"
Team:Duke/Parts
From 2014.igem.org
| Line 14: | Line 14: | ||
<p>During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.</p> | <p>During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.</p> | ||
<table> | <table> | ||
| - | <tr><td><span style="font-weight:bold">Sequence</td> <td>Ungated Mean</td><td>Fluorescence Relative to Reporter-Only</ | + | <tr><td><span style="font-weight:bold">Sequence</span></td> <td><span style="font-weight:bold">Ungated Mean</span></td><td><span style="font-weight:bold">Fluorescence Relative to Reporter-Only</span></td></tr> |
<tr><td></td><td></td></tr> | <tr><td></td><td></td></tr> | ||
<tr><td>Reporter</td><td>43.7</td><td>1</td></tr> | <tr><td>Reporter</td><td>43.7</td><td>1</td></tr> | ||
Revision as of 03:51, 18 October 2014
Construction Background
During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.
| Sequence | Ungated Mean | Fluorescence Relative to Reporter-Only |
| Reporter | 43.7 | 1 |
| DH5alpha ZI | 0.16 | 0.003661327231 |
| dCas9 | 42.73333333 | 0.9778794813 |
| GFP1 (ccatctaattcaacaagaat) | 13.4 | 0.3066361556 |
| GFP2 (agtagtgcaaataaatttaa) | 48.6 | 1.112128146 |
| GFP3 (gtagtgacaagtgttggcca) | 15.43333333 | 0.3531655225 |
We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:
PCR1: oligos with prefix-decoy-spacer (top strand), decoy-spacer-decoy (top strand), and spacer-decoy-spacer (bottom strand) are combined and cycled 35 times resulting in a mixture of products
PCR2: the products of PCR1 are used as a template for a bottom strand oligo that appends the BioBrick suffix and cycles 35 times.
The products of PCR2 are inserted in to pSB1C3 via Gibson assembly
These constructs can be expanded further by serial digestion/ligation
From our PCR-based construction scheme we isolated 1x and 6x decoys, and then expanded the 6x array to 12x. These parts were submitted to the registry as BBa_K1545000 BBa_K1545001 and BBa_K1545001
Crystal structure 4OO8 from the Doudna Lab. Cas9 is in blue, gRNA in red, and the DNA to which the complex binds is in yellow. Click for the PubMed article.
