Team:Duke/Parts
From 2014.igem.org
Line 14: | Line 14: | ||
<p>During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.</p> | <p>During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.</p> | ||
<table> | <table> | ||
+ | <tr><td>Sequence</td> <td>Ungated Mean</td><td>Fluorescence Relative to Reporter-Only</td></tr> | ||
+ | <tr><td>DH5alpha ZI</td> <td>0.16</td><td>0.003661327231</td></tr> | ||
+ | <tr><td></td><td></td></tr> | ||
+ | <tr><td>Reporter</td><td>43.7</td><td>1</td></tr> | ||
+ | <tr><td></td><td></td></tr> | ||
+ | <tr><td>dCas9</td><td>42.73333333</td><td>0.9778794813</td></tr> | ||
+ | <tr><td></td><td></td></tr> | ||
+ | <tr><td>GFP1 (ccatctaattcaacaagaat)</td><td>13.4</td><td>0.3066361556</td></tr> | ||
+ | <tr><td></td><td></td></tr> | ||
+ | <tr><td>GFP2 (agtagtgcaaataaatttaa)</td><td>48.6</td><td>1.112128146</td></tr> | ||
+ | <tr><td></td><td></td></tr> | ||
+ | <tr><td>GFP3 (gtagtgacaagtgttggcca)</td><td>15.43333333</td><td>0.3531655225</td></tr> | ||
+ | </table> | ||
+ | |||
+ | <!--<table> | ||
<tr><td>Sequence</td> <td>Ungated Mean</td></tr> | <tr><td>Sequence</td> <td>Ungated Mean</td></tr> | ||
<tr><td>DH5alpha ZI</td> <td>0.16</td></tr> | <tr><td>DH5alpha ZI</td> <td>0.16</td></tr> | ||
Line 32: | Line 47: | ||
<tr><td>GFP3 (gtagtgacaagtgttggcca)</td><td>15.43333333</td></tr> | <tr><td>GFP3 (gtagtgacaagtgttggcca)</td><td>15.43333333</td></tr> | ||
<tr><td>fluorescence relative to reporter-only</td><td>0.3531655225</td></tr> | <tr><td>fluorescence relative to reporter-only</td><td>0.3531655225</td></tr> | ||
- | </table> | + | </table>--> |
<p>We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:</p> | <p>We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:</p> | ||
Revision as of 03:49, 18 October 2014
Construction Background
During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.
Sequence | Ungated Mean | Fluorescence Relative to Reporter-Only |
DH5alpha ZI | 0.16 | 0.003661327231 |
Reporter | 43.7 | 1 |
dCas9 | 42.73333333 | 0.9778794813 |
GFP1 (ccatctaattcaacaagaat) | 13.4 | 0.3066361556 |
GFP2 (agtagtgcaaataaatttaa) | 48.6 | 1.112128146 |
GFP3 (gtagtgacaagtgttggcca) | 15.43333333 | 0.3531655225 |
We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:
PCR1: oligos with prefix-decoy-spacer (top strand), decoy-spacer-decoy (top strand), and spacer-decoy-spacer (bottom strand) are combined and cycled 35 times resulting in a mixture of products
![](https://static.igem.org/mediawiki/2014/5/5b/Parts1.png)
PCR2: the products of PCR1 are used as a template for a bottom strand oligo that appends the BioBrick suffix and cycles 35 times.
![](https://static.igem.org/mediawiki/2014/4/40/DukeParts2.png)
The products of PCR2 are inserted in to pSB1C3 via Gibson assembly
![](https://static.igem.org/mediawiki/2014/3/34/Parts3.png)
These constructs can be expanded further by serial digestion/ligation
![](https://static.igem.org/mediawiki/2014/c/cf/Parts4.png)
From our PCR-based construction scheme we isolated 1x and 6x decoys, and then expanded the 6x array to 12x. These parts were submitted to the registry as BBa_K1545000 BBa_K1545001 and BBa_K1545001
![](https://static.igem.org/mediawiki/2014/3/3b/4oo8doudna.png)
Crystal structure 4OO8 from the Doudna Lab. Cas9 is in blue, gRNA in red, and the DNA to which the complex binds is in yellow. Click for the PubMed article.