NOTEBOOK

PCR

Primers

Primer reverse: TCACTCAAAGGCGGTAATAC

Primer forward: CCACCTGACGTCTAAGAAAC

Quantification and amplification of plasmid DNA

• 1) The quantity and purity of genomic DNA were determined by optical density in a spectrophotometer (NanoDrop® ND-1000 UV-Vis).
• 2) Genomic DNA was amplified using PCR with primers TCACTCAAAGGCGGTAATAC (reverse primer) and CCACCTGACGTCTAAGAAAC (foward primer).
• 3) The reaction was performed in a thermocycler (Applied Biosystems® Veriti® Thermal Cycler).
• 4) The following reagents were used in the reaction: In a 0.2 ml tube: 1U Taq DNA polymerase (Invitrogen Life Technologies, Brazil); µl 2.5 of 10X PCR buffer (10 mM Tris-HCl pH 8 and 50 mM KCl - Invitrogen Life Technologies, Carlsbad, CA), 4mM MgCl 2 (Invitrogen Life Technologies, Carlsbad, CA, USA) 0.25 mM dNTPs (desorribonucleotídeo 5'-triphosphate - dATP, dCTP, dGTP and dTTP - GE Healthcare, Piscataway, NJ, USA), 15 pmol of each primer and 10.9 µl of ultrapure water qs (Invitrogen Life TechnologiesTM, Carlsbad, CA, USA). After the mixture was added 5 µl DNA from each sample a total final volume of 25 µl.
• 5) The temperature cycles consisted of initial denaturation at 94 ° C / 10 minutes, followed by 40 cycles of denaturation at 94 ° C / 1 minute, annealing at 65 ° C / 1 minute, and extension at 72 ° C / 2 minutes, followed by final extension at 72 ° C / 7 minutes. The successful amplification of DNA was verified by electrophoresis on a 2% agarose gel stained with ethidium bromide, visualized under ultraviolet light and documented with the aid of the Kodak Digital Science 1D system.