August

1st

• made electrocompetent E.coli rosetta cells.
• prepared cultures of K1319042 and K131026

2nd

• tested the OD measurement device and compared it to the spectrophotometer and the plate reader.
• tested K131026 and K1319042 for fluorescence in the plate reader
• did a heat shock transformation of I746909 into NEB TOP 10 cells
• did an electroshock transformation of pET17-Gal3 into E.coli rosetta

3rd

• OD measurements of the iGEM device in comparison to the spectrophotometer were taken.
• cryo cultures of K131026 and K1319042 were prepared
• master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures

4th

• made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in E. coli rosetta (DE3), respectively.
• made plasmid prep, most of them using 1.5 mL culture medium, and eluted with 1x 50 µL of ddH₂O. The resulting DNA concentrations are shown below.

To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.

Test digest clones were test-digested

combination	cut products[bp]
I746909 BL21 #1	2029, 947
K1319042 DH5alpha	2029, 1780
K131026 DH5alpha	2029, 1848
pET17-Gal3 #1	3086, 923, 1262

All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.

• prepared an over night cultur of K1319042 for chips

5th

• assembly of a V_R=2.5 L bioreactor for cultivation of a 1 L expression culture.
• Two precultures of 20 mL LB+A were inoculated at 19:00
• transformation of K746909 into BL21 cells and K1319000 into NEB10β cells.
• made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc
• made alliquots of HM, 1 L HM + glucose + supplements and 500 ml LB

• The Quickchange mutagenesis PCR with a tamplate K1319000 and following primers was made.
  • forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC
  • rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG

Picture

6th

• transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells.
• They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.
• made precultures of NEB10βand DH5 alpha cells
• inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24 h.

7th

• made media for Pseudomonas flourescens
  • Nutrient Broth
  • Pseudomonas-F
  • Pseudomonas-P
• made 2 L LB

8th

• prepared 2x 60 ml (LB + cam + IPTG) with K1319042
• prepared 5 ml K131026 and C0179
• made SDS page

9th

• made a plate reader experiment with K131026 in LB and LB + HM

11th

• plated on LB + antibiotics
  • K131026
  • I746909
  • K13190042
  • I04450 in pSB1C3
  • I04450 in pSB1A3
  • I04450 in pSB1K3
  • pSEVA construct (pSEVA 641_FP pSEVA 234-LasR)

13th

• Agarose chips were prepared:
  • E. coli DH5α K131026 and I746909 in LB and HM
  • K1319042 and the pSEVA two plasmid construct in HM
• Images were taken every 30 min with the Geldoc

15th

• A bioreactor containing 1 L Medium was inoculated with pET17-His-SNAP-YFP-Gal3.

16th

• The above mentioned Bioreactor was stopped after 20 h and all cells were lysed.

18th

• Overnight cultures of I746909 and K131026 in LB, TB, 2x HM+ were made
• 3x J23101.E0240 was plated
• pET17-His-SNAP-YFP-Gal3 was purified with Äkta via a histidine-tagged protein purification.

19th

• Chips with K131026 and I746909 in HM were made. Images were taken every 30 min with the Geldoc
• A PCR of J23101.E0240, K1319000, K1319001, K1319002 was run and the product was separated on a 1,2 % agarose gel
• A SDS gel with samples of protein purification of pET17-His-SNAP-YFP-Gal3 was made to check if the purifired samples contain the target protein - YFP-Gal3. The purification or the gel resulted in two samples with a yellow color. For the SDS we also used the two samples before and the two samples after ones with the yellow color, 6 mL.

YFP-Gal3 protein purification

• Two samples with YFP-Gal3 were concentrated till 1 mL
• The concentration of YFP-Gal3 was calculated on Tecan. Calculation showed concentration 13,42 mg/ml

20th

• repeat PCR for REACh1 and J23101.E0240 and run a gel
• plasmid prep of pSEVA BfsB, pSEVA lasR and I746909

24th

• made 2.5 L LB
• made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device

Sensor Chips with K131026 in BL21 in LB taken with first prototyp of our own device Sensor chips with K131026 in BL21 in LB medium with 1,5 % agar, lower chip induced. A) befor induction with 2 µl of 5000 µg/ml HSL (3-oxo-C12) B) 0.5 h after induction C) 1 h after induction D) 1.5 h after induction E) 2 h after induction F) 2.5 h after induction

25th

• did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)
• tested the growth of Pseudomonas fluorescens in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300 µL Fe3+ in 500 mL flasks with a filling volume of 30 mL. The flasks were inoculated with P. fluorescens cells on Standard I agar, and incubated at 30 °C at 250 rpm.
• prepared over night cultures of K131026 in DH5α and NEB for chips
• prepared 2x 5 ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep

26th

• ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.
• plasmid prep of I20260, K516032 and B0034
• restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI
• gel with restricted the I20260, K516032 and B0034 was run
• purification of vector backbones pSB1A2, pSB3K3 and pSB1C3
• restriciton of synthesized TEV protease with EcoRI and PstI
• qualitatively tested the Pseudomonas fluorescens that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300 µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.
• made chips with K131026 in DH5α and NEB, in LB and LB + 10 % glycerol. Images were taken with our own device every 10 min (illumination problems).

Sensor Chips with K131026 in NEB in LB taken with first prototyp of our own device Sensor chips with K131026 in NEB in LB medium with 1,5 % agar. Chip on the top induced with 0.5 µl of 500 µg/ml HSL and on the bottom with less than 0.2 µl of 500 µg/ml HSL (3-oxo-C12). A) befor induction B) 1 h after induction C) 1.5 h after induction D) 2 h after induction

• plasmid prep of the back bones, restriction and gel purification

27th

• transformation of some BioBricks
• ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3
• transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively

28th

• transformation of some BioBricks