778794813 |
GFP1 (ccatctaattcaacaagaat) | 13.4 | 0.3066361556 |
GFP2 (agtagtgcaaataaatttaa) | 48.6 | 1.112128146 |
GFP3 (gtagtgacaagtgttggcca) | 15.43333333 | 0.3531655225 |
We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:
PCR1: oligos with prefix-decoy-spacer (top strand), decoy-spacer-decoy (top strand), and spacer-decoy-spacer (bottom strand) are combined and cycled 35 times resulting in a mixture of products
![](https://static.igem.org/mediawiki/2014/5/5b/Parts1.png)
PCR2: the products of PCR1 are used as a template for a bottom strand oligo that appends the BioBrick suffix and cycles 35 times.
![](https://static.igem.org/mediawiki/2014/4/40/DukeParts2.png)
The products of PCR2 are inserted in to pSB1C3 via Gibson assembly
![](https://static.igem.org/mediawiki/2014/3/34/Parts3.png)
These constructs can be expanded further by serial digestion/ligation
![](https://static.igem.org/mediawiki/2014/c/cf/Parts4.png)
From our PCR-based construction scheme we isolated 1x and 6x decoys, and then expanded the 6x array to 12x. These parts were submitted to the registry as BBa_K1545000 BBa_K1545001 and BBa_K1545001
![](https://static.igem.org/mediawiki/2014/3/3b/4oo8doudna.png)
Crystal structure 4OO8 from the Doudna Lab. Cas9 is in blue, gRNA in red, and the DNA to which the complex binds is in yellow. Click for the PubMed article.