Team:SJTU-BioX-Shanghai/Results

From 2014.igem.org

(Difference between revisions)
Line 15: Line 15:
<article class="post__article">
<article class="post__article">
-
<h2>Reformed Plasmid Result</h2>
+
<h3>Reformed Plasmid Result</h3>
<p>We designed four reformed plasmids, pBluescript II KS(+) ScaI deletion, pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy.
<p>We designed four reformed plasmids, pBluescript II KS(+) ScaI deletion, pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy.
And we test their co-transformation ability and get the result picture. All of these plasmid has Amp antibiotic resistance. </p>
And we test their co-transformation ability and get the result picture. All of these plasmid has Amp antibiotic resistance. </p>
Line 33: Line 33:
<p>So we experimentally validate that our reformed plasmids perform as expected. </p>
<p>So we experimentally validate that our reformed plasmids perform as expected. </p>
-
<h2>TAL USB function identification</h2>
+
<h3>TAL USB function identification</h3>
<p>The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000
<p>The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000
In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.</p>
In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.</p>

Revision as of 19:11, 17 October 2014

Reformed Plasmid Result

We designed four reformed plasmids, pBluescript II KS(+) ScaI deletion, pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy. And we test their co-transformation ability and get the result picture. All of these plasmid has Amp antibiotic resistance.

We co-transformed pRSFDuet-1 and two plasmids, pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion, respectively. So the plate has two antibiotic resistance, Kan and Amp. We culture two different strains on the plate and get the result picture.

Figure 2.1.1 Two plates of Co-transfected bacteria (pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion)

Moreover, we verify our pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy part through lacl & blue-white spot screening.

Figure 2.1.2 Two plates of lacl & blue-white spot screening

So we experimentally validate that our reformed plasmids perform as expected.

TAL USB function identification

The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000 In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.

Figure 2.1.3 The structure of TAL USB

When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein (BBa_K747000 to BBa_K747095) After doing ligation with T4 Ligase, we experimentally validated this part's function.

Sequencing result is followed:

GGAATTCCATATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCGATGGCTTCC TCCGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGTTCCGTTAACGGTCACGAGTTCGAAA TCGAAGGTGAAGGTGAAGGTCGTCCGTACGAAGGTACCCAGACCGCTAAACTGAAAGTTACCAAAGGTGGTCCGCT GCCGTTCGCTTGGGACATCCTGTCCCCGCAGTTCCAGTACGGTTCCAAAGCTTACGTTAAACACCCGGCTGACATC CCGGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGTGTTATGAACTTCGAAGACGGTGGTGTTG TTACCGTTACCCAGGACTCCTCCCTGCAAGACGGTGAGTTCATCTACAAAGTTAAACTGCGTGGTACCAACTTCCC GTCCGACGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCTTCCACCGAACGTATGTACCCGGAAGACGGT GCTCTGAAAGGTGAAATCAAAATGCGTCTGAAACTGAAAGACGGTGGTCACTACGACGCTGAAGTTAAAACCACCT ACATGGCTAAAAAACCGGTTCAGCTGCCGGGTGCTTACAAAACCGACATCAAACTGGACATCACCTCCCACAACGA AGACTACACCATCGTTGAACAGTACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTGCTGAGGCCGCCGCAAAA GAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGACCAGTAGCTATCTGCATTTTCCGGAGTTTGATCCGGTCATTT TCTCAATAGGACCCGTGGCGCTTCACTGGTACGGCCTGATGTATCTGGTGGGTTTCATTTTTGCAATGTGGCTGGC AACACGACGGGCGAATCGTCCGGGCAGCGGCTGGACCAAAAATGAAGTTGAAAACTTACTCTATGCGGGCTTCCTC GGCGTCTTCCTCGGGGGACGTATTGGTTATGTTCTGTTCTACAATTTCCCGCAGTTTATGGCCGATCCGCTGTATC TGTTCCGTGTCTGGGACGGCGGCATGTCTTTCCACGGCGGCCTGATTGGCGTTATCGTGGTGATGATTATCTTCGC CCGCCGTACTAAACGTTCCTTCTTCCAGGTCTCTGATTTTATCGCACCACTCATTCCGTTTGGTCTTGGTGCCGGG CGTCTGGGCAACTTTATTAACGGTGAATTGTGGGGCCGCGTTGACCCGAACTTCCCGTTTGCCATGCTGTTCCCTG GCTCCCGTACAGAAGATATTTTGCTGCTGCAAACCAACCCGCAGTGGCAATCCATTTTCGACACTTACGGTGTGCT GCCGCGCCACCCATCACAGCTTTACGAGCTGCTGCTGGAAGGTGTGGTGCTGTTTATTATCCTCAACCTGTATATT CGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCTGATTGGTTACGGCGCGTTTCGCATCATTGTTGAGT TTTTCCGCCAGCCCGACGCGCAGTTTACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCC GATGATTGTCGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTTAGGAGGT GGAGGTAGTGGTGGAGGTGGAAGTGGTGGAGGTGGTAGTGCTGCAGCTCTGGACACGGGCCAGTTGCTGAAGATCG CGAAGCGGGGAGGAGTCACGGCGGTCGAGGCGGTGCACGCGTGGCGCAATGCGCTCACGGGAGCACCCCTCAACCT GACCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTT CCGGTTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCACGATGGCGGTAAACAAG CCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAGGCCCACGGGCTCACGCCTGAGCAGGTAGTGGCTAT TGCATCCAACGGAGGGGGCAGACCCGCACTGGAGTCAATCGTGGCCCAGCTTTCGAGGCCGGACCCCGCGCTGGCC CACCACCACCACCACCACTAACTCGAGCGG

Furthermore, we find some mismatch cases in our sequencing result. Here are a typical mismatch result.

There is the partial sequencing result.

Figure 2.1.4 Partial sequencing result of mismatch

We try to understand why we get this wrong sequence. We Check our part and 2012 Freiburg's project. And we find that the the mismatch sticky end appearing in original sequence is GCTC and ACTC. What a similar sticky ends! Here are the two components in the mismatch sequence.

Figure 2.1.5 The process of mismatch generating

So the sequencing result proves that similar sticky ends can mismatch when T4 ligase exists. This result enlighten us on improving TALE construction parts.

2012 Freiburg's parts have seven sticky ends:

TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC

Spired by BLAST algorithm, we calculate the similarity of each other sticky ends.

Figure 2.1.6 Strict rules score table

The higher score, the higher similarity, and the higher possibility of mismatch. The table shows that more than 30% of pairs’ score is equal to 3, which means that the possibility of mismatch cannot be neglected. Even if we employ the relatively loose rule to calculate the similarity, we can still find that error rates cannot be neglected.

Figure 2.1.6 Loose rules score table

So how to solve this problem?

Our team design seven new sticky ends which is theoretically better than original vision. See more information please go to TAL Improvement page!