Week 1: 02.04.2014 – 06.04.2014

Cultivation of E. coli Nissle 1917
Genomic DNA extraction of E.coli Nissle strain
Production of BfR, FTNA1 and FTNA2
Restriction digest
PCR Purification
Ligation Assay
Transformation into DH5α-Cells

Week 2: 07.04.2014 – 13.04.2014

Colony PCR to check the results
Bfr, FTNA 1, FTNA 2 primar designed for amplification
Transformation of pQE_80L into DH5α
Cultivation of BfR, FTNA 1, FTNA 2 in LB

Week 3: 14.04.2014 – 20.04.2014

Miniprep of the cells from Week 2
DNA concentration determination and sequencing
Expression of BfR, FTNA 1, FTNA 2 and induction with IPTG
Production of a Mutaflor-Supression culture and streaking

Week 4: 21.04.2014 – 27. 04.2014

Minirep

Week 5: 28.04.2014 – 04.05.2014

PCR Plasmid/Primar and Parameter check with Q5 Polymerase and Phusion Polymerase
Miniprep of [pKD46+ DH5α] and [pKD4 + DH5 α]
Genomic DNA extraction from Pseudomonas putida
Enzyme digestion of different plasmids

Week 6: 05.05.2014 – 11.05.2014

Preculture of strains from Budisa strain databse in LB medium and Midiprep
Canamycin cassette PCR of pKD4
Restriction digest of Plasmid pKD4 and pKD46v

Week 7: 12.05.2014 – 18.05.2014

Biotransformation of Ferritin and pKD46 in Nissle and DH5 α strains

Week 8: 19.05.2014 – 25.05.2014

Gel extraction of FieF PCR
Gene Knockout of FieF in [RV + pKD46] and [WM10+pKD46]
Transformation of pKD46 in Nissle and MG 1655
PCR of ATPCS and PPMT
Digestion of pQE_80L for cloning

Week 9: 26.05.2014 – 01.06.2014

Production of LB plates
AMB-1 and Microfluidic Chip were picked up from Max-Plank Institute

Week 10: 02.06.2014 – 08.06.2014

Colony PCR and analytical gel electrophoresis for identifying the right clones
PCR of ATPCS and PPMT to identify the correct amplification parameter.
Colony PCR for Knockout.
PCR of ATPCS and PPMT with Q5 High Fidelity Mastermix.

Week 11: 09.06.2014 – 15.06.2014

Refine the PCR of PPMT and ATPCS with DMSO

Week 12: 16.06.2014 – 22.06.2014

PCR amplification of ATPCS from cDNA
Colony PCR to seperate cells with FieF Knockout
Restrcition digest of pQE_80L and ATPCS-PCR Fragment
Test expression of Ferritin in RV308 (pSB1C3_Ferritin) and Nissle (pSB1C3_Ferritin)

Week 13: 23.06.2014 – 29.06.2014

Amplification of ATPCS from cDNA and PCR Purification
Preparation of Nissle, Nissle + Ferritin, RV 308, Rv 308 + Ferritin pre-cultures
Transformation of human Ferritin on PC514 to Nissle and RV 308
Induction of Ferritin expression with IPTG

Week 14: 30.06.2014 – 06.07.2014

Colony PCR and Ligation of ATPCS
Knockout of FieF and FUR in RV308 and Nissle
Transformation of RFP device and Ferritin in RV308, Nissle and WM110 strains.
PCR amplification of knockout cassette FUR/FieF
Expression of RV308 (RFP) and RV308 (RFP + Ferritin) after Induction with IPTG

Week 15: 07.07.2014 – 13.07.2014

Preparation of cryostocks and pre-cultures of ATPCS clone 1-10, WM 110, RV 308, Nissle
PCR of PPMT with goTaq Polymerase
Miniprep of ATPCS clone number 3

Week 16: 14.07.2014-20.07.2014

Midiprep of pQE_80L , PMA-T_PPMT, pKD46
Digestion of pQE_80L with Hind III and SacI

Week 17: 21.07.2014-27.07.2014

Miniprep and Restriction of pBADex-mYFP Venus (Amp); pEx-HisII (Amp); pJS418_Phagemid (dummy) (Cm)
Ligation of PPMT Fragment from pMAC_PPMT into pEX_HisII

Week 18: 28.07.2014-3.08.2014

Degradation test of prepped TB-Expression Plasmids
Transformation of pEX_His_PPMT in MG1655, DH5α, DH10B strains
Colony PCR of the PPMT clones
Miniprep and Sequencing of pEX_His_PPMT in DH5 α
Ligation of ATPCS PCR Fragment into pQE_80 L
Colony PCR of pQE_80L_ATPCS

Week 19: 04.08.2014 -10.08.2014

Preculture of ATPCS clones for Sequencing
PCR of BamHI_PPMT_GS, GS_ATPCS_HindIII, BamHi_HuFerritin_HindIII
Transformation of BFR M52H in DH10B.

Week 20: 11.08.2014 - 17.08.2014

Prepare chemically competent cells
Generation of Heme-free BFR by Site-directed Mutagenesis
Digestion of various PCR fragements for cloning into pQE_80L
Colony PCR of pQE_80L
Clone Sequencing

Week 21: 18.08.2014 – 24.08.2014

SDS-PAGE with Coomasie staining for identification of protein expression

Week 22: 25.08.2014 – 31.08.2014

Calibration curve for iron concentration measurement

Week 23: 15.09.2014 – 21.09.2014

Preparing cultures for fluorescence microscopy
Constructing pQE_80L_T5_ATPCS_lac_PPMT
Digest and Dephosphorylation of vector pQE_80L_ATPCS
PCR of Biobrick parts (BB0-BB3)
Digest of pSB1C3-Ferritin

Week 24: 22.09.2014 – 28.09.2014

Preparation of pre-cultures
Checking insertion of gene in ATPCS_PPMT clones by colony PCR
Digestion of miniprepped pSB1C3_Ferritin (Calgary) for extraction of vector for Biobrick preparation
Mutagenesis of ATPCS in different plasmid_ATPCS construct
Berlin Vector – pQE-80L-JBFS- huFerritin Assembly PCR
Isolation of plasmid DNA of pQE80L_ATPCSMut_GS_PPMT and pQE80L_ATPCS_PPMT
Repeat PCR of Biobricks

Week 25: 29.09.2014 – 05.10.2014

Digestion of Biobrick parts
Ligation of Biobrick parts with pSB1C3 backbone
Plasmid Digestion and checked with PCR

Week 25 06.10.2014 – 12.10.2014

Colony PCR
Miniprep of cultures and preparation of sequencing samples
Preculture of knockouts
PCR of pSB1C3 backbone
Extraction of PCR Product (pSB1C3 linearised)
Iron concentration measurement in knockout strains

04/02 Wednesday - Cultivating E. coli Nissle 1917

LB plates were produced without antibiotic. Therefore 10 ml MQ-H₂O were sterile filtered in 15 ml falcon tube. 1 capsule Mutaflor 331800 was solved in the sterile water. The E. coli Nissle solution was incubated at 37°C and 200 rpm for 1 h and crossed out at 4 plates to get different dilution of cells.

04/03 Thursday - Genomic DNA extraction of ECN - first step

For extraction of the genomic DNA of E. coli Nissle, 2 E. coli colonies were oicked from LB plate (dilution 1:10³) and used for inocculation of 6 ml LB precultures. These were grown over night at 37°C and 200 rpm.

04/04 Friday - Genomic DNA extraction of ECN - second step

For preperation of the genomic DNA 1 ml of each preculture was taken and a genomic extraction performed using the Wizard Genomic DNA purification Kit. See instructions of the purification Kit by Promega. Genomic DNA was stored at 12°C in fridge. As E. coli Nissle is a natural organism without resistence genes both precultures were streaked out on LB, LB+KAN and LB+AMP. All plates were incuvated over the weekend at 37°C. DNA concentration was meassured by 260 nm using Goldi. DNA was diluted 1:40 in a UV cuvette and DNA absorption meassured at 260/28 nm in goldi.
'''For genomic DNA:''' {| class="wikitable" |- | 1: || 1390 ng/µl |- | 2: || 988 ng/µl |}

04/05 Saturday - Genomic DNA extraction of ECN - results

Bacteria growth only on LB plate indicates that there was no contamination with AMP or KAN restinatant E. coli. This doesn´t mean that there is no contamination at all. See for sure on PCR.
{| class="wikitable" |- ! LB !! LB+KAN !! LB+AMP |- | + || - || - |}

04/06 Sunday

==Production of BfR, FTNA1 and FTNA2== ===Restriction digest=== After 2 purifications of plasmids:
{| class="wikitable" |- | p1 || 84ng/µl || 10µl |- | p2 || 72,2ng/µl || 10µl |- | p3 || 54,8ng/µl || 23µl |} ====Restriction program==== {| class="wikitable" |- | || 1x || 4x |- | plasmid P2 || 3µl || 12µl |- | BamHI (FD) || 1µl || 4µl |- | HindIII (FD) || 1µl || 4µl |- | Buffer (FD) || 2µl || 8µl |- | H₂O || 13µl || 52µl |} --> 37°C for 1h (restriction) --> 80°C for 10min (deactivation) {| class="wikitable" |- | PCR || 6,38µl || 4,56µl || 2,71µl |- | BamHI (FD) || 1µl || 1µl || 1µl |- | HindIII (FD) || 1µl || 1µl || 1µl |- | Buffer (FD) || 2µl || 2µl || 2µl |- | H₂O || 19,62µl || 21,44µl || 23,29µl |} --> 37°C for 1h (restriction) --> 80°C for 10min (deactivation) {| class="wikitable" |- | Plasmid || 1 || 2 || 3 |- | P || 10µl || 10µl || 18µl |- | BamHI (FD) || 1µl || 1µl || 1µl |- | HindIII (FD) || 1µl || 1µl || 1µl |- | Buffer (FD) || 2µl || 2µl || 3µl |- | nuc.free H₂O || 6µl || 6µl || 7µl |} --> 37°C for 1h (restriction) --> 80°C for 10min (deactivation) ===PCR Purification (without isopropanol)=== Elution buffer 20µl; 1min incubated {| class="wikitable" |- | plasmid P1-3 || 45,3ng/µl |- | BfR || 12,9ng/µl |- | FTNA1 || 34,4 ng/µl |- | FTNA2 || 29,9ng/µl |} ===Ligation Assay=== {| class="wikitable" |- ! - !! Control !! BFR !! BFR !! BFR !! FTNA1 !! FTNA1 !! FTNA1 !! FTNA2 !! FTNA2 !! FTNA2 !! BFR_E !! BFR_E !! BFR_E |- | Dilution || - || 1x || 3x || 5x||1x|| 3x || 5x||1x || 3x || 5x ||1x || 3x || 5x |- | Vector DNA || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 |- | Insert DNA || 0 || 0,4 || 1,6 || 2,0 || 0,10 || 0,47 || 0,79 || 0,18 || 0,52 || 0,90 || 0,40 || 1,16 || 2,0 |- | Buffer || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 |- | T4 DNA-Ligase || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 |- | H₂O || 7,65 || 7,25 || 6,5 || 5,65 || 7,5 || 7,20 || 6,85 || 7,50 || 7,20 || 6,85 || 7,25 || 6,50 || 5,65 |- |} ===Transformation=== --> Transformation of 5µl Sample into DH5α-Cells --> Incubation o/n at 37°C after streating out on LB+amp plates using sterile beads {| class="wikitable" |- ! BFR !! FTNA1 !! FTNA2 |- | 5,2ng || 5,51ng || 5,43ng |- | 15,6ng || 16,5ng || 16,27ng |- | 26,0ng || 27,4ng || 27,13ng |}

04/07 Monday - Cloning Results

{| class="wikitable" |- ! Sample !! CFU |- | Control || 13 |- | tBFR 1 || 121 |- | tBFR 3 || 38 |- | tBFR 5 || 664 |- | BFR 1 || 87 |- | BFR 3 || 151 |- | BFR 5 || 150 |- | FTNA1 1 || 65 |- | FTNA1 3 || 131 |- | FTNA1 6 || 191 |- | FTNA2 1 || 84 |- | FTNA2 3 || 114 |- | FTNA2 5 || 151 |} --> picked 5 colos per construct for coloPCR (50µl TE-buffer; 96°C; 10min) --> rescue plate '''colPCR Programm''' {| class="wikitable" |- ! - !! 1x !! Mastermix 23x |- | nuc.free H₂O || 13,7µl || 315,1µl |- | 10x Dream Taq Buffer || 2µl || 46µl |- | 25mM MgCl₂ || 1,2µl || 27,6µl |- | 10mM dNTPs || 0,5µl || 11,5µl |- | Primer T5 prom (PB16) || 0,5µl || 11,5µl |- | Primer T5 term (PB17) || 0,5µl || 11,5µl |- | |- | boiled colos || 1µl + 18,4ml Mastermix |- | Taq Polymerase || 0,5µl |} {| class="wikitable" |- ! Temperature !! Time |- | 95°C || 3' |- |30 cycles |- | 95°C || 30'' |- | 55°C || 30'' |- | 72°C || 1' |- | |- | 72°C || 10' |- | 12°C || hold |}

04/08 Tuesday - Amplification of ferritin genes

Primer designed for amplification:
'''primer Bfr:''' FW: 5' GC G| G A T C C AAAGGTGATACTAAAGTTATAAATTATCTC(GC 23,33% Tm = 57,5) 3' OK RW: 5' GC A| A G C T T TCAACCTTCTTCGCG(GC 50% Tm = 58,5) 3' OK '''primer FtnA1:''' FW: 5' GC G| G A T C C GCAACCGCTGGAATG(GC 60% Tm = 60,5) 3' OK RW: 5' GC A| A G C T T TCAATGCAGCTGATGC(GC 50,0% Tm = 58,5) 3' OK '''primer FtnA2:''' FW: 5' GC G| G A T C C CTGAAACCAGAAATGATTG(GC 36,8% Tm = 65,1) 3' OK RW: 5' GC A| A G C T T TTAGTTTTGTGTGTCGAGG(GC 42,1% Tm = 56,8) 3' OK Using the Thermoscientific PCR mastermix phusion polymerase, 2x 50 µl reactions per amplification: {| class="wikitable" |- | Nuc-free H₂O || 39,5 µl |- | 2x mastermix || 50,0 µl |- | FW primer || 5,0 µl |- | RW primer || 5,0 µl |- | template DNA || 0,5 µl |} '''PCR programs:''' {| class="wikitable" |- | || 98°C || 10s || 1x |- | || 98°C || 5s || 30x |- |primer|| Bfr/ FtnA1/ FtnA2 || 60,5°C/ 58,9°C/ 56,1°C || 30x |- | || 72°C || 10s || 30x |- | 72°C || 60s || Beispiel || 1x |} Transformation of pQE_80L into DH5alpha
Plasmid from plasmid database of TU workgroup by Prof. Budisa was taken:
plasmid ID: 4; concentration = 308 ng/µl
Unthaw 50 µl aliquot of DH5alpha or BL21 DE3 gold on ice for 10 min.Than Use 308 ng and 616 ng of plasmids to bind on Ca2+-surface of the cell membranes. Heat shock was performed for 30-90 s. The cells were incubated on ice for 2 min and than there was added 950 µl LB media. The cells were incubated at 37°C for 60 min. After this 70 µl of transformed E. coli suspension was streacked out onto a plate with the appropriate selection marker. The plate was incubated over night at 37°C. To prepare preculture 2 colonies were picked and added into 5 ml LB media + 5 µl AMP. The precultures were incubated over night at 37°C and 200 rpm.

04/10 Thursday - Expression of Ferritin in LB

→Innoculate 20ml LB + amp with 1ml of a preculture
{| |- ! Title !! No. !! Wavelength !! Absobance !! Volume |- | BfR || 1 || 600nm || 0,529A || 1,51ml |- | FTNA1|| 2 || 600nm || 0,307A || 3,25ml |- | FTNA2 || 3 || 600nm || 0,605A || 1,32ml |} →Incubation for 2h until OD₆₀₀=0,6-08
{| |- ! Title !! No. !! Wavelength !! Absobance |- | BfR || 1 || 600nm || 0,825A |- | FTNA1|| 2 || 600nm || 0,883A |- | FTNA2 || 3 || 600nm || 0,859A |} → Take SDS Sample non-induced
→Induce with 20µl IPTG
→Add Fe²⁺
→Expression: 4h at 22°C
Cultivation was aborted because of heat development

.

04/14 Monday - Miniprep

Miniprep of the cell-seperation streak out of the cloning procedure from december 2013
'''Miniprep-Kit of ThermoScientific'''
{| class="wikitable" |- ! - !! Title !! Concentration in ng/µl |- | A4 || BfR || 66 |- | B3 || FTNA1 || 138 |- | C5 || FTNA2 || 88 |- | D2 || BfR_Electro || 144 |} =='''DNA Concentration Determination'''== {| |- | Dilution Factor || 20 |- | Integration Time || 1s |- | Factor || 50 |- | Units || µg/ml |} {| class="wikitable" |- ! - !! Title !! No. !! 260nm !! 280nm !! 320nm !! Ratio !! Conc. |- | A4 || BfR || 1 || 0,056 || -0,022|| -0,010 || 2,05 || 66 |- | B3 || FTNA1 || 2 || 0,135 || 0,067 || -0,003 || 1,96 || 138 |- | C5 || FTNA2 || 3 || 0,078 || 0,035|| -0,008 || 2,00 || 86 |- | D2 || BfR-Electro || 4 || 0,150 || 0,078 || 0,006 || 2,02 || 144 |}

04/16 Wednesday - Sequencing

Preparation of the sequencing for the Samples from 16.01.2013
{| |- | T5 prom. Primer || 3µl |- | Plasmid || 12µl |} {| |- | A4 || 6µl |- | B3 || 6µl |- | C5 || 6µl |- | D2 || 6µl |}

04/17 Thursday - Expression of BfR and FTNA1/2

4x sterile 250ml Erlenmeyer
+50ml LB
+50µl amp
+2,5ml preculture
Incubation: 1h at 30°C {| class="wikitable" |- ! No. !! Title !! Wavelength !! Absorbance |- | 1 || BfR || 600nm || 0,909A |- | 2 || FTNA1 || 600nm || 0,980A |- | 3 || FTNA2 || 600nm || 0,930A |- | 4 || BfR+20?? || 600nm || 0,970A |} →Take SDS-Sample
→Induction with 50µl IPTG
→Addition of 0,0525g Fe-citrate (20mM dissolved in 1ml sterile Water)
→Incubation for 3h at 30°C
→continue incubation o/n
→Centrifuge with 6800g for 5min

04/18 Friday - Production of LB-Plates

===Production of a Mutaflor-Supression-culture=== →10ml sterile LB
→Add the content of a Mutaflor capsula (white pouder)
Incubation: 37°C at 220rpm
===Production of Dilutions of the Supression-culture and out streaking=== →1µl of the supression-culture to 999µl LB (1:1000)
→100µl of that dilution to 900µl LB (1:10⁴)
→10µl of that dilution to 990µl LB (1:10⁵)
→Streak out 50µl of each culture on LB with sterile beads
Incubation: 37°C

04/24 Thursday - Mini-Prep

(Ammar Al-Shameri) {| class="wikitable" |- | 1 || PSB || D40 || 9fP || CR/LB |- | 2 || PSB || D20 || 9fP || CR/LB |- | 3 || PSB || D40 || fs || LB/CR |- | 4 || PSB || D40 || LB/CR |- | 5 || PSB || AB || Turyu || CR/LB |- | 6 || PSB || D48 || 9fP || CB/CR |}

04/28 Monday -PCR Plasmid/ Primer and Parameter Check

(Salah and Christina)
Check of:
-Plasmids/Primer
-Annealing temperature
-Phusion and Q5 Polymerase ===Plasmids=== iGEM Plasmid pkD4 (Stock 200ng/µl) =>1:200 diluted = 1ng/µl WH (Willi Hauke) Plasmid pkD4 (0,72ng/µl) ===Primer=== P1 FieF (iGEM) fwd tnaA KO (WH) P2 FieF (iGEM) rev tnaA KO (WH) ===Combinations=== (4 combinations with Phusion; 4 combinations with Q5 ) {| border="2" | | '''Plasmid''' | '''Primer''' | '''Primer''' |- | '''1. ''' | iGEM Plasmid | P1 (iGEM) | P2 (iGEM) |- | '''2. ''' | WH Plasmid | fwd tnaA KO | rev tnaA KO '''POSITIVCONTROL''' |- | '''3. ''' | iGEM Plasmid | fwd tnaA KO | rev tnaA KO |- | '''4. ''' | WH Plasmid | P1 (iGEM) | P2 (iGEM) |} Each of the four combinations was prepared 3 times => for Gradient PCR ===Phusion Polymerase PCR Assay=== 20µl Reaction {| class="wikitable" |- ! !! Plasmid !! Primer !! Primer |- | 1. || iGEM Plasmid || P1 (iGEM) || P2 (iGEM) |- | 2. || WH Plasmid || fwd tnaA KO || rev tnaA KO POSITIVCONTROL |- | 3. || iGEM Plasmid || fwd tnaA KO || rev tnaA KO |- | 4. || WH Plasmid || P1 (iGEM) || P2 (iGEM) |- |} ===Q5 Polymerase PCR Assay=== 20µl Reaction {| {{table}} | align="center" style="background:#f0f0f0;"|'''5xQ5 Reaction Puffer (G2 runder Behälter)''' | align="center" style="background:#f0f0f0;"|'''4µl''' | align="center" style="background:#f0f0f0;"|'''1x''' |- | 10mM dNTPs ||0,4µl||200µM |- | 10µM forward Primer||1µl||0,5µM |- | 10µM reverse Primer||1µl||0,5µM |- | Template DNA||1µl||1pg-1ng sein |- | Q5 High Fidelity DNA Polymerase||0,2µl||0,02U/µl |- | GC enhancer||4 µl|| |- | Nuclease-Free Water ||to 20µl|| |- | |||| |- | ||8,4µl|| |- | |} ===FUR PCR Assay===
(Along with the above mentioned PCR Assays another Gradient PCR with FUR-Primer is performed)
Aliquot of the FUR Primer (100µM) 1:10 diluted =>10µM
20µl Reaction with Phusion-Polymerase (see above)
with WH Plasmid and P1 FUR & P2 FUR Primer
===Gradient PCR Program=== Thermocycling Conditions for the Gradient PCR
Programm-NAME: Q5 grad trp KO
{| {{table}} | align="center" style="background:#f0f0f0;"|'''Step''' | align="center" style="background:#f0f0f0;"|'''TEMP''' | align="center" style="background:#f0f0f0;"|'''TIME''' |- | Initial Denaturation||98°C||30 sec |- | 5 Cycles||98°C||8 sec |- | ||64±5°C||25 sec GRADIENT |- | ||72°C||Trp ko: 1528bpà45s |- | 25 Cycles||98°C||8 sec |- | ||72°C||70 sec |- | Final Extension||72°C||2 min |- | Hold||8°C|| |- | |} ===Gel-Electrophoresis=== 1% Agarose Gel
5µl Sample +1µl loading dye (1:6)
8µl diluted GeneRuler Mix ladder
MODE: 90V 25min
'''Sample label:''' P = with Phusion Polymerase
Q = with Q5 Polymerase
1 = 1. Kombination
2 = 2. Kombination
3 = 3. Kombination
4 = 4. Kombination
'''Gradient''' 1 = 59°C 4 = 63°C 8 = 69°C {| {{table}} | align="center" style="background:#f0f0f0;"|'''Gel 1 Phusion''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | P FUR||P1||P1||P1||P2||P2||P2||Marker||P3||P3||P3||P4||P4||P4 |- | |||||||||||||||||||||||||| |- | 8||1||4||8||1||4||8||||1||4||8||1||4||8 |- | Gel 2 Q5|||||||||||||||||||||||||| |- | ||Q1||Q1||Q1||Q2||Q2||Q2||Marker||Q3||Q3||Q3||Q4||Q4||Q4 |- | |||||||||||||||||||||||||| |- | ||1||4||8||1||4||8||||1||4||8||1||4||8 |- | |} ====Results==== {| {{table}} | align="center" style="background:#f0f0f0;"|'''Gel 1 Phusion Result:''' | align="center" style="background:#f0f0f0;"|'''For FUR-Primer no Amplifikation''' |- | || |- | ||For iGEM-Plasmid no Amplifikation |- | || |- | ||Combination 2 (WH Plasmid & Primer)= only non-specific amplification |- | || |- | ||Combination 4 (WH Plasmid & iGEM Primer)=Bands for 59°C and 63°C + non-specific amplification |- | || |- | || |- | align="center" style="background:#f0f0f0;"|'''Gel 2 Q5 Result:'''||For iGEM-Plasmid no Amplifikation |- | || |- | ||Combination 2 (WH Plasmid & Primer) = bands for all three annealing temperature observed+non-specific amplification |- | || |- | ||Combination 4 (WH Plasmid & iGEM Primer)= Bands at all three annealing temperature+non-specific amplification |- | |}

iGEM Plasmid not to be used anymore. FUR need to be checked again.

04/29 Tuesday - Mini-Prep

(Aritra)
[pKD46 + DH5α]→ 155ng/µl
[pKD4 + DH5α]→ 302ng/µl

05/02 Friday - Genomic DNA extraction from Psedomonas putida

(Johann)
-->see Protocol Wizard ® Genomic DNA Purification Kit - Strain from VLB Martin Senz PHO Psedomonas putida KT2242 B_0712 from 29.04.2014 culture
- 2 days in 30°C Shaking Incubator.
- Mikro 22R Centrifuge Hettich (16000g)
Final DNA Concentration measured after purification = 95ng/µl

02.05.2014 - DNA Digestion to test Plasmids

{| {{table}} | align="center" style="background:#f0f0f0;"|'''Samples''' | align="center" style="background:#f0f0f0;"|'''Conc. DNA (ng/µl)''' | align="center" style="background:#f0f0f0;"|'''Enzymes used''' | align="center" style="background:#f0f0f0;"|'''Expected band length''' | align="center" style="background:#f0f0f0;"|'''Evaluation''' |- | pKD4||302||Xbal||1874,1393||Possible plasmid, failed |- | pKD46||40||EcoRI||4820,1509||Failed |- | pKD46||39||EcoRI||4820,1509||Failed |- | pKD4||60||Xbal||1874,1393||Possible(passed); whole plasmid |- | pSBAC3||88||SpeI/EcoRI||2047,22||Possible (passed); smallpattern |- | pSBAC3-D20-GFP||115||SpeI/EcoRI||2047,957||whole plasmid; failed |- | pSBAC3-D40-Bfr||86||SpeI/EcoRI||2047, 774||Whole plasmid; failed |- | pSBAC3-D40-GFP||80||SpeI/EcoRI||2047,1014||Whole plasmid; failed |- | pSBAC3-AB-Tyrosin||110||SpeI/EcoRI||2047,3319||Failed |- | pSBAC3-D40||164||SpeI/EcoRI||2047,267||Failed |- | pSBAC3-D40-GFP-ssr||106||SpeI/EcoRI||2047,1032||Passed; whole plasmid |- | |} ==Gel Electrophoresis== '''Key:'''
-band1: Ladder
-band5:Ladder
-residual bands, see table above

===Results=== pKD4 with 60(ng/µl) best candidate for PCR.

05/05 Monday - Preculture of strains from Budisa strain database in LB Medium

(Johann) 1. BU31 (pKD4) in 50 ml LB+Kanamycin+Ampicillin 37°C 220 rpm
2. BU32 (pKD46) in 50 ml LB+Ampicillin 30°C 240rpm
3. BU31 (pKD46) in LB plate+Ampicillin 30°C
==Midiprep== (christina) Midiprep of BU31 (pKD4) and BU32 (pKD46) from strain Database.
Concentration pKD4 = 104 ng/µl
Concentartion pKD46 = 161 ng/µl

05/06 Tuesday - Gel-Electrophoresis

(Aritra) Kanamycin Cassette PCR (pKD4 from MidiPrep 05.05.2014 104ng/µl Christina)
'''Key:'''
- 1st: Ladder
- 2nd and 3rd: Fief
- 4th: Negative control
- 7th and 8th: FUR

===Results=== FieF worked well; FUR no bands ==Restriction digest of Plasmid pKD4 and pKD46== {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | ||pKD4||pKD46 |- | Plamid ||19.2µl||12.5µl |- | Digestion Enzym||Xbal 1µl||Xmal 1µl |- | nuclease free H2O||24.8µl||31.5µl |- | 10xFO green Buffer||5µl||5µl |- | Total||50µl||50µl |- | |} - Both the reaction mix incubated at 37°C for 1 hr. - After that another 1 hr at RT. ===Gel-Electrophoresis=== - 20µl of both the samples together with whole plasmids loaded on 1% Agarose Gel
====Results==== '''Key:'''
-1st: pKD4 (XbaI digested)
-2nd: pKD4 (undigested)
- 3rd: Ladder
- 4th: pKD46 (undigested)
-5th: pKD46 (XmaI digested)
===Gel Extraction=== -Used GeneJet GelExtraction Kit by Thermo Scientific ====Results==== DNA Concentration: 16ng/µl

05/16 Friday - Biotransformation of Ferritin and pKD46 in Nissle and DH5-α strain

concentration Ferritin 120ng/µl
concentration pKD 46 95 ng/µl
Protocol *electro competent cells of DH5α and Nissle were thawed on ice *0.4µl of Ferritin and 0.53 µl of pKD46 was added to the cells *cells with DNA were transferred to cuvettes for electroporation, then 950ml (LB-medium) was added to the cells immediately *incubation at 37°C for ferritin, 30°C for pKd46 for 1 h with shaking *the cells were plated on Amp plates for pKD46 and CM for Ferritin *Transformation did not work.

05/21 Wednesday - PCR Gel-Extraction of FieF

(Christina)
1% Agarosegel + 0,5µl EtBr
45µl Sample+9µl Loading Dye
8µl Ladder
--> Gel-Extraction Kit used with 50µl nuclease-free water for elution
[[Datei:140521 DNA conc.jpg|miniatur|zentriert]] ==Gene Knockout of FieF== (Salah) ===Preparation of the preculture=== '''Used Precultures:'''
- RV +pKD46
- WM10 +pKD46
The precultures was diluted to OD₆₀₀=0,1 and then incubated for 2h at 30°C until they reach OD₆₀₀=0,6
{| class="wikitable" |- ! Title !! Wavelength !! Absorbance |- | Reference || 600nm || 0,000A |- | RV+pKD46 || 600nm || 0,066A |- | WM10+pKD46 || 600nm || 0,050A |} (The culture was diluted 1/10 for the OD measurement)
→The precultures are ready for the Rekombinase induction with Arabinose ===Induction with Arabinose=== The cultures have been induced with 500µl arabinose (1M) →After the induction, the cultures have to be incubated for further 30min at 30°C {| class="wikitable" |- ! Title !! Wavelength !! Absorbance |- | Reference || 600nm || 0,000A |- | RV+pKD46 || 600nm || 0,084A |- | WM10+pKD46 || 600nm || 0,067A |} →From now on the cultures need to be cooled on ice ===Preparation for the Electroporation=== ===Electroporation=== '''Electroporation-Program: Ec1'''
-Amount of DNA sample: 75-150ng
{| class="wikitable" |- ! Sample !! Conc !! Used Volume !! Strain !! Electroporation Time |- | FieF1 || 42ng/µl || 2µl (84ng) || RV || 4,4ms |- | FieF2 || 9ng/µl || 10µl (90ng) || RV || 4,1ms |- | FieF1 || 42ng/µl || 2µl (84ng) || WM10 || 4,3ms |- | FieF2 || 9ng/µl || 10µl (90ng) || WM10 || 4,8ms |} After the transformation, the cultures was immediately prepared with 950µl SOC and incubated for 60min at 30°C without antibiotics --> recovery ===Selection-cultures=== The selection of positive clones is done by using LB plates with kan+amp
Incubation: 30°C o/n

05/22 Thursday - Transformation of pKD46

(Salah) ===Preparation of the preculture=== '''Used Precultures:'''
- MG1655
- Nissle
The precultures was diluted to OD₆₀₀=0,1 and then incubated for 2h at 30°C until they reach OD₆₀₀=0,6
{| class="wikitable" |- ! Title !! Wavelength !! Absorbance |- | Reference || 600nm || 0,000A |- | MG1655 || 600nm || 0,062A |- | NIssle || 600nm || 0,054A |} (The culture was diluted 1/10 for the OD measurement)
→From now on the cultures need to be cooled on ice ===Preparation for the Electroporation=== ===Electroporation=== '''Electroporation-Program: Ec1'''
-Amount of DNA sample: 75-150ng
{| class="wikitable" |- ! Sample !! Conc !! Used Volume !! Strain !! Electroporation Time |- | MG1655 1 || 42ng/µl || 2µl (84ng) || RV || 5,4ms |- | MG1655 2 || 9ng/µl || 10µl (90ng) || RV || 5,8ms |- | Nissle 1 || 42ng/µl || 2µl (84ng) || WM10 || 0,7ms (thrown away) |- | Nissle 2 || 9ng/µl || 10µl (90ng) || WM10 || 5,8ms |} After the transformation, the cultures was immediately prepared with 950µl SOC and incubated for 60min at 30°C without antibiotics --> recovery ===Selection-cultures=== The selection of positive clones is done by using LB plates with amp
Incubation: 30°C o/n == PCR of ATPCS and PPMT == {| class="wikitable" |- ! Mastermix !! ATPCS !! PPMT |- | nuc.free water|| 18.9 || 17.5 |- | 2x Fusion Mastermix || 25 || 25 |- | Fw Primar || 2.5 || 2.5 |- | Rw Primar || 2.5|| 2.5 |- | template DNA || 1.1 || 2.5 |} {| class="wikitable" |- ! ATPCS !! Programm |- | 98°C || 10 |- | 98°C|| 5 30 cycles |- | 62°C|| 5 30 cycles |- | 72°C || 5 30 cycles |- | 72°C|| 60 secs |- | 8°C|| store |} {| class="wikitable" |- ! PPMT!! Programm |- | 98°C || 10 |- | 98°C|| 5 30 cycles |- | 63,1°C|| 5 30 cycles |- | 72°C || 21 30 cycles |- | 72°C|| 60 secs |- | 8°C|| store |} ATPCS 1469 bp; PPMT 234 bp --> wrong Programm

05/23 Friday - Digestion of Vector for Cloning

Plasmid: pQE80L
Old Plasmid of Johann:
-P1≈1000ng
-P3≈400ng
{| class="wikitable" |- ! P3 !! !! P1 !! |- | SacI || 1µl || SacI || 1µl |- | HindIII || 1µl || BamHI || 1µl |- | Buffer || 2µl || Buffer || 2µl |- | Plasmid 1 || 4µl || Plasmid 3 || 16µl |- | nuc.water || 12µl || nuc. water || 0µl |} --> Incubation: 1,5h at 37°C
--> Deactivation: 20min at 80°C

05/27 Tuesday - Production of LB Plates

(Salah and Christina)
LB Agar Plates prepared:
4x with Ampicillin (25µl in 25ml)
4x with Ampicillin+ Kanamycin (25µl+25µl in 25ml)
4x Cm (25µl in 25ml)

05/28 Wednesday

Picked up from MPI: AMB-1 and Microfluidic Chip. (From the two AMB-1 cultures, one is in the freeze and the other one in the RT-Incubator)
Digestion of pQE80L:
Marker: 2 log DNA ladder 5µl
Sample 1: P1 Sacl-BamHI 10µl
Sample 2: P3 Sacl-HindIII 10µl

06/02 Monday - Colony PCR and analytical gel electrophoresis for identifying the right clones

Primer: C1 C2
C2 C5
{| {{table}} | align="center" style="background:#f0f0f0;"|'''Components''' | align="center" style="background:#f0f0f0;"|'''20 µL Reaktion''' |- | || |- | || |- | Nuc. Free water||13.7 |- | 10x Dream Taq Polymerase Puffer||2 |- | 25mM MgCl2||1.2 |- | 10mM dNTPs||0.5 |- | 10mM FW Primer||0.5 |- | 10mM RW Primer||0.5 |- | Colony||1 |- | Taq DNA Pol||0.6 |- | |} {| {{table}} | align="center" style="background:#f0f0f0;"|'''Denaturation''' | align="center" style="background:#f0f0f0;"|'''95°C''' | align="center" style="background:#f0f0f0;"|'''10min''' | align="center" style="background:#f0f0f0;"|'''''' |- | Denaturation||95°C||30sec|| |- | Annealing||55°C||30 sec|| |- | Extension||72°C||X min||30x |- | Extension||72°C||10 min|| |- | End||12||hold|| |- | |} Backup plates done. Cells given direct to PCR. 11 colonies selected.
Colony PCR with some of the clones performed. (All negative)

06/03 Tuesday - Strategy 2: PCR of ATPCS 2PPMT

(Virginia and Aritra)
===PCR Assay=== {| class="wikitable" |- ! - !! Sample1(PPMT) !! Sample2(ATPCS) |- | nuc. free water || 17,5µl || 18,9µl |- | FW Primer || 2,5µl || 2,5µl |- | RW Primer || 2,5µl || 2,5µl |- | 2x Phusion Mastermix || 25µl || 25µl |- | Template DNA || 2,5µl (250ng) || 1,1µl (250ng) |} ===PCR Program=== {| class="wikitable" |- ! PPMT (234bp) !! !! ATPCS (1469bp) !! |- | 98°C || 10' || 98°C || 10' |- |30cycles start |- | 98°C || 5" || 98°C || 5" |- | 62°C || 5" || 63°C || 5" |- | 72°C || 10" || 72°C || 45" |- |30cycles stop |- | 72°C || 1' || 72°C || 1' |- | 8°C || hold || 8°C || hold |} ===Gel-Electrophoresis=== '''Key:'''
2nd band= Ladder
3rd band= PPMT
5th band= ATPCS

06/04 Wednesday - PCR amplification of ATPCS and PPMT

(see under protocol "Amplification BamHI_PPMT_Sacl and Sacl_ATPCS_HindIII" After Gel: 1 Band visible for ATPCS around 1500bp (expected); no band for PPMT Purification of the ATPCS-PCR product from gel. conc. of ATPCS-fragment 6ng/microL freezed at -20°C on 1st floor

04.06.2014 - Colony PCR for Knockout

6 clones were picked from 2 Agar plates; Agar plates labelled with numbers with RED 3 PCR: a) Primers C1, C3 b) Primers C2, C4 c) Primers C1, C5 {| {{table}} | align="center" style="background:#f0f0f0;"|'''BandNr:''' | align="center" style="background:#f0f0f0;"|'''Clone Nr:''' | align="center" style="background:#f0f0f0;"|'''PCR type''' | align="center" style="background:#f0f0f0;"|'''Primers''' |- | 1||6||C||C1,C5 |- | 2||1||A||C1,C3 |- | 3||2||A||C1, C3 |- | 4||3||A||C1, C3 |- | 5||4||A||C1, C3 |- | 6||5||A||C1, C3 |- | 7||6||A||C1, C3 |- | 8||1||B||C2,C4 |- | 9||2||B||C2,C4 |- | 10||Marker|||| |- | 11||3||B||C2,C4 |- | 12||4||B||C2,C4 |- | 13||5||B||C2,C4 |- | 14||6||B||C2,C4 |- | 15||1||C||C1,C5 |- | 16||2||C||C2,C4 |- | 17||3||C||C2,C4 |- | 18||4||C||C2,C4 |- | 19||5||C||C2,C4 |- | |} Results: all samples with same primers are identical PCR A: one band an dimer (900-800bp) PCR B: one band (1200bp) PCR C: two bands (800 and 400 bp) - 2 of the colonies are quite luckily mix colonies that contains our knockout, bands are shown for wildtype and 2 show amplification for kanR cassette - they should be transfered to a new plate for single colony test

06/05 Thursday - New PCR protocol for ATPCS and PPMT with Q5 High Fidelity MasterMix

'''PPMT PCR Reaction:''' {| {{table}} | align="center" style="background:#f0f0f0;"|'''Component''' | align="center" style="background:#f0f0f0;"|'''25µl''' | align="center" style="background:#f0f0f0;"|'''Final Conc.''' |- | 2x Q5 MM||12. Mai||1x |- | 10µM FW Primer||02. Mai||0,5µM |- | 10µM RW Primer||2,5||0,5µM |- | 95ng/µL Putida genomic DNA||2.63 (250ng)||9.99 ng/µL |- | Nuc. Free water||Apr 87|| |- | |} '''ATPCS PCR Reaktion result''' {| {{table}} | align="center" style="background:#f0f0f0;"|'''Component''' | align="center" style="background:#f0f0f0;"|'''25µl''' | align="center" style="background:#f0f0f0;"|'''Final Conc.''' |- | 2x Q5 MM||1.,5||1x |- | 10µM FW Primer||Jan 25||0,5µM |- | 10µM RW Primer||Jan 25||0,5µM |- | 230ng/µL Arabidopsis cDNA||1.1 (250ng)||10 ng/µL |- | Nuc. Free water||08. Sep|| |- | |} PCR Program '''PPMT 234 bp result''' {| {{table}} | align="center" style="background:#f0f0f0;"|'''denaturing''' | align="center" style="background:#f0f0f0;"|'''98°C''' | align="center" style="background:#f0f0f0;"|'''180sec''' |- | Denaturing||98°C||10 sec |- | |||| |- | Annealing 30x|||| |- | ||64°C||30 sec |- | Elongation||72°C||20 sec |- | Final Elongation||72°C||2min |- | Store||8°C|| |- | |} '''ATPCS 1469bp result''' {| {{table}} | align="center" style="background:#f0f0f0;"|'''denaturing''' | align="center" style="background:#f0f0f0;"|'''98°C''' | align="center" style="background:#f0f0f0;"|'''30 sec''' |- | Denaturing||98°C||10 sec |- | |||| |- | Annealing 30x|||| |- | ||62°C||30 sec |- | Elongation||72°C||60 sec |- | Final Elongation||72°C||2min |- | Store||8°C|| |- | |}

05.06.2014

Cryostocks: RV 308 ferritin (Cm)
Nissle ferritin (Cm)
500 µl 7%DMSO+ 500 µl Cell Culture medium => -80°C

06/06 Friday - PCR for ATPCS and PPMT with Q5 High Fidelity MasterMix

PPMT PCR Reaction:
{| {{table}} | align="center" style="background:#f0f0f0;"|'''Component''' | align="center" style="background:#f0f0f0;"|'''25µl''' | align="center" style="background:#f0f0f0;"|'''25µl''' | align="center" style="background:#f0f0f0;"|'''Final Conc.''' |- | 2x Q5 MM||12. Mai||12,5||1x |- | 10µM FW Primer||02. Mai||Jan 25||0,5µM |- | 10µM RW Primer||2,5||Jan 25||0,5µM |- | 95ng/µL Putida genomic DNA||5,26 (500ng)||5,26 (500 ng)|| |- | Nuc. Free water||Apr 87||4,74|| |- | |} ATPCS PCR Reaction
{| {{table}} | align="center" style="background:#f0f0f0;"|'''Component''' | align="center" style="background:#f0f0f0;"|'''25µl''' | align="center" style="background:#f0f0f0;"|'''Final Conc.''' |- | 2x Q5 MM||12. Mai||1x |- | 10µM FW Primer||Jan 25||0,5µM |- | 10µM RW Primer||Jan 25||0,5µM |- | 230ng/µL Arabidopsis cDNA||2.2 (500ng)|| |- | Nuc. Free water||08. Sep|| |- | |} PCR programm
PPMT 234 bp
{| {{table}} | align="center" style="background:#f0f0f0;"|'''denaturing''' | align="center" style="background:#f0f0f0;"|'''98°C''' | align="center" style="background:#f0f0f0;"|'''120sec''' |- | Denaturing||98°C||10 sec |- | |||| |- | Annealing 30x|||| |- | ||64°C||30 sec |- | Elongation||72°C||20 sec |- | Final Elongation||72°C||2min |- | Store||8°C|| |- | |} ATPCS 1469bp {| {{table}} | align="center" style="background:#f0f0f0;"|'''denaturing''' | align="center" style="background:#f0f0f0;"|'''98°C''' | align="center" style="background:#f0f0f0;"|'''30 sec''' |- | Denaturing||98°C||10 sec |- | |||| |- | Annealing 30x|||| |- | ||62°C||30 sec |- | Elongation||72°C||60 sec |- | Final Elongation||72°C||2min |- | Store||8°C|| |- | |} 10µl of PCR reaction + 2µl 6XDNA loading dye was loaded onto a 1 % agarose gel
ATPCS (one clear thick epxacted band at Test of purity and quality of genomic DNA by running it through a 1% agarose gel1400 bp)
PPMT1 (no band)
PPMT2 (no band)

> '''Test of genomic DNA of P.Putida for purity and quality by running it on a 1% agarose gel'''
- looks fine on a gel. One clear band over 10 000 bp
'''!!! Improve PPMT !!!:''' Try using DMSO (NEB PCR grad) and set Annealingtemperature down to 55°C
Try different DMSO conc. : 0; 1; 5; 8 %

06/11 Wednesday - Continuation of work from 06.06.2014: PCR for (ATPCS and) PPMT with Q5

PPMT PCR without success last weak. Therefore the temperature of the annealing step should reduce from 64°C up to 55°C in the pcr programm.
'''1) corrected pcr programm for PPMT''' {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''T [°C]''' | align="center" style="background:#f0f0f0;"|'''t [s]''' |- | Denaturating||98||120 |- | Denaturating||98||10 |- | Annealing||55||30 |- | Elongation||72||60 |- | Final Elongation||72||120 |- | Store||8|| |- | |} '''2) PPMT pcr reaction''' Different samples with concentrations on DMSO 0%, 1%, 5%, 8% were prepared. Use 99,97% DMSO the samples were prepared with the following pattern: The final volume is 25μl.
{| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''#1 [μl]''' | align="center" style="background:#f0f0f0;"|'''#2 [μl]''' |- | Q5 MM||12,5||12,5 |- | 10 μl FW Primer||2,5||1,25 |- | 10 μl RW Primer||2,5||1,25 |- | Putida genomic DNA 95 ng/μl|| 5,26|| 5,26 |- | dazu 1.: DMSO,||0||0 |- | |||| |- | nuclease free H₂O||2,24||4,74 |- | dazu 2.: DMSO,||0,25||0,25 |- | nuclease free H₂O||1,99||4,49 |- | dazu 3.: DMSO,||1,25||1,25 |- | nuclease free H₂O||0,99||3,49 |- | dazu 4.: DMSO,||2||2 |- | nuclease free H₂O||0,24||2,74 |- | |} '''the 7 samples were labeled by the following schema:''' PPMT.1.1, PPMT.1.2, PPMT.1.3, PPMT.1.4 (Primer je 2,5μl, DMSO Konz. 0,1,5,8 %) PPMT.2.2, PPMT.2.3., PPMT.2.4 (Primer je 1,25μl, DMSO Konz. 1,5,8 %)

06/12 Thursday - PCR of PPMT

Amplification of PPMT with DMSO
''(Continuation of work from 06.06.2014: PCR for PPMT with Q5'' For Protocol please see Labjournal from 11.06.2014
'''following labeling for 8 samples was used:''' PPMT.1.1, PPMT.1.2, PPMT.1.3, PPMT.1.4 (Primer je 2,5μl, DMSO Konz. 0,1,5,8 %) PPMT 2.1, PPMT.2.2, PPMT.2.3., PPMT.2.4 (Primer je 1,25μl, DMSO Konz. 0,1,5,8 %) ===Gel Electrophoresis=== 1µl loading buffer+5 µl sample loaded on 1% agarose gel; 90V
(rest of sample in iGEM freezer) ====Results==== contamination from water (band 3000bp for every sample)
with higher DMSO conc. (5% and 8%) bands from visible

06/17 Tuesday - PCR Amplification of ATPCS from cDNA

===PCR-pipetting scheme=== {| class="wikitable" |- ! Volume [µl] !! Chemicals |- | 12,5 || 2x Q5 Mastermix |- | 1,25 || 10µM fwd Primer |- | 1,25 || 10µM rev Primer |- | 2,2 || Arabinopsis Thaliana cDNA |- | 8,9 || nucl.free H₂O |- | 26,1µl total volume |- |} ===PCR-program=== {| class="wikitable" |- ! PCR-step !! Temperature [°C] !! Time [sec] |- | Denaturation || 98 || 30 |- |"30 cycles start" |- | Denaturation || 98 || 10 |- | Annealing || 62 || 30 |- | Elongation || 72 || 60 |- |"30 cycles stop" |- | Final Elongation || 72 || 120 |- | Store || 8 || |} ==PCR Purification of ATPCS== - Kit Purification
- Elutionbuffer: 30µl

- Final concentration: 69 µg/ml

06/18 Wednesday - PCR of drag outs to separate cells for FieF Knockout

Pick up 7 single colonies + 20µl d. H₂O each (on ice)
--> Labeling: K1, K2, K3, K4, K5, K6, K7
PCR for each colony with Primer combinations: C1-C3, C2-C4, C1-C5 --> 7x3= 21 Samples
===PCR Assay=== {| class="wikitable" |- ! Amount [µl] !! Chemical |- | 1 || Sample (Colony) |- | 13,5 || d. H₂O |- | 2 || 10x Dream Taq Polymerasebuffer |- | 1,2 || 25mM MgCl₂ |- | 0,5 || 10µM fwd Primer |- | 0,5 || 10µM rev Primer |- | 0,5 || 10mM dNTPs |- | 0,6 || Taq DNA Polymerasse |} ===PCR Program=== Colony-PCR: Elongation Time : 1,2 Min, Annealing Temp.: 55°C
===Gel Electrophoresis===

====Result==== RV-strain is not appropriate for Fief-Knockout. Unknown genome leads to unspecific binding of designed primers, too many bonds in gel electrophoresis picture.

06/19 Thursday

Continue working with colonies: K1, K5, K6, K7 from 18.06.2014
PCR-programme: {| class="wikitable" |- ! Amount [µl] !! Chemical |- | 1 || Sample (Colony) |- | 13,5 || d. H₂O |- | 2 || 10x Dream Taq Polymerasebuffer |- | 1,2 || 25mM MgCl₂ |- | 0,5 || 10µM fwd Primer C1 |- | 0,5 || 10µM rev Primer C4 |- | 0,5 || 10mM dNTPs |- | 0,6 || Taq DNA Polymerasse |} PCR-programme:
Elongation time: 2Min, Annealing Temperature: 56°C
== Magnetization of E. coli by expression of human Ferritin, 1st Experiment part 1 of 4 == '''Aim''': Test the possibility of Magnetization of E.coli cells by the expression of human Ferritin: '''Procedure''': To evaluate the effect of Ferritin on the Magnetization different cultures were compared:
For Both RV308 and Nissle {| class="wikitable" |- !Culture !! 1 !! 2 !! 3 !! 4 |- |Plasimd || +|| -|| +|| + |- |iron || +|| +|| -|| + |- |induction || +|| +|| +|| - |} - Transform the Human Ferritin gen carried on the Plasmid PC514 provided from (iGEM Team of Calgary university, Canada) to E. coli strains (Nissle and RV308) via electroporation, plate on (Amp) plates for selection.

06/20 Friday Restriction digest of pQE_80L and ATPCS-PCR fragment

{| {{table}} | align="center" style="background:#f0f0f0;"|''''' | align="center" style="background:#f0f0f0;"|'''1x''' | align="center" style="background:#f0f0f0;"|'''5x Mastermix''' | align="center" style="background:#f0f0f0;"|'''pQE_80L''' |- | H2O nucfree||23,1µl||115,5µl||2µl |- | 10x green FD buffer||2µl||10µl||2µl |- | DNA||2,89µl||14,5µl||14µl |- | BamHI||1µl||0µl||1µl |- | SacI||1µl||0µl||1µl |- | |} 5x Mastermix = Mastermix for ATPCS
Enzymes were added to each single aliqout and not into the Mastermix
'''Incubation:''' for 1,5 h at 37 °C
'''Deactivation:''' 80°C for 5 min
''I used the wrong restriction enzymes as I got confused with the PCR fragment. Digestion with SacI and HindIII is needed not BamHI. ''Repeat PCR for ATPCS as well as restriction digest! ==Test expression of Ferritin in RV308 (pSB1C3_Ferrtin) and Nissle (pSB1C3_Ferrtin)== 5ml overnight culture used as an inoculum.
4 ml culture were diluted to 40 ml with LB and grown for 1 h at 37°C until an OD600 of 0.7 and 0.8 was reached.
Non-induced SDS sample was taken and induced with 1 mM IPTG
After expression for 3 h induced SDS sample was taken. ===SDS PAGE=== Ferritin band ecpected at 21kDa
'''Key:'''
- 1st band: Nissle (non induced)
- 2nd band: RV308 (non induced)
- 3rd band: Ladder
- 4th band: Nissle (induced)
- 5th band: RV308 (induced)

06/25 Wednesday - Amplification of ATPCS (cDNA)

===PCR-pipetting scheme=== {| class="wikitable" |- ! Volume [µl] !! Chemicals |- | 12,5 || 2x Q5 Mastermix |- | 1,25 || 10µM fwd Primer |- | 1,25 || 10µM rev Primer |- | 1,5 || Arabinopsis Thaliana cDNA |- | 8,9 || nucl.free H₂O |- | 25,4µl total volume |- |} ===PCR-program=== {| class="wikitable" |- ! PCR-step !! Temperature [°C] !! Time [sec] |- | Denaturation || 98 || 30 |- |"30 cycles start" |- | Denaturation || 98 || 10 |- | Annealing || 62 || 30 |- | Elongation || 72 || 60 |- |"30 cycles stop" |- | Final Elongation || 72 || 120 |- | Store || 8 || |} ===PCR Purification=== -Purification Kit
→DNA concentration measurement showed, that the Absorbance ratio of 260nm:280nm is quite low, which means that targeted DNA got contaminated. =='''Preparation of pre-culture'''== '''Strains:'''
- e.coli nissle
- e.coli nissle + ferritin
- RV308
- RV308 + ferritin
===Assay=== - 5ml LB media + 1 picked clone of the pre-day
- Addition of 5µl CN37 to the strains with ferritin
'''Incubation:''' 37°C; 170rpm; o/n

06/27 Friday

== Magnetization of E. coli by expression of human Ferritin, 1st Experiment part 2 of 4 == - Preculture of 1 positive clone over night ( preculture: 7 ml LB+ 7µL Amp + 1 Clone)

06/28 Saturday

== Magnetization of E. coli by expression of human Ferritin, 1st Experiment part 3 of 4 == - Transfer the Precultures (OD= 0.4-0.5) to 25, 50 mL flasks (half filled with LB) and cultivate them at 37°C for 3 hours RV308 (+,+,+) & (-,+,+) And Nissle (+,+,+) were cultivated in 50 mL flasks
Strain: OD
RV308 0,78
Nissle 0,86
- Induction with (20µl (50 ML flasks)/10µl (25 ML flasks)) IPTG (concentation 1 M).
- Add FeCl2 and MnCl2 (100µL in 50ml flasks/ 50µl in 25ml flasks) Incubation over night at 37C°
Strain: OD
RV308 2.56
Nissle 2.8

06/29 Sunday

== Magnetization of E. coli by expression of human Ferritin, 1st Experiment part 4 of 4 == -Sampling for testing the Ferritin content via SDS-Page, different ODs were taken in consideration!
-Prepare the sample for SDS-gel by centrifuation and discard the supernatant then add (60µl Dis.water + 15 SDS+ MH-EtoH), boil for 10 min at 94°C.
- Test the Magnetization using an permanent magnet under light microscope.
'''Evaluation''': '''SDS Page''': was not clear! '''Magnetization : ''' '''RV308''' {| class="wikitable" |- !Culture !! 1 !! 2 !! 3 !! 4 |- |Plasimd || +|| -|| +|| + |- |iron || +|| +|| -|| + |- |induction || +|| +|| +|| - |-Magnetization|| yes|| No|| No|| yes (strong)} {| class="wikitable" |- !Culture !! 1 !! 2 !! 3 !! 4 |- |Plasimd || +|| -|| +|| + |- |iron || +|| +|| -|| + |- |induction || +|| +|| +|| - |-Magnetization|| yes|| No|| No|| yes (strong)}. '''Nissle''' In samples with Iron aggregates were observed with strong Mag.effect.

06/30 Monday - Colony PCR and Ligation ATPCS

===PCR pipetting scheme=== {| class="wikitable" |- ! Volume [µl] !! Chemicals |- | 13,7 || nucl.free H₂O |- | 2 || 10x Dream Taq Buffer |- | 1,2 || 25mM MgCl₂ |- | 0,5 || 10mM dNTPs |- | 0,5 || 10µM fwd Primer |- | 0,5 || 10µM rev Primer |- | 1 || Sample (Colony) |- | 0,6 || Dream Taq DNA Polymerase |- |20µl Total Volume |- |} ===PCR program=== {| class="wikitable" |- ! PCR-step !! Temperature [°C] !! Time [sec] |- | Denaturating || 95 || 180 |- |''30 cycles start'' |- | Denaturating || 95 || 30 |- |Annealing || 55 || 30 |- |Elongation|| 72 || 120 |- |'' 30cycles stop'' |- |Final Elongation || 72 || 600 |- | Store || 12 || |} ===Gel Electrophoresis=== 1% Agarose gel with EtBr; 8µl sample; 5µl Ladder
"Key:"
First band= Ladder
Each other band is a different picked clone (10 clones were picked)

07/01 Tuesday - ATPCS Ligation

The ligation of ATPCS was checked with 1% Agarose gel (stained with ethidiumbromid) after colony pcr.

07/02 Wednesday - Knockout of Fief and Fur in RV308 and Nissle

To pepare the knockout 5 µl CM solution (pFerritin with canamycin resistance cassette)and 500 µl culture solution were added to 5 ml LB media. For each stain two samples were determined (RV1/2 and N1/2). The samples were incubated at 37°C up to an OD₆₀₀ of 0.53-0.55. After incubation 1 ml of each culture was transfered in sterile eppi and washed for 7 min at 7000 rpm and 4°C. The supernatant was descarded, the pellet was resuspended in 1 ml sterile H₂O and washed for 7 min at 7000 rpm and 4°C and descarded the supernatant. The pellet of N1 was resuspended in 25 µl pRFP (c = 41 ng/µl) and 25 µl sterile H₂O. The pellets of N2 and RV1/2 were resuspended in 2 µl pRFP and 50 µl sterile H₂O. 50 µl of each suspension were transfered in electroporation cuvette and electroporated for a few sec (table below). Directly after this, 1 ml fresh LB media (37°C) was added, the suspension was transfered in a sterile eppi and incubated at 37°C at 600 rpm. The cultures were recovered, deleted on CM+Amp plates and incubated at 37°C ove night. {| class="wikitable" |- ! Überschrift !! [kV] !! [ms] |- | N1 || 1,8 || 2,3 |- | N2 || 1,2 || 5,4 |- | RV1 || 1,2 || 5,3 |- | RV2 || 1,5 || 5,3 |} Transformation of stains RV, Nissle, WM
The stains RV308[ferritin], Nissle[ferritin], RV308, Nissle and WM110 were transformed with RFP. RV308[ferritin] and Nissle[ferritin] were deleted on CM+Amp plates and 5 ml culture was added with CM/Amp and incubated at 37°C. The transformed strains RV308, Nissle and WM110 were deleted on Amp plates and 5 ml culture was added with Amp and incubated at 37°C.
Results of transformation
{| class="wikitable" |- ! stain !! colonies on plate !! cells in culture |- | Nissle1 + RFP || 3 || Yes |- | Nissle2 + RFP || 19 || Yes |- | WM110 1 + RFP || 0 || Yes |- | WM110 2 + RFP || n.d. || Yes |- | RV308 1 + RFP || 0 || Yes |- | RV308 2 + RFP || 87 || Yes |- | Nissle[ferritin]1 + RFP || 10⁸ || No |- | Nissle[ferritin]2 + RFP || 0 || No |- | RV308[ferritin] 1 + RFP || 330 || Yes |- | RV308[ferritin] 2 + RFP || 300 || Yes |} The cultures of WM110 1 + RFP and WM110 2 + RFP were deleted on Amp plates and incubated at 37°C. Moreover 5 ml precultures from RV308 + RFP + Amp and RV308[ferritin] + RFP + CM+Amp were prepared.

07/03 Thursday - PCR amplification of knockout cassette FUR/FieF

The pcr preparation was performed at the pattern in the table below.
{| class="wikitable" |- ! pcr preparation !! FUR (25µl) !! FieF (50µl) |- | Os High Fedility 2x Mastermix || 12,5 µl || 25 µl |- | forward primer 10mM || 1,25 µl || 2 µl |- | reverse primer 10mM || 1,25 µl || 2,5 µl |- | pkD4 plasmid DNA 1 ng/µl || 1 µl || 1 µl |- | nuclease-free H₂O || to 25 µl || to 50 µl |} The amplification was performed with the programm in the table below.
{| class="wikitable" |- ! step !! T [°C] !! t [sec] |- | initial denaturation || 98 || 30 |- | 5 cycles || 98/ 63/ 72 || 8/ 25/ 45 |- | 25 cycles || 98/ 72 || 8/ 70 |- | final elongation || 72 || 120 |} --> hold at 8°C The amplification results were analysed in agarose gelelectrophorese (1% agarose; 0,5µl Gel Red; 10x diluted ladder; 6x loading dye).

07/04 Friday - Expression von RV308 (RFP) und RV308 (RFP + Ferritin)

50 ml LB + 50 µl Amp inoculated with 5 ml overnight culture of RV308 (RFP)
50 ml LB + 50 µl Amp/Cm inoculated with 5 ml overnight culture of RV308 (RFP + Ferritin)
After a OD of 0.6-0.7 was reached 50 ml cultures were portioned into 4 sterile 100 ml flasks so that there was a final volume of 10 ml in each flask.
The cultures were then cultred the following:
{| {{table}} | align="center" style="background:#f0f0f0;"|''' ''' | align="center" style="background:#f0f0f0;"|'''RV308 (RFP)''' | align="center" style="background:#f0f0f0;"|''' ''' | align="center" style="background:#f0f0f0;"|''' ''' | align="center" style="background:#f0f0f0;"|''' ''' | align="center" style="background:#f0f0f0;"|''' ''' | align="center" style="background:#f0f0f0;"|'''RV308 (RFP + Ferritin)''' | align="center" style="background:#f0f0f0;"|''' ''' | align="center" style="background:#f0f0f0;"|''' ''' | align="center" style="background:#f0f0f0;"|''' ''' |- | Induced 1 mM IPTG||+||-||+||-||||+||-||+||- |- | Fe/Mn each 1 mM*||+||+||-||-||||+||+||-||- |- | |} *Fe/Mn were solubilized by autoclaving and 1M stock solution
Altough not planned IPTG and metal ion solutions were added simultaneously due to time constraints. It was planned to add metal ions 2h after induction

07/07 Monday - Preculture prepared of:

1. ATPCS Klon 1 - 10 (Amp) --> check if anything grew and contact Johann
2. WM110 (RFP), RV308 (RFP), Nissle (RFP), RV308 (Ferritin + RFP) --> make Cryostock for each
Overgrown WM110 (RFP) plate streaked out again, please take out and put in cool room
Rune:
PCR of PPMT and ATPCS

07/09 Wednesday - PCR for PPMT with goTaq (Promega)

25 mikrol reaction:
12,5 mikrol goTaqMastermix
1,25 mikrol fw Primer 10mikrom
1,25 mikrol b Primer 10mikrom
1,0 mikrol DNA Template PPMT
9,0 mikrol nucleasefreies Wasser
'''Mit folgenden PCR-Programm Parametern:''' Denaturation 98°C 10 min
Denaturation loop 98°C 1 min
Annealing Temp loop 56°C 1 min
Elongation Time loop 72°C 1 min
Final Elongation 72°C 5 min
Storage 8°C infinite
== Miniprep == Miniprep of ATPCS clone number 3 = 94ng/µl and sent for Sequencing

07/17 Thursday - Midiprep

#pQE_80L = 183 ng/µl
#pMA-T_PPMT =321ng/µl
#pKD46 = 218ng/µl
== '''Digestion''' == Digestion pQE_80L with HindIII and SacI
deactivated at 80°C for 10 mins

07/24 Thursday - miniPrep + restriktion PPMT und iGEM plasmids

Plasmide: 1. pBADex-mYFP Venus (Amp)
2. pEx-HISII (Amp)
3. pJS418_phagemid(dummy) (Cm)
Restriction-enzymes: XbaI | PstI (used SpeI instead :X)
kit-miniprep
1. 220ng/µl 2. 130ng/µl 3. 430ng/µl
restriction:
500 ng DNA + 1µl XbaI + 1µl PstI + 5µl 10x Buffer + ->50µl Wasser (x3) [ppmt x4]
1. 2,3µl 2. 3,8µl 3. 1,2 µl PPMT 1,6µl
2nd try w/ right enzyme:
1,5 µg DNA + 0.5 µl enzymes + 3µl BUffer + -> 30 µl Wasser
1. 6,5µl 2. 11 µl 3. 3,5 µl PPMT 4,5 µl (x3)
Fragments: 1. 4043/700 2. 4450/55 3. 3800/861 PPMT 2400/251
Gel1 L|3| 1 |1|2|2|2|P|3|3 Gel2 L|P|P|P
Neu: Gel 1|2|3|L|P|P|P
GelEx QiagenKit -> extrakte in grüner box im freezer
Ligation 2 + P
10µl Ansatz: 1µl BUffer + 0.5 µl Ligase + 1.4 µl PPMT + 7.14 µl pEX-HisII [78ng]

07/25 Friday

1. Ordered Primer for cloning hu_Ferritin into pQE80L
2.) Ligation of PPMT Fragment from pMAC_PPMT into pEX_HisII
pMAC_PPMT and pEX_HisII were digested with HF PstI and HF XbaI (NEB)
PPMT (Insert) and cut pEX_HisII (Vector DNA) were purified via an Gel extraction
Ligation was performed using NEB T4 DNA Ligase in molar ratios of (Insert:Vector) and 40 ng Vector were used.
0:1 2:1 3:1 5:1
{| {{table}} | align="center" style="background:#f0f0f0;"|'''Ratio''' | align="center" style="background:#f0f0f0;"|'''02:01''' | align="center" style="background:#f0f0f0;"|'''03:01''' | align="center" style="background:#f0f0f0;"|'''05:01''' |- | Amount Insert||4,04 ng||6,06 ng||10,1 ng |- | |} Ligase was deactivated and ligation transformed after weekend

07/28 Monday

1. Degradation test of prepped TB-Expression Plasmids by running samples on agarose gel
pBADex_MYFP_Venus (no observable degradation)
pEX_HisII (no observable degradation)
pJS418_Phagemid (Dummy) (no observable degradation)
Data:
Fabian : 28072014_1
2.Transformation of 0.2 µl pEX_His_PPMT ligation into DH5alpha, DH10b, and MG1655 via electroporation

07/29 Tuesday

1.) Transformation worked and we got colonies for pEX_HisII_PPMT
Colony PCR was performed (Sascha)
See Standard Protocol
2.) Ligation of ATPCS PCR Fragment into pQE_80L
ATPCS PCR fragment and PQE80L Vector were digested with FD HindIII and FD SacI (ThermoScientific)
ATPCS was purified via PCR purification and Vector DNA was purified via an Gel extraction
Vector DNA was dephosphorylised using Fast-AP and deactivated
Ligation was performed using NEB T4 DNA Ligase in molar ratios of (Insert:Vector) and 40 ng Vector were used.
0:1 2:1 3:1 5:1 {| {{table}} | align="center" style="background:#f0f0f0;"|'''Ratio''' | align="center" style="background:#f0f0f0;"|'''02:01''' | align="center" style="background:#f0f0f0;"|'''03:01''' | align="center" style="background:#f0f0f0;"|'''05:01''' |- | Amount Insert||24,96 ng||37,41 ng||62,36 ng |- | |} Ligase was deactivated and ligation transformed next day


#pMAC_PPMT* #pQE_80L* #pSB1c3 #pKD46* (*)Bands at 20 kbp for Promega prepped Plasmids.

07/30 Wednesday

== Results Colony PCR for pEX-HisII-PPMT clones == preculture 4 and 5 in incubator for Miniprep and Sequencing
== Transformation == ===Chemical competent cells XL Blue === * 3 µl for each Ligation Assay * 10 min incubation on ice *60 s Heat schock * 2 min incubation on ice *950µl LB added *1h --> 37 °C for Recovery *platted on Amp-plates === Eporation === *0.2 µl Ligationassay in competent DH5α [iGEM] *1.7 kV * 1h; 37°C * platted on Amp plates

07/31 Thursday

Miniprep for sequencing of pEx_His_ppmt in DH10B? 90-100 ng/µl
Cryostock & miniprep of pjs418 in DH5a 518ng/µl
PCR of 7 clones with pQe80l_ATPCS
16 µl wasser
2 green dreamtaq buffer
0.5 dNTP
0.5 primer (each)
colony
0.6 dream taq
95° 3min
95° 30s x30
55° 30s x30
72° 2min x30
72° 10min
Colonie PCR did not work--> no positive clones concentration after MiniPrep
* pJS418 = 518 ng/µl * Klone 4 = 90 ng/µl * Klone 5= 105 ng/µl

08/06 Wednesday

PCR {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''BamHI_PPMT_GS''' | align="center" style="background:#f0f0f0;"|'''GS_ATPCS_HindIII''' | align="center" style="background:#f0f0f0;"|'''BamHI_HuFerritin_HindIII''' |- | Q5 2x Mastermix||12,5||12,5||25 |- | 10 µM Primer fw||1,25||1,25||1,25 |- | 10 µM Primer rev||1,25||1,25||1,25 |- | template (1ng)|| 0,30|| 0,5|| 1 |- | nucfree H2O|| 9,7|| 9,5|| 19 |- | |} Program: {| {{table}} | align="center" style="background:#f0f0f0;"|'''BamHI_PPMT_GS''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''GS_ATPCS_HindIII''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''BamHI_HuFerritin_HindIII''' | align="center" style="background:#f0f0f0;"|'''''' |- | 98||30''|| ||98||30''|| ||98||30'' |- | |||||||||||||| |- | 98||10''||||98||10''||||98||10'' |- | 58||30''||||56,3||30''||||58,6||30'' |- | 72||12''||||72||60''||||72||45'' |- | |||||||||||||| |- | 72||2'||||72||2'||||72||2' |- | 8||end||||8||end||||8||end |- | |} Analytical Gel Expacted Bands clearly seen for PPMT and Ferritin. Only little ATPCS band shows Primer Dimer inhibit PCR. Anyhow we will try a Gel extraction and after a Assembly PCR == Generation of Heme-free BFR by Site-directed Mutagenesis, part 1 of 5 == ==== Site-directed mutagenesis was performed by the QuickChange method ==== Primer design with http://www.bioinformatics.org/primerx/ methionine (on position 52) was substituted by histidine BFR M52H

08/07 Thursday

Analysing 2 colonies of pQE80L_ATPCS whether ATPCS was inserted by sequencing revealed no proper results.
Tested by colony PCR (see protocols) using 55°C Annealing temp and 2' Elongation time (expected bands should be 2000bps).
Gel showed PCR was about 500 bp big -> ATPCS NOT INSERTED.
Outcome:BamHI_PPMT_GS super
GS_ATPCS_HindIII bad
BamHI_Ferritin super

08/08 Friday - Gradienten PCR GS_ATPCS_HindIII

'''PCR''' {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''3x GS_ATPCS_HindIII''' |- | Q5 2x Mastermix||12,5 |- | 10 µM Primer fw||1,25 |- | 10 µM Primer rev||1,25 |- | template (1ng)|| 0,5 |- | nucfree H2O|| 9,5 |- | |} '''Program:''' {| {{table}} | align="center" style="background:#f0f0f0;"|'''GS_ATPCS_HindIII''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | 98°C||30''|| |- | |||| |- | 98°C||10''|| |- | 56,3-62°C||30''||34 |- | 72°C||60''|| |- | |||| |- | 72°C||2'|| |- | 8°C||end|| |- | |} - preparative agarose gel 1% and gel ex of GS_ATPCS_HindIII bands at ca. 1490 bp
- accidentally also loaded BamHI_PPMT_GS onto Gel and was also extracted (elution with 25 µl elution buffer).
- BamHI_Ferritin_HindIII was PCR purified
- DNA concentration meassurement for purificated pcr fragments:
GS_ATPCS_HindIII = 33 ng/µl
BamHI_PPMT_GS = 48 ng/µl
BamHI_Ferritin_HindII = 125 ng/µl
'''Assembly PCR''' An Assembly PCR was used to align BamHI_PPMT_GS with GS_ATPCS_HindIII and amplify the complementary structure in order to form a fusion protein coding sequence.
Therefore, both fragments were added a templated equal molar amounts.
Calcultation:
bpATPCS = 1493
bpPPMT = 255
mATPCS/bpATPCS = mPPMT/bpPPMT
mATPCS = (1ng * 1493) / 255
mATPCS= 58 ng
{| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''BamHI_PPMT_GS_ATPCS_HindIII''' |- | Q5 2x Mastermix||25 |- | 100 µM Primer fw||0.25 (not added till later to second PCR run) |- | 100 µM Primer rev||0.25 (not added till later to second PCR run) |- | template (1ng)|| 1,750 µl ATPCS + 0.208 µl PPMT |- | nucfree H2O|| 18.042 |- | |} '''Program:''' {| {{table}} | align="center" style="background:#f0f0f0;"|'''1. PCR BamHI_PPMT_GS_ATPCS_HindIII''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | 98||30''|| |- | |||| |- | 98||10''|| |- | 68||30''|| 5 |- | 72||55''|| |- | |||| |- | 72||1'|| |- | 8||end|| |- | |} {| {{table}} | align="center" style="background:#f0f0f0;"|'''2. PCR BamHI_PPMT_GS_ATPCS_HindIII''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | 98||30''|| |- | |||| |- | 98||10''|| |- | 68||30''|| 30 |- | 72||55''|| |- | |||| |- | 72||2'|| |- | 8||end|| |- | |} === Transformation into DH10B === #BFR M52H # BFR M52H *Recover in LB--> 1h at 37°C

08/11 Monday - Plan-prepare fragments for digest

Constructs aimed for *In pQE_80L (Amp) BamHI_PPMT_GS_ATPCS_Hind III (PCR Construct available) Construct Size 1724 of 4731 *In pQE_80L (Amp) BamHI_FTH_FTL_Hind III (PCR Construct available) Construct Size 1077 of 4731 *In pQE_80L (Amp) Sacl_ATPCS_Hind III (PCR Construct not available) Construct Size 1400 of 4731 *In pJS418 (CM) XbaI_PPMT_PstI (PCR Construct available) Construct Size 255 of 3800 {| class="wikitable" |- ! Q5 MasterMix !! 25μl |- | ATPCS SacI || 2.5 |- | ATPCS Hind III|| 2.5 |- | cDNA At. || 0.5 |- | H₂O || 19.5 |- |} {| class="wikitable" |- ! PCR Programm !! |- | 98°C|| 30 sec |- | 98°C || 10 sec |- | 62°C 34cycles || 30 sec |- | 72°C || 60 sec |- | 72°C|| 2 mins |- | 4°C|| Store |} PCR Fragmente PPMT_GS_ATPCS+ATPCS+Purification (Gelex)
After Gelex:
PPMT 48ng/μl
Ferritin 125ng/μl (Pur from PCR)
ATPCS 33ng/μl

08/12 Tuesday - Preparing chemically competent cells

V=100ml, 37°C
BU36=DH10B OD at 600nm=0.461A
DH10B competent cells
'''''Digestion''''' {| class="wikitable" |- ! Inserts PCR Pur !! JBH1 PPMT_GS_ATPCS 1 !! JBH2 PPMT_GS_ATPCS 2 !! JBH3 Ferritin !! JSH ATPCS |- | PCR Fragment || 20|| 20 || 8|| 20 |- | Buffer || 3 || 3|| 3 || 3 |- | FD BamHI /FD SacI|| 1|| 1|| 1 || 1 |- | FD Hind III || 1 || 1 || 1 || 1 |- | nuclease free H₂O || 5 || 5 || 17|| 5 |} {| class="wikitable" |- ! Vector !! VBH pQE_80L !! VSH pQE_80L SacI !! 2x PJS_418 !! 2x P_Mac_PPMT |- | Vector || 5.5 || 5.5|| 1.9|| 3.2 |- | Enzyme 1|| 1 BamHI || 1 SacI || 1 FDxBa|| 1 FDxBa |- | Enzyme 2 || 1 HindIII || 1 HindIII || 1 FD PST || 1 FD PST1 |- | Buffer || 3|| 3 || 2|| 2 |- | Fast AP || 1|| 1 || 0 || 0 |- | nuclease free H₂O|| 18.5|| 18.5 || || |} * 35 ng/L PPMT ATPCS 1 * 15ng/L PPMT ATPCS 2 * 25ng/L ATPCS * 13ng/L P_Mac_PPMT * 31ng/L PJS_418

{| class="wikitable" |- ! Ligation 5:1 !! JBH1 in VBH !! JBH2 in VBH !! JBH3 in VBH!! JSH in VSH !! PPMT in PJS_418 |- | 10x T4 DNA ligase Buffer|| 1μl|| 1μl || 1μl || 1μl || 1μl |- | Vector || 1.42 || 1.42 || 1.42|| 1.33|| 1.29 |- | Insert || 3.29 || 7.08 || 1.36 || 7.17 || 1.03 |- | Nuclease free H₂O || 3.79 || 0 || 5.72 || 0 || 6.18 |- | T4 DNA ligase (NEB)|| 0.5 || 0.5 || 0.5 || 0.5 || 0.5 |} Ampicillin
JBH1 in VBH
JBH2 in VBH
JSH in VSH
Chloramphenicol
PPMT in PJS_418 Transformation in DH10b (cc.c)
10⁶ Kolonie for every approach

08/13 Wednesday - pQE 80L Colony PCR

{| class="wikitable" |- ! Mastermix !! 1x!! 35x !! 10x |- | nuclease free H₂O|| 14 || 490 || 140 |- | 10 dreamtaq|| 1 || 70|| 20 |- | 25µM MgCl₂ || 1.2 || 42|| 12 |- | 10mM dNTPs || 0.5|| 17.5 || 5 |- | 10mM Forward Primar || 0.5|| 17.5|| 5 |- | 10mM Reverse Primar || 0.5 || 17.5 || 5 |- | Taq|| 0.3 || 10.5 || 3 | |} {| class="wikitable" |- ! PCR Programm !! |- | 95°C|| 3 mins |- | 95°C || 30 secs |- |55°C|| 30 secs |- | 72°C|| 60 secs |- | 72°C || 10 min |- | 8°C|| Store |} Samples :
# PPMT GS ATPCS size 1912 # PPMT GS ATPCS size 1912 # ATPCS in pQE80L size 1770 # Ferritin in pQE80L size 1376 # PPMT in PJS size 420 pQE80L=300bp
pJS = 170bp
Sequence clones A - H + J
== Generation of Heme-free BFR by Site-directed Mutagenesis, part 2 of 5 == QuickChange Site-Directed Mutagenesis
20µL approach: {| class="wikitable" |- ! Überschrift !! component |- | 2 µL || 10x Pfu Buffer (MgSO4) |- | 0,6 µL || 10µM forward Primer |- | 0,6 µL || 10µM reverse Primer |- | x µL || 30ng Template |- | 0,4 µL || dNTPs |- | 0,6 µL || Pfu Polymerase |- | to 20 µL || PCR Wasser |} Template BFR:
0,5 µL A4 (66ng/µL)
0,2 µL D2 (144ng/µL)
{| class="wikitable" |- ! labeling !! Template !! Annealing Temp. |- | 17 || D2 (144ng/µL) || 71°C |- | 15 || D2 (144ng/µL) || 55°C |- | 67 || A4 (66ng/µL) || 71°C |- | 65 || A4 (66ng/µL) || 55°C |} PCR Program
{| |- ! Temp !! time |- | 95°C || 30sec |- | ________ || ______ |- | 16 Cyclen || |- | 95°C || 30sec |- | 55/71°C || 1min |- | 68°C || 5min |- | ________ || ______ |- | 68°C || 10sec |- | 4°C || finale |} Σ20µL -8µL fürs Gel= 12µL +1µL DpnI 37°C 90min
'''chemical Transformation (Fabian) ''' in DH10b
plating out on Amp plates

08/15 Friday - Clone Sequencing

{| class="wikitable" |- ! Clone !! Name !! Construct present !! concentration after isolation |- | A|| pQE_80L_PPMT GS ATPCS || yes || 388ng/µL |- | B|| pQE_80L_PPMTGSATPCS || yes || 373ng/µL |- | C || pQE_80L_PPMTGSATPCS || yes|| 442ng/µL |- | D || pQE_80L_PPMTGSATPCS || no|| 389 ng/µL |- | E || pQE_80L_huFerritin || yes|| 490ng/µL |- | F|| pQE_80L_huFerritin || no|| 402ng/µL |- | G || pQE_80L_ATPCS|| yes || 497ng/µL |- | H || pQE_80L_ATPCS || yes || 443 ng/µL |- | I || pJS418_PPMT|| yes || 596 ng/µL |}

08/19 Tuesday

== Generation of Heme-free BFR by Site-directed Mutagenesis, part 3 of 5 == ÜN culture
5ml LB + 5µL Amp →shakingincubator

08/20 Wednesday

== Generation of Heme-free BFR by Site-directed Mutagenesis, part 4 of 5 == MiniPrep nach Protocol
Photometer
4µL Probe + 76µL dilution (Wasser)

08/21 Thursday

== Generation of Heme-free BFR by Site-directed Mutagenesis, part 5 of 5 == Sequencing:
Primer PB 16
Crystocks:
ÜN culture
500µL culture + 500µL DMSO
2xclon 17
2xclon 67

08/22 Friday - SDS-PAGE with Coomasie staining

Samples
# Marker # Pellet ATPCS/PPMT #15:00 after induction ATPCS/PPMT #overnight ATPCS/PPMT #GS Pellet #PGSA after induction 15:00 #GS P/A overnight #human Ferritin Pellet #human Ferritin after induction 15:00 #human Ferritin overnight '''''Analysis of Expression'''''
Human Ferritin = 42 kDa (Potparam Expasy)
ATPCS = 56.3 kDA (Potparam Expasy)
PPMT = 7.9 kDA (Potparam Expasy)
ATPCSGSPPMT = 64.3 kDa (Potparam Expasy)

08/29 Friday - Calibration curve for Iron concentration measurement

{| class="wikitable" |- ! Überschrift !! Überschrift |- | 0.017A || 10 µg/ml |- | 0.105A || 50 µg/ml |- | 1.076A || 100 µg/ml |- | 2.095A || 150 µg/ml |- | 2.747A || 200 µg/ml |}

09/03 Wednesday

== Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 1 of 8 == '''Aim''': Test the possibility of Magnetization of E.coli cells by the expression of human Ferritin: '''Procedure''': ... -Precultures of Nissle and RV308 (wild types)

09/04 Thursday

== Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 2 of 8 == -Prepare chemical competent cells ( Nissle and RV308) . see Protocol

09/05 Friday

== Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 3 of 8 == -Chemical biotransforamtion (double Trafo, 200ng of each) of, red fluorescence protein carried on plasmid (kan) Human-Ferritin carried on PQE-80L (Amp) [was prepared by iGEM-Berlin using the '''Biobrick''' from Calgary, unlike does not contains polypeptide at the beginning].

09/06 Saturday

== Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 4 of 8 == -Positive colones for both RV308 and Nissle

09/11 Thursday

== Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 5 of 8 == - Precultures of the transformed colones

09/12 Friday

== Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 6 of 8 == - Transfer the precultures into 250ml filled until 100ml with LB and incubate them at 37°C Strain OD
RV308 0.71
Nissle 0.6
- Induction with 100µl IPTG (1M), incubation over night at '''30°C''' and 200rpm

09/13 Saturday

== Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 7 of 8 == -samples were taken for protein analysis SDS-Page Strain OD
RV308 6.2
Nissle 5.2
- adding 7ml of 1M Mn-citrate (wrongly) and incubated at 4°C over weekend

09/15 Monday

== Magnetization of E. coli by expression of human Ferritin, 2nd Experiment part 8 of 8 == -Test the Magnetization using a permanent magnet under '''Fluorescent microscope.''' '''Evaluation''' -Cells grew -no red fluorescence observed -no Magnetization observed Possible Explanation: - Adding Mn ions instead of Fe could be effected the Magnetization - The red Fluorescence gen contains a cadaverin chain, this could explain the non-fluorescence.

09/16 Tuesday

== Preparing Cultures for flouruscence microscopy == E. coli Nissle 1917 (pQE_80L Hu_Ferritin + RFP)
E. coli RV308 (pQE_80L_HuFerritin + RFP)
Nissle OD600 = 5.08
RV 308 OD600 = 5.81
take OD=1
wash in 1000 µl PBS three times ( centrifuge at 6000g for 2min, discard supertanent and resuspend pellet in PBS) finally resuspend pellet in 500 µl Put it into a cool box and take it over to the fluorescence microscope facility. == Constructing PQE_80L_T5_ATPCS_lac_PPMT == Plasmid for Co-Expression of PPMT and ATPCS on one plasmid. Source: pJS418_PPMT (amplifying insert) pQE_80L_ATPCS (as target vector) === PCR of HindIII_lac_PPMT_HindIII === Construction of the HindIII_lac_PPMT_HindIII in pQE80L_Hind III {| class="wikitable" |- ! 3x HindIII_lac_PPMT_HindIII |- | Q5 2x Mastermix|| 12,5 |- | 10 µM Primer fw|| 1,25 |- | 10 µM Primer rev|| 1,25 |- | template (1ng)|| 0,5 |- | nucfree H2O|| 9,5 |- |} === Program === {| class="wikitable" |- ! Temperature!! Durattion in seconds!! Cycles |- | 98|| 30''|| 1 |- | 98|| 5''|| loop start |- | 62-65|| 15''|| loop 32 |- | 72|| 10''|| loop end |- | 72|| 2'|| 1 |- | 8|| infinite|| 1 |}

09/17 Wednesday - Digest and Dephosphorylation of vector pQE_80L_ATPCS

{| class="wikitable" |- ! pQE80L_ATPCS digest!! 1x!! 3x |- | pQE_80L_ATPCS|| 2 µl || 7 µl |- | FD HindIII|| 1 µl || 3 µl |- | 10x FD Buffer|| 2µl || 7 µl |- | FastAP (Thermo)|| 1 µl|| 3 µl |- | nucfree H2O|| 14 µl || 51 µl |} Gelextraction resulted in HindIII cut pQE80L_ATPCS 20 µl with 12 ng/µl
In parallel the PCR fragment HindIII_lac_PPMT_HindIII was purified and is ready for digest.

09/18 Thursday

== Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 1 of 7 == ''''''Aim''' ''' -Double Trafo of the Human-Ferritin and fluorescence marker.
'''Procedure:'''… Stains: RV308, Nissle and DH0B (control)
-chemical Double-biotransformation of:
-0.5 µl of Human-ferrtin on PQE-80L(490 ng/µl) with (Amp)
-3 µl green fluorescence protein Nerm ASGP-R-GFP (83 ng/µl) with (Kan)
for control:
- 3 µl green fluorescence protein Nerm ASGP-R-GFP (83 ng/µl) with (Kan) is transformed into DH05
- Double Trafo of ('''pJS418_PPMT and pQE_80L_ATPCS)'''

09/19 Friday

'''PCR of BB0 - BB3 parts (Saba)''' {| class="wikitable sortable" |- ! compound !! V/µl (50µl total) |- | Q5 2xMM || 25.0 |- | 10µM P_fv || 2.5 |- | 10µM P_rev || 2.5 |- | DNA (template 1ng)|| 2.0 (of diluted plasmid) |- | nuc.-free H2O || 28.0 |- |} '''Primers''' {| class="wikitable" |- ! Reaction !! fw Primer !! rev. Primer !! TmTm/°C !! Template !! bp |- | BB0 || BBa_K1438000_fw || BBa_K1438000_rev || 62 || pQE80L_BFR || 507 |- | BB1 || BBa_K1438000_fw || BBa_K1438000_rev || 62 || pQE80L_BFR M52H || 507 |- | BB2 || BBa_K1438002_fw || BBa_K1438002_rev || 68 || pQE80L_Hu-Fer || 1000 |} '''PCR Programms''' '''BB0 & BB1''' {| class="wikitable" |- ! T/°C !! t/min !! cycles |- | 98 || 0:30 || 30 |- | 98 || 0:10 || 30 |- | 62 || 0:30 || 30 |- | 72 || 0:15 || 30 |- | 72 || 2:00 || 30 |- | 8 || infinity || 30 |} '''BB2''' {| class="wikitable" |- ! T/°C !! t/min !! cycles |- | 98 || 0:30 || 30 |- | 98 || 0:10 || 30 |- | 68 || 0:30 || 30 |- | 72 || 0:40 || 30 (probably too long since ~1000bp and not 1408bp however worked well as seen on gel) |- | 72 || 2:00 || 30 |- | 8 || infinity || 30 |}

Biobricks derived from pQE80L constructs
BB1 BFR 191µg/ml
BB2 BFRM 173µg/ml
BB2 HuFerritin 166 µg/ml == Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 2of 7 == -No positive colones were detected for double-trafo expect these for control (transformation was successful in DH05).

09/20 Saturday - Digest of PSB1C3-Ferritin

===== Plasmid: PSB1C3 - ferritin with Peptid 120ng/µl ===== {| class="wikitable" |- ! component !! µL |- | NEB Xba1 || 2 µL |- | NEB Pst1 || 2 µL |- | NEB Buffer 3.1 || 20 µL |- | nucleasefree H₂O || 151 µL |- | PSB1C3 Feriitin || 25 µL |- | total volume || 200µL |} 37°C for 1,5h (inactivate for 20min at 80°C) ==== Gel electrophoresis ==== 1% Agarose-Gel
+ 3 µL EthBr
200µL Probe + 40 µL loading dye (6x)
5 µL GenRuler-Mix
no Gel-extraction, because nothing was seen on the gel, except the marker (GenRuler)
(add Figure)
Figure not in Dropbox
== Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 3 of 7 == -Transformation of RF '''(red fluorescence protein)''' on with (Kan) into DH05

09/21 Sunday

== Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 4 of 7 == -Transformation was successful

09/22 Monday - Precultures

Precultures of PSB1K3_RFP in DH10b (Kan)
pQE80L_ATPCS & pJS418_PPMT in Dh10b (Amp & Cm)
Clones with pQE80L_ATPCS'n'PPMT in DH10b (Amp)
PSB1C3_Ferritin in DH10b (Cm) == Checking Insertion of gene by colony PCR == Performing PCR for clones of ATPCS-PPMT construct
{| class="wikitable" |- ! !! 1x in µl !! 12x in µl !! 10x in µl |- | nuclease free H₂O|| 14|| 168 || 140 |- | 10x DreamTaq buffer|| 2 || 24 || 20 |- | 25mM MgCl₂|| 1.2|| 14.4|| 12 |- | 10mM dNTPs || 0.5|| 6 || 5 |- | 10mM FW Primar
HindIII-lac-prom-fw || 0.5 || 6 || 5 |- | 10mM RW Primar
PB17 (T7 term_rev) || 0.5 || 6 || 5 |- | Taq Polymerase || 0.3 || 3.6 || 3 |} {| class="wikitable" |- ! Programm colony PCR !! Temp !! Time |- | Denaturing|| 95°C|| 7 min |- | Denaturing|| 95°C|| 30 |- | Annealing || 69°C || 30 |- | Elongation || 72°C || 1 min |- | Final Elongation || 72°C || 10 min |- | Store|| 8°C || |} Dissolved colonies 4 and 6 which showed band at 400 bp were grown each in a cultivation tube with LB+Amp100 at 37°C

09/23 Tuesday - Mutagenesis of ATPCS

The elimination of the XbaI restriction site of all our ATPCS containing constructs was achieved by quick change mutagenesis.
... Details Saba.... After digest with DpnI the reaction was transformed into competent DH10b E. coli cells via heat shock transformation.
After streaking out all aliquots on LB-Amp Agar plates, they were incubated at 37 °C over night.
== Digest of miniprepped PSB1C3_Ferritin (Calgary) for extraction of vector for BioBrick preparation == {| class="wikitable" |- ! Components !! Volume in µl |- | NEB XbaI|| 2 |- | NEB PstI || 1,5 |- | NEB Buffer 3.1 || 5 |- | nucfree H2O || 26,5 |- | plasmid PSB1C3_ferritin (Calgary) || 15 |- | || 50 µl reaction |}
The reaction was incubated at 37 °C for 1,5 h.
The digested vector was purified using a 1% agarose gel and the Roth GelNebulizer purifiction kit. The vector band was expected at 2000 bp and the insert band at about 1000 bp.
'''both colonies from Saba were grown --> Mini-prep (Johann) to harvest plasmid DNA''' Mutagenesis of ATPCS in pQE80L_ATPCS-GS-PPMT
pQE80L_ATPCS_PPMT
pQE80L_ATPCS
3x PCR-Reactions
Q5 MM 12.0µl
PB_for SN_ATPCS_xbaI_Mut_for 1.25µl
PB_rev SN_ATPCS_xbaI_Mut_rev 1.25µl
nuc.-free H2O 10.5µl
template (1ng) ~ 1.0µl (dilations of original plasmids)
Total 26µl
'''PCR Programm''' {| class="wikitable" |- ! T/°C !! t/min |- | 98 || 0:30 |- | 98 || 0:10 |- | 69 || 0:30 |- | 72 || : |- | 72 || 2:00 |} Trafo of 5µl PCR-Product in DH10b cells --> incubation at 37 °C == Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 5 of 7 == - Preculture of DH05 with RF plasimd

09/24 Wednesday

== Berlin Vector - pQE-80L-JBFS-huFerritin Assembly PCR == ==== Running Gel Electrophoresis ==== * 1% Agarose, Ethidium bromide * 50µL Assembly PCR product + 10µL 6*DNA dye * 10µL GeneRuler DNA Ladder Mix (ThermoScientific) * Gel Electrophoresis conditions 100V, 30min

==== Gel Extraction ==== Gel Extraction using GeneJET Gel Extraction Kit (ThermoScientific) * Determination of Concentration by Ultraviolet Spectrophotometry ? ==== Double Digest ==== * Digestion of 1μg of purified Insert DNA using FastDigest BamHI / HindIII * 1h at 37°C ? * Heat inactivation of FastDigest BamHI / HindIII, 15min at 80°C ==== PCR purification ==== * PCR purification of BamHI / HindIII digested insert using GeneJET PCR Purification Kit (ThermoScientific) * Determination of Concentration by Ultraviolet Spectrophotometry ? ==== Ligation ==== * Using the Molar Ligation Ratio 1:5 (1 times vector and 5 times insert) {| class="wikitable" |- ! Position !! Substance !! Volume |- | Beispiel || Beispiel || Beispiel |- | Beispiel || Beispiel || Beispiel |- | Beispiel || Beispiel || Beispiel |} * 20min at RT ==== Chemical Transformation ==== * 100µL Aliquots of Chemically Competent Cells - DH10B ''E.coli'' + 10µL Ligation approach chilled on ice for 30 min * Heat shock for 1min at 42°C * Add 900µL preheated (37°C) LB * Incubate the cells for 1h at 37°C with shaking approx. 200rpm * Plate 200µL and spin down the rest and plate on LB Ampicillin, incubate overnight at 37°C ====Saba==== o/n culture of clones from successful pQE80L_ATPCS-mut_GS_PPMT and pQE80L_ATPCS-mut_PPMT transformation --> 37°C, 200pm, o/n 5-6 nl LB+AB (Amp) == Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 6 of 7 == - Miniprep of the Preculture, DNA concentration 71 ng/µl '''Chemical Biotransformation of: -'''3 µl of RFP 71 ng/µl''' -2 µl '''Ferritin jbfs_m (different ferrtin)(120 ng/µl) with (Amp)'''''' in RV308 and Nissle (2 plates each)

09/25 Thursday - PCR of Biobrick Parts

==Isolation of plasmid-DNA with Mini-Prep Kit of pQE80L_ATPCSMut_GS_PPMT and pQE80L_ATPCS_PPMT== '''PCR of Biobrick-Parts 03,04,06 & 10-15''' {| class="wikitable" |- ! BB !! PB_fw !! PB_rew !! Tm/°C !! template !! bp !! part |- | 03 || BBa-K1438003_fw || BBa-K1438003_rew || 67 || pQE80L_PPMT_GS_ATPCS || 1715 || PPMT GS ATPCS |- | 04 || BBa-K1438004_fw || BBa-K1438003_rew || 65 || pQE80L_PPMT_ATPCS || 1408 || ATPCS |- | 10 || XbaI_T7_prom || for Lambda_Term_suffix_rew || 66 -->67 || pQE80L_BFR || 690 (+377bp-->cp) || BFR_cp |- | 11 || " || " || 66 -->67 || pQE80L_BFRM52H || 690 (+377bp) || BFRM52H_cp |- | 12 || " || " || 66 -->65 || pQE80L_FTH_FLH(HuFer) || 1337(+377bp) || FTH_FLH_cp |- | 13 || " || " || 66 -->67 || pQE80L_PPMT_GS_ATPCS || 1968(+377bp) || PPMT_GSATPCS_cp |- | 14 || " || " || 66 -->67 || pQE80L_PPMT_ATPCS || 2091(+377bp) || ATPCS_cp |- | 06 || " || " || 66 || pQE80L_fbfs_mil_Ferritin || 1403(+377bp) || fbfs_mil_Ferritin_cp |} '''PCR-Ansätze V/µl''' Q5 2xMM 25.0 10µM PB_fw 2.5 10µM PB_rew 2.5 template 2.0 (~1ng) nuc.-free H2O 18.0 '''PCR-Programm''' {| class="wikitable" |- ! T/°C !! t/min !! cycles |- | 98 || 30" || 30 |- | 98 || 10" || " |- | 66/67 || 30" || " |- | 72 || 40"/12"/1' || " |- | 72 || 2' || " |- | 8 || infinity || " |} Datei:140925 SN iGEM biobricks4-12.JPEG|PCR Results PCR purification of 1,2, 3 (Jbfs_mil_Ferritin_cp),BF-cp and BFM-cp biobrick parts {| class="wikitable" |- ! !! Concentration µg/ml |- | fbfs_mit_Ferritin1 || 42 |- | fbfs_mit_Ferritin2 || 35 |- | fbfs_mit_Ferritin3 || 42 |- | ATPCS and PPMT || -12 too low |- | Bacterioferritin CP|| 56 |- | BFM52H CP || 57 |} == Magnetization of E. coli by expression of human Ferritin, Bio-transformations, 3rd Experiment part 7 of 7 == - Double-trafo was successful in all RV308 plates but not in Nissle

09/30 Tuesday

==Ligation of Biobrick parts with PSBIC3 backbone (digested on 23.09.2014 by Johann== Transformation into DH10b c.c.cells by chemical transformation
5µl of each ligation was transformed to 100µl aligusted cells each
--> after recovery at 37°C, 30min cells were plated on Cm/LB-Agar plates after centrifuging-->pelleting and resuspending in 100µl LB to plate all cells. --> incubation at 37°C, o/n == Mini Prep von pSB 1U 3-RFP == concentration 112 ng/µl
Preculture
pQE-80L-jbfs-Ferritin 5ml LB+5µl Amp at 37°C overnight

10/01 Wednesday - Plasmid Digestion & PCR Probe

==== Plasmid Digestion ==== {| class="wikitable" |- ! Plasmid Digestion !! |- | NEB Buffer 3.1 || 5µl |- | NEB XbaI || 0.5µl |- | NEB PstI || 0.5µl |- | P_MA_T_PPMT 312ng/µl || 3.2µl |- | null. free water || 40.5µl |} ==== PCR Probe ==== ===Ligation plates evaluated:=== All plates had clones except for BFR_cp from each plate transformation one clone was cultivated with LB/Cm (~5ml) o/n at 37°C

10/02 Thursday - Cultures were Mini-preped

--> elution with 40µl EB --> DNA contration measurement

10/06 Monday- Colony PCR

{| class="wikitable" |- ! Biobrick !! Sequenzierung !! Sequenz (?) !! (???) |- | BB0 || BFR || 100Y BFR M52H || -A ws ATGf (??) |- | BB1 || BFR M52H || 100% BFR || -A wr |- | BB2 || HFTN_LFFN (?) || 96Y HuFerritin (Rw Sep nötig) ?? || |- | AnP || ATPCS || f 70% ok, aber Fragment f || PCR nochmal ... Gelex (?) |- | BFM1cp || BFR1cp || ? || |- | BFM2cp || BFR2cp || ? || |- | HuFecp || HuFerritin cp || ? || |} ===Colony-PCR of other clones=== '''PCR-Programm''' {| class="wikitable" |- ! T/°C !! t/min !! cycles |- | 95 || 7' || 30 |- | 95 || 30" || 30 |- | 52 || 30" || 30 |- | 72 || 1' || 30 |- | 72 || 10" || 30 |- | 8 || infinity || 30 |} --> gel (1% Agarose) Clones 3, 5, 6, 7 and 13 were grown o/n in LB/Cm for Mini-prep on the following day. therefore 5µl of the disolved clones were used for each inoculation --> 37°C, 200rpm ==2x M9 Media Production== (Christina)
2X M9 mineral medium
For 500 ml M9 minearal medium add to XXX ml sterile water:
{| class="wikitable" |- | 100ml || M9 salt solution (10X) || Na₂HPO₄
KH₂PO₄
NaCl
NH₄Cl || 67.4mM
44.0mM
17.10mM
18.70mM |- | Beispiel || Beispiel || Beispiel || Beispiel |- | Beispiel || Beispiel || Beispiel || Beispiel |- | Beispiel || Beispiel || Beispiel || Beispiel |- | Beispiel || Beispiel || Beispiel || Beispiel |- | Beispiel || Beispiel || Beispiel || Beispiel |- | Beispiel || Beispiel || Beispiel || Beispiel |}

10/07 Tuesday

===Mini-Prep of cultures (Ben) and preparation of sequencing samples (Saba):=== 9µl nuc.-free H2O + 3µl DNA + 3µl PB794


== Preculture of Knockouts == * λΔ FieF +PCP 20 : 5ml LB+tet/amp (1:1000) * λΔ FUR : 5ml LB+tet/kan (1:1000) * MG1655 ΔFieF: 5ml LB + amp/kan (1:1000)
incubation at 30°C

10/08 Wednesday - PCR of PSB1C3 Backbone

Q5 Mastermix 2x {| class="wikitable" |- ! Component !! Volume in µl |- | Q5 Mastermix 2x || 25 |- | Primer fw (PSB1C3 Suffix fw)|| 2,5 |- | Primer rev (PS1C3 Prefix rev|| 2,5 |- | template (PSB1C3_BBa_K1189018)|| 2 |- | nuc free H2O|| 18 |} {| class="wikitable" |- ! Temperature in °C!! Time!! Nr. of cyles |- | 98|| 30''|| |- | 98|| 5''|| loop start |- | 70|| 15''|| 30 |- | 72|| 1'|| loop end |- | 72|| 2'|| |- | 8|| infinit|| |- |} == Extraction of PCR Product (PSB1C3 linearised) == After extracting the expected band at 2000 bp it was purified using the EMDMillipore Montage Gel Extraction Device.
Resulting in about 120 µl DNA extract in TAE buffer with an concentration of 9ng/µl
{| class="wikitable" |- ! Digestion of PCR Product !! |- | NEB Buffer 3.1 || 15µl |- | NEB PstI|| 1.5µl |- | NEB XbaI || 1.5µl |- | nuc. free water || 83µl |- | PCR Product || 100µl |} * 1.5 hours at 37°C * PCR Purification * DNA concentraion measurement = 35ng/µl == Ligation == Calculation *BFM52H = 3.22µl *BF_cp= 6.7µl *jbfs_m = 8.06 µl *BB_AnP = 10.64 µl * HuFer = 9.45 µl == Iron Concentration measurement == 278 mg FeSO₄.7H₂O dissolved in 10 ml d.H₂O
λ FieF PCP₂ Amp 1:100 ---> 3.0 OD
iGEM BV125 tet 1:100 --> 3.0 OD
λ FieF PCP₁ Amp 1:20 -->3.26 OD iGEM BV125 tet 1:20---> 2.44
too high OD! Both samples diluted 1:2 Samples # FieF + 5µl 0.1 M Fe-stock solution # FieF + 15 µl 0.1 M Fe-Stock solution # BV + 5 µl 0.1M Fe-stock solution # BV + 15 µl 0.1 M Fe-stock solution Overnight incubation at 30°C on a shaker

10/09 Thursday

Mini Prep (using: AccuPrep Plasmid Mini Extraction Kit Ver. 2.0, Company: BIONEER), using 100µl Elution Buffer
and dsDNA Measurement: 4 µl Sample + 76µl MilliQ, blanked with MilliQ {| class="wikitable" |- ! Samplenumber !! Samplename !! dsDNA conc [ng/µl] !! Sample [µl] used for Sequencing !! nucl.free Water [µl] used for Sequencing |- | #1 || cp HuF || 111 || 9 || 3 |- | #2 || AGSP || 107 || 9,4 || 2,6 |- | #3 || AGSP || 59 || 12 || 0 |- | #4 || AGSP || 64 || 12 || 0 |- | #5 || jbfs_Fer || 54 || 12 || 0 |- | #6 || A'n'P || 67 || 12 || 0 |} For Sequencing: *total volume: 15µl *Primer used: PB795 3µl each Sequencing approach *Sample [µl] see table *nucl.free Water [µl] see table evaluation of Trafos ---> no growth --->Repeat Trafo in other cells

10/10 Friday - STRATEGY 1 - Knockout of FieF and FUR Genes

=== Detection PCR === kan-deletion-cassette for FieF and FUR Genes was transformed into 2 different strains (MG1655 and λ MAGE). Additionally pCP20 was already transformed into one of the λ MAGE Clones (has to be re-validated).
The positive clones have to be validated.
Detection-PCR of one clone of Plates 1-3:
Plate 1: MG1655 ΔFieF
Plate 2: λ ΔFieF + pCP20
Plate 3: λ ΔFUR
=== Primer-Combinations === '''FieF''' {| class="wikitable" |- !- !! Combination !! WT length !! Clone length !! Annealing Temperature range |- | A ||C1+C2 || 2060bp || 2654bp || 58,4-60,1°C |- | B ||C1+C3 || 0 || 1046bp || 59,5-60,1°C |- | C ||C4+C2 || 0 || 1181bp || 57,5-58,4°C |- | D ||C1+C5 || 1134bp || 0 || 60,1-60,5°C |} --> Annealing Temperature: 57°C
'''FUR''' {| class="wikitable" |- ! - !!Combination !! WT length !! Clone length !! Annealing Temperature range |- | A ||C1+C2 || 1130bp || 2219bp || 59,5°C |- | B ||C1+C3 || 0 || 823bp || 59,5°C |- | C ||C4+C2 || 0 || 969bp || 57,5-59,5°C |- | D ||C1+C5 || 500bp || 0 || 59,5°C |} --> Annealing Temperature: 57°C === PCR-Assay === {| class="wikitable" |- ! - !! 1x !! Mastermix 15x |- | nuc.free H₂O || 14,4µl || 216µl |- | 10x Dream Taq Buffer || 2µl || 30µl |- | 50mM MgCl₂ || 0,6µl || 9µl |- | 10mM dNTPs || 0,5µl || 7,5µl |- | |- | 10mM Primer Combination || 1µl |- | 10µl nuc.free H₂O+ picked colony|| 1µl + 18,4ml Mastermix |- | Taq Polymerase || 0,5µl |} === PCR-Program === {| class="wikitable" |- ! Temperature !! Time |- | 95°C || 7' |- |30 cycles |- | 95°C || 30" |- | 57°C || 30" |- | 72°C || 2'40" |- | |- | 72°C || 5' |- | 12°C || hold |} === Gel-Electrophoresis === 1% Agarose-Gel + 1µl GelRed; 90V; 30min

10/14 Tuesday - Iron-Assay

1. Day: inoculation of 5ml LB Media (+ Antibiotics)
* 37°C or 30°C/ON

2.Day:inoculation of 10ml LB (1:10)
* 30°C or 37°C
* grow until OD₆₀₀ 0,6
* take 1ml
* centrifuge 2min at max. speed
* discard the supernatant
* wash with 1X M9 Media

* 1XM9:
:500µL 2X M9+
:500µL sterile water
* wash 2x and recover 1mL 1XM9 Media
* diluted 1:1000 with 1X M9
* plate 20µL per well 24well plate without Antibiotics
*A:MG1655 wt *B:Nissel 1917 wt *C:RV308 wt *D:DH10b
concentration of Fe-citrat
0 0,5 1 2 5 10mM