From 2014.igem.org
(Difference between revisions)
|
|
| Line 20: |
Line 20: |
| | | | |
| | <p><b>Biology Details:</b></p> | | <p><b>Biology Details:</b></p> |
| - | <p>Design of tri-color plasmid pool (June 2014)<br> | + | <p>Design of tri-color plasmid pool <br> |
| - | 9 promoter-rbs pairs of varying strength from Kosuri et al paper (2013):<br> | + | <UL><LI>9 promoter-rbs pairs of varying strength from Kosuri et al paper (2013):</UL> |
| | <table border="1" cellpadding="0" cellspacing="0"> | | <table border="1" cellpadding="0" cellspacing="0"> |
| | <tr> | | <tr> |
| Line 76: |
Line 76: |
| | | | |
| | <p>Selection of colored reporter proteins <br> | | <p>Selection of colored reporter proteins <br> |
| - | Co-transformation testing of multiple color combinations of proteins from DNA2.0<br> | + | <UL><LI>Co-transformation testing of multiple color combinations of proteins from DNA2.0<br> |
| - | Transformations on Kanamycin and IPTG<br></p> | + | <LI>Transformations on Kanamycin and IPTG</UL><br></p> |
| | <img src=""> | | <img src=""> |
| | <img src=""> | | <img src=""> |
Revision as of 17:57, 17 October 2014
|
|
|
| |
| |
| |
Notebook |
|
Timeline of major events:
- May: Basic concept research and design
- June: Software development initiated; plasmid design started and promoter-RBS’s picked
- July: Wetlab testing of possible color protein combinations
- August 10: Design of complete tri-color plasmids finalized
- August 24: Assembly of tri-color plasmid pools completed (DNA2.0)
- September 10: Tri-color plasmids optimized on museum wetlab setup
- September 29: Software fully integrated with hardware on mobile exhibit
- September 30 - October 3: Prototyping of mobile exhibit with museum staff and visitors
- October 6 - October 17: Data collection on the museum floor with visitor!
Biology Details:
Design of tri-color plasmid pool
- 9 promoter-rbs pairs of varying strength from Kosuri et al paper (2013):
|
Promoter - RBS Pairs |
Sequence |
| 1 |
BBa_J23117 - BBa_J61112 |
TTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCCAATCTCTAGAGAAAGAGGTGACATAC |
| 2 |
BBa_J23104 - BBa_J61107 |
TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGCTTACGTCTAGAGAAAGAAGAGACTCAC |
| 3 |
apFAB78 - apFAB954 |
TTGACATTTATCCCTTGCGGCGATAGATTTAACGTATGACGGATCTTAATCTAGCTCAGGACAATTT |
| 4 |
apFAB76 - apFAB927 |
TTGACATTTATCCCTTGCGGCGATATAATAGATATCTTAATCTAGCCCGGGAGTTTTTTCATTCCGGATCTTAATCTAGCTGGGGACTGTTT |
| 5 |
apFAB70 - apFAB844 |
TTGACATCGCATCTTTTTGTACCTATAATGTGTGGATAGAGTATCTTAATCTAGCAGGGGACACTTT |
| 6 |
BBa_J23104 - apFAB909 |
TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGCTTACGATCTTAATCTAGCGAAGGATAGTTT |
| 7 |
apFAB45 - apFAB901 |
AAAAAGAGTATTGACTTCGCATCTTTTTGTACCTATAATGTGTGGATAGCGG |
| 8 |
apFAB92 - apFAB863 |
AAAAAATTTATTTGCTTTCAGGAAAATTTTTCTGCATAATTATTTCATGGAGCATCTTAATCTAGCGGGGGAGCGTTT |
| 9 |
apFAB71 - salis-4-10 |
TTGACATCGCATCTTTTTGTACCTATAATAGATTCATGATGAAATCTCTTTTATCAAATATAAGCAGGAT |
Selection of colored reporter proteins
- Co-transformation testing of multiple color combinations of proteins from DNA2.0
- Transformations on Kanamycin and IPTG
![]()
![]()
Final tri-color plasmid designs, assembled by DNA2.0:
Chromogenic plasmid pool
- Blitzen (blue)
- Kringle (yellow)
- Paprika (red)
Fluorescent plasmid pool
- CindyLouCFP (400/495)
- KringleYFP (520/542)
- PaprikaRFP (554/590)
Optimization of plasmid pools with visitor-accessible museum wetlab set up. Transformation condition:
- 6cm plates
- 400 ug/ml Amp
- 0.3 ul unamplified plasmid pool in 100ul CaCl2
- 20 ul competent bacteria
- Current visitor wetlab transformation protocol: 30 sec on ice, 40 sec heat shot at 42 degrees C
- Chromogenic pool maturation time ~ 5 days 37 degrees C
- Fluoroescent pool maturation time ~ 3 days 37 degrees C
- Low copy fluorescent plasmid pool gave more reliable results with most color variety
Safety:
We did not use any dangerous organisms or reagents. Transformation of bacteria was done in the musuem’s existing wetlab setup.
|
|
|
"
