Team:Hong Kong HKUST/pneumosensor/results/module two

From 2014.igem.org

Revision as of 14:54, 5 October 2014 by Jumnicole (Talk | contribs)


Pneumosensor Results

S. pneumoniae sigma X promoters Module

Overview

The activity of combox promoter is turned on by a specific sigma factor that is produced by a regulatory gene comX. The sigma factor X will bind to the combox promoter region and activate gene expression. Sigma factor X will serve as an inducer with high specificity as it binds to an area of several specific base pairs on the combox promoter. This ComX and combox system could be used as a highly specific reporting system in our Streptococcus pneumonia detection platform. However in nature, ComX protein will be degraded by clpXP enzyme which exist in E.Coli and some other bacteria. Hence, to ensure the induction of combox promoter by comX, comW protein is needed as it functions to protect ComX protein from being degraded by clpXP. ComW protein will be degraded instead, increasing the amount of ComX protein produced.


Construct

The three main components of the construct are comX gene, comW gene, and combox promoter. We assemble comX and combox promoter in one vector plasmid, while comW in a different plasmid. The system will be fused with a tagging protein and a reporting protein. Tagging protein is essential for detecting the ComX and ComW protein expression by means of western blot. Reporting protein which is fluorescence protein is needed for reporting purpose, hence comX and combox system could serve as a specific reporting system that will be useful for many synthetic constructs. comX and combox promoter construct will be assembled separately in different plasmid before being combined into one plasmid.

ComX Generator construct (BBa_K1379006) and comW construct

Backbone pSB1C3 was used for ComX generator construct and comW construct. comX gene / comW gene was fused with BBa_K880005 which contains a constitutive promoter (J23100) and strong RBS (B0032). The purpose of this strong constitutive promoter and strong RBS is to unsure the large production of ComX and ComW protein throughout time. Then, a double terminator (B0015) is fused with the promoter, RBS, and ComX. BBa_K880005 and B0015 was obtained from 2014 iGEM distribution kit.

Construct using pSB1C3 backbone with only comX gene (BBa_K1379004), with comX gene and BBa_B0015 double terminator (BBa_K1379045) was also built.

Bacterial Strain
The bacterial strain of E.coli that were used is DH10B. Since this strain of E.Coli have clpXP degradation enzyme which target ComX for degradation, an excess amount of ComX protein are required to maintain enough amount of ComX for combox promoter induction.

comX and comW gene
comX gene and comW gene was cloned from NCTC 7465 E.Coli strain genomic DNA by PCR using Vent Polymerase.

comX Tag Protein
We engineered a C-myc protein tag in the 3’ ends of comX by including the sequence in comX extraction primer.

3’ primer to extract comX with engineered C-myc tag gene sequence:

GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CAGATCCTCTTCTGAGATGAGTTTTTGTTC GTGGGTACGGATAGTAAACTCCTTAAACAC

[6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [30’ C-myc protein] [30' reverse complementary of 3’ comX]

ComW Tag Protein
We engineered a FLAG protein tag in the 3’ ends of comW by including the sequence in comW extraction primer.

3’ primer to extract comW with engineered FLAG tag gene sequence:

GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CTTGTCGTCATCGTCTTTGTAGTC ACAAGAAATAAAACCCCGATTCATTACCAATT

[6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [24’ FLAG protein] [32' reverse complementary of 3’ comW]

PCelA (BBa_ K1379002) and Phelicase (BBa_ K1379003) construct

Backbone pSB1C3 was used for PCelA and Phelicase construct. PCelA / Phelicase gene was fused with BBa_E0240, which contains a medium RBS (BBa_B0032), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this GFP generator is to indicate the functionality of PCelA and Phelicase in the presence and absence of ComX protein. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E.coli used is DH10B.

PCelA / Phelicase gene
PCelA and Phelicase gene was cloned from the genomic DNA of E.Coli strain NCTC7465 by PCR using Vent Polymerase. The difference between these two promoters is the whole sequence of Phelicase was obtained from Wellcome Trust Sanger Institute, a British genomics and genetics research institute. (https://www.sanger.ac.uk/)

PcelA Forward primer: TTTCTGTCTAGAGTTGACCAAGGAAGACTATTTTGC

PcelA Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAATTTTCTCCTCTCTTAGATTATTCGTAAGAGG

Phelicase Forward primer: TTTCTGTCTAGAGTGGACTTGGCCGTCCTCT

Phelicase Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAGACGTTCTTCTTCTGTTAATTCATTCTCAG

Assembly and Characterization

Assembly
comX and comW construct contain 3 parts that needs to be assembled: K880005 which contains constitutive promoter and RBS, comX engineered with C-myc tag / comW engineered with FLAG tag, and a double terminator in pSB1C3 backbone. Promoter, RBS, comX engineered with C-myc tag, and double terminator were combined using traditional digestion and ligation method. The ligation product was confirmed by digestion check and sequencing.

Combox construct also contains 3 parts that need to be assembled: PcelA/Phelicase promoter, BBa_E0240 which contains RBS, GFP and double terminator, and pSB1C3 backbone. All three parts were combined using traditional digestion and ligation method. The final ligation product was confirmed by digestion check and sequencing.

Characterization
RPU (Relative promoter unit) and leakage will be measured as a characterization of 100 base pairs combox promoter (PcelA), and 160 base pairs combox promoter (Phelicase). For combox promoter characterization, ComX generator construct which contain K880005, comX gene, and B0015, is ligated with PcelA / Phelicase construct which contain combox promoter and GFP generator. In order to characterize the two combox promoters, ComX generator-combox construct was migrated from pSB1C3 to pSB3K3. RPU are measured with J23100 Andersen family promoter as a reference promoter.


Home

Pneumosensor

Riboregulator

Human Practice

Team

WetLab

Achievement