Team:Berlin/Project

From 2014.igem.org

(Difference between revisions)
Line 482: Line 482:
               <div class="sub-content-project">  
               <div class="sub-content-project">  
                 <h2 class="sub-content-project-headline">04/02 Wednesday - Cultivating E. coli Nissle 1917</h2>
                 <h2 class="sub-content-project-headline">04/02 Wednesday - Cultivating E. coli Nissle 1917</h2>
 +
                LB plates were produced without antibiotic. Therefore 10 ml MQ-H<sub>2</sub>O were sterile filtered in 15 ml falcon tube. 1 capsule Mutaflor 331800 was solved in the sterile water.
 +
                The E. coli Nissle solution was incubated at 37°C and 200 rpm for 1 h and crossed out at 4 plates to get different dilution of cells.
 +
                <!--{| class="wikitable"
 +
                |-
 +
                ! dilution !! E. coli Nissle solution !! H<sub>2</sub>O !! dilution factor
 +
                |-
 +
                | I || 2 µl || 1998 µl || 1:10<sup>3</sup>
 +
                |-
 +
                | II || 100 µl from dilution I || 900 µl ||1:10<sup>4</sup>
 +
                |-
 +
                | III || 10 µl from dilution II || 990 µl || 1:10<sup>5</sup>
 +
                |}-->
 +
            </div> 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 04/03 Thursday - Genomic DNA extraction of ECN - first step </h2>
-
LB plates were produced without antibiotic. Therefore 10 ml MQ-H<sub>2</sub>O were sterile filtered in 15 ml falcon tube. 1 capsule Mutaflor 331800 was solved in the sterile water.  
+
            For extraction of the genomic DNA of E. coli Nissle, 2 E. coli colonies were oicked from LB plate (dilution 1:10<sup>3</sup>) and used for inocculation of 6 ml LB precultures. These were grown over night at 37°C and 200 rpm.  
-
The E. coli Nissle solution was incubated at 37°C and 200 rpm for 1 h and crossed out at 4 plates to get different dilution of cells.
+
            </div>
-
{| class="wikitable"
+
 
-
|-
+
            <div class="sub-content-project">
-
! dilution !! E. coli Nissle solution !! H<sub>2</sub>O !! dilution factor
+
            <h2 class="sub-content-project-headline"> 04/04 Friday - Genomic DNA extraction of ECN - second step</h2>
-
|-
+
 
-
| I || 2 µl || 1998 µl || 1:10<sup>3</sup>
+
            For preperation of the genomic DNA 1 ml of each preculture was taken and a genomic extraction performed using the Wizard Genomic DNA purification Kit. See instructions of the purification Kit by Promega. Genomic DNA was stored at 12°C in fridge.
-
|-
+
 
-
| II || 100 µl from dilution I || 900 µl ||1:10<sup>4</sup>
+
            As E. coli Nissle is a natural organism without resistence genes both precultures were streaked out on LB, LB+KAN and LB+AMP. All plates were incuvated over the weekend at 37°C.
-
|-
+
 
-
| III || 10 µl from dilution II || 990 µl || 1:10<sup>5</sup>
+
            DNA concentration was meassured by 260 nm using Goldi. DNA was diluted 1:40 in a UV cuvette and DNA absorption meassured at 260/28 nm in goldi.
-
|}
+
 
-
              </div>   
+
            '''For genomic DNA:'''
 +
            {| class="wikitable"
 +
            |-
 +
            | 1: || 1390 ng/µl
 +
            |-
 +
            | 2: || 988 ng/µl
 +
            |}
 +
 
 +
            [[Datei:Wizard_dna_purification_kit_promega.png]]
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 04/05 Saturday - Genomic DNA extraction of ECN - results </h2>
 +
 
 +
            Bacteria growth only on LB plate indicates that there was no contamination with AMP or KAN restinatant E. coli. This doesn´t mean that there is no contamination at all. See for sure on PCR.
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! LB !! LB+KAN !! LB+AMP
 +
            |-
 +
            | + || - || -
 +
            |}
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">                   
 +
            <h2 class="sub-content-project-headline"> 04/06 Sunday </h2>
 +
            ==Production of BfR, FTNA1 and FTNA2==
 +
            ===Restriction digest===
 +
            After 2 purifications of plasmids:
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            | p1 || 84ng/µl || 10µl
 +
            |-
 +
            | p2 || 72,2ng/µl || 10µl
 +
            |-
 +
            | p3 ||  54,8ng/µl || 23µl
 +
            |}
 +
 
 +
            ====Restriction program====
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            |  || 1x || 4x
 +
            |-
 +
            | plasmid P2 || 3µl || 12µl
 +
            |-
 +
            | BamHI (FD) ||  1µl || 4µl
 +
            |-
 +
            | HindIII (FD) ||  1µl || 4µl
 +
            |-
 +
            | Buffer (FD) ||  2µl || 8µl
 +
            |-
 +
            | H<sub>2</sub>O ||  13µl || 52µl
 +
            |}
 +
 
 +
            --> 37°C for 1h (restriction)
 +
            --> 80°C for 10min (deactivation)
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            | PCR || 6,38µl || 4,56µl || 2,71µl
 +
            |-
 +
            | BamHI (FD) ||  1µl || 1µl || 1µl
 +
            |-
 +
            | HindIII (FD) ||  1µl || 1µl || 1µl
 +
            |-
 +
            | Buffer (FD) ||  2µl || 2µl || 2µl
 +
            |-
 +
            | H<sub>2</sub>O ||  19,62µl || 21,44µl || 23,29µl
 +
            |}
 +
 
 +
            --> 37°C for 1h (restriction)
 +
            --> 80°C for 10min (deactivation)
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            | Plasmid || 1 || 2 || 3
 +
            |-
 +
            | P ||  10µl || 10µl || 18µl
 +
            |-
 +
            | BamHI (FD) ||  1µl || 1µl || 1µl
 +
            |-
 +
            | HindIII (FD) ||  1µl || 1µl || 1µl
 +
            |-
 +
            | Buffer (FD) ||  2µl || 2µl || 3µl
 +
            |-
 +
            | nuc.free H<sub>2</sub>O ||  6µl || 6µl || 7µl
 +
            |}
 +
 
 +
            --> 37°C for 1h (restriction)
 +
            --> 80°C for 10min (deactivation)
 +
 
 +
            ===PCR Purification (without isopropanol)===
 +
 
 +
            Elution buffer 20µl; 1min incubated
 +
            {| class="wikitable"
 +
            |-
 +
            | plasmid P1-3 || 45,3ng/µl
 +
            |-
 +
            | BfR || 12,9ng/µl
 +
            |-
 +
            | FTNA1 || 34,4 ng/µl
 +
            |-
 +
            | FTNA2 || 29,9ng/µl
 +
            |}
 +
 
 +
            ===Ligation Assay===
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! - !! Control !! BFR !! BFR !! BFR !! FTNA1 !! FTNA1 !! FTNA1 !! FTNA2 !! FTNA2 !! FTNA2 !! BFR_E !! BFR_E !! BFR_E
 +
            |-
 +
            | Dilution || - || 1x || 3x || 5x||1x|| 3x || 5x||1x || 3x || 5x ||1x || 3x || 5x
 +
            |-
 +
            | Vector DNA || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1
 +
            |-
 +
            | Insert DNA || 0 || 0,4 || 1,6 || 2,0 || 0,10 || 0,47 || 0,79 || 0,18 || 0,52 || 0,90 || 0,40 || 1,16 || 2,0
 +
            |-
 +
            | Buffer || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1
 +
            |-
 +
            | T4 DNA-Ligase || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25
 +
            |-
 +
            | H<sub>2</sub>O || 7,65 || 7,25 || 6,5 || 5,65 || 7,5 || 7,20 || 6,85 || 7,50 || 7,20 || 6,85 || 7,25 || 6,50 || 5,65
 +
            |-
 +
            |}
 +
            ===Transformation===
 +
            --> Transformation of 5µl Sample into DH5α-Cells
 +
            --> Incubation o/n at 37°C after streating out on LB+amp plates using sterile beads
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! BFR !! FTNA1 !! FTNA2
 +
            |-
 +
            | 5,2ng || 5,51ng || 5,43ng
 +
            |-
 +
            | 15,6ng || 16,5ng || 16,27ng
 +
            |-
 +
            | 26,0ng || 27,4ng || 27,13ng
 +
            |}
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">               
 +
            <h2 class="sub-content-project-headline"> 04/07 Monday - Cloning Results </h2>
 +
            {| class="wikitable"
 +
            |-
 +
            ! Sample !! CFU
 +
            |-
 +
            | Control || 13
 +
            |-
 +
            | tBFR 1 || 121
 +
            |-
 +
            | tBFR 3 || 38
 +
            |-
 +
            | tBFR 5 || 664
 +
            |-
 +
            | BFR 1 || 87
 +
            |-
 +
            | BFR 3 || 151
 +
            |-
 +
            | BFR 5 || 150
 +
            |-
 +
            | FTNA1 1 || 65
 +
            |-
 +
            | FTNA1 3 || 131
 +
            |-
 +
            | FTNA1 6 || 191
 +
            |-
 +
            | FTNA2 1 || 84
 +
            |-
 +
            | FTNA2 3 || 114
 +
            |-
 +
            | FTNA2 5 || 151
 +
            |}
 +
            --> picked 5 colos per construct for coloPCR (50µl TE-buffer; 96°C; 10min)
 +
            --> rescue plate
 +
 
 +
            '''colPCR Programm'''
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! - !! 1x !! Mastermix 23x
 +
            |-
 +
            | nuc.free H<sub>2</sub>O || 13,7µl || 315,1µl
 +
            |-
 +
            | 10x Dream Taq Buffer || 2µl || 46µl
 +
            |-
 +
            | 25mM MgCl<sub>2</sub> || 1,2µl || 27,6µl
 +
            |-
 +
            | 10mM dNTPs || 0,5µl || 11,5µl
 +
            |-
 +
            | Primer T5 prom (PB16) || 0,5µl || 11,5µl
 +
            |-
 +
            | Primer T5 term (PB17) || 0,5µl || 11,5µl
 +
            |-
 +
            |
 +
            |-
 +
            | boiled colos || 1µl + 18,4ml Mastermix
 +
            |-
 +
            | Taq Polymerase || 0,5µl
 +
            |}
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! Temperature !! Time
 +
            |-
 +
            | 95°C || 3'
 +
            |-
 +
            |30 cycles
 +
            |-
 +
            | 95°C || 30''
 +
            |-
 +
            | 55°C || 30''
 +
            |-
 +
            | 72°C || 1'
 +
            |-
 +
            |
 +
            |-
 +
            | 72°C || 10'
 +
            |-
 +
            | 12°C || hold
 +
            |}
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">               
 +
            <h2 class="sub-content-project-headline"> 04/08 Tuesday - Amplification of ferritin genes </h2>
 +
 
 +
            Primer designed for amplification:
 +
 
 +
            '''primer Bfr:'''
 +
 
 +
            FW: 5'  GC  G| G A T C C AAAGGTGATACTAAAGTTATAAATTATCTC(GC 23,33% Tm = 57,5)  3'  OK
 +
 
 +
            RW: 5'  GC  A| A G C T T TCAACCTTCTTCGCG(GC 50% Tm = 58,5)  3'                    OK
 +
 
 +
            '''primer FtnA1:'''
 +
 
 +
            FW: 5'  GC  G| G A T C C GCAACCGCTGGAATG(GC 60%  Tm = 60,5) 3'                    OK
 +
 
 +
            RW: 5'  GC  A| A G C T T TCAATGCAGCTGATGC(GC 50,0% Tm = 58,5)  3'                OK
 +
 
 +
            '''primer FtnA2:'''
 +
 
 +
            FW: 5'  GC  G| G A T C C CTGAAACCAGAAATGATTG(GC 36,8%  Tm = 65,1)  3'            OK
 +
 
 +
            RW: 5'  GC  A| A G C T T TTAGTTTTGTGTGTCGAGG(GC 42,1%  Tm = 56,8)  3'            OK
 +
 
 +
 
 +
            Using the Thermoscientific  PCR mastermix phusion polymerase, 2x 50 µl reactions per amplification:
 +
            {| class="wikitable"
 +
            |-
 +
            | Nuc-free H<sub>2</sub>O || 39,5 µl
 +
            |-
 +
            | 2x mastermix || 50,0 µl
 +
            |-
 +
            | FW primer ||  5,0 µl
 +
            |-
 +
            | RW primer ||  5,0 µl
 +
            |-
 +
            | template DNA ||  0,5 µl
 +
            |}
 +
 
 +
 
 +
            '''PCR programs:'''
 +
            {| class="wikitable"
 +
            |-
 +
            |  || 98°C || 10s || 1x
 +
            |-
 +
            |  || 98°C || 5s || 30x
 +
            |-
 +
            |primer|| Bfr/ FtnA1/ FtnA2 || 60,5°C/ 58,9°C/ 56,1°C || 30x
 +
            |-
 +
            | || 72°C || 10s || 30x
 +
            |-
 +
            | 72°C || 60s || Beispiel || 1x
 +
            |}
 +
 
 +
 
 +
 
 +
            == <big>'''Transformation of pQE_80L into DH5alpha'''</big> ==
 +
 
 +
            Plasmid from plasmid database of TU workgroup by Prof. Budisa was taken:
 +
            plasmid ID: 4; concentration = 308 ng/µl
 +
 
 +
            Unthaw 50 µl aliquot of DH5alpha or BL21 DE3 gold on ice for 10 min.Than Use 308 ng and 616 ng of plasmids to bind on Ca<big>2+</big>-surface of the cell membranes. Heat shock was performed for 30-90 s. The cells were incubated on ice for 2 min and than there was added 950 µl LB media. The cells were incubated at 37°C for 60 min. After this 70 µl of transformed E. coli suspension was streacked out onto a plate with the appropriate selection marker. The plate was incubated over night at 37°C. To prepare preculture 2 colonies were picked and added into 5 ml LB media + 5 µl AMP. The precultures were incubated over night at 37°C and 200 rpm.
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">           
 +
            <h2 class="sub-content-project-headline"> 04/10 Thursday - Expression of Ferritin in LB </h2>
 +
 
 +
            →Innoculate 20ml LB + amp with 1ml of a preculture<br />
 +
 
 +
            {|
 +
            |-
 +
            ! Title !! No. !! Wavelength !! Absobance !! Volume
 +
            |-
 +
            | BfR || 1 || 600nm || 0,529A || 1,51ml
 +
            |-
 +
            | FTNA1|| 2 || 600nm || 0,307A || 3,25ml
 +
            |-
 +
            | FTNA2 || 3 || 600nm || 0,605A || 1,32ml
 +
            |}
 +
            →Incubation for 2h until OD<sub>600</sub>=0,6-08<br />
 +
            {|
 +
            |-
 +
            ! Title !! No. !! Wavelength !! Absobance
 +
            |-
 +
            | BfR || 1 || 600nm || 0,825A
 +
            |-
 +
            | FTNA1|| 2 || 600nm || 0,883A
 +
            |-
 +
            | FTNA2 || 3 || 600nm || 0,859A
 +
            |}
 +
            → Take SDS Sample non-induced<br />
 +
            →Induce with 20µl IPTG<br />
 +
            →Add Fe<sup>2+</sup><br />
 +
            →Expression: 4h at 22°C<br />
 +
            Cultivation was aborted because of heat development
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">                                                              .                                   
 +
            <h2 class="sub-content-project-headline"> 04/14 Monday - Miniprep </h2>
 +
            Miniprep of the cell-seperation streak out of the cloning procedure from december 2013<br />
 +
            '''Miniprep-Kit of ThermoScientific'''<br />
 +
            {| class="wikitable"
 +
            |-
 +
            ! - !! Title !! Concentration in ng/µl
 +
            |-
 +
            | A4 || BfR || 66
 +
            |-
 +
            | B3 || FTNA1 || 138
 +
            |-
 +
            | C5 || FTNA2 || 88
 +
            |-
 +
            | D2 || BfR_Electro || 144
 +
            |}
 +
 
 +
            ==<big>'''DNA Concentration Determination'''</big>==
 +
            {|
 +
            |-
 +
            | Dilution Factor || 20
 +
            |-
 +
            | Integration Time || 1s
 +
            |-
 +
            | Factor || 50
 +
            |-
 +
            | Units || µg/ml
 +
            |}
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! - !! Title !! No. !! 260nm !! 280nm !! 320nm !! Ratio !! Conc.
 +
            |-
 +
            | A4 || BfR || 1 || 0,056 || -0,022|| -0,010 || 2,05 || 66
 +
            |-
 +
            | B3 || FTNA1 || 2 || 0,135 || 0,067 || -0,003 || 1,96 || 138
 +
            |-
 +
            | C5 || FTNA2 || 3 || 0,078 || 0,035|| -0,008 || 2,00 || 86
 +
            |-
 +
            | D2 || BfR-Electro || 4 || 0,150 || 0,078 || 0,006 || 2,02 || 144
 +
            |}
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">                               
 +
            <h2 class="sub-content-project-headline"> 04/16 Wednesday - Sequencing </h2>
 +
            Preparation of the sequencing for the Samples from 16.01.2013
 +
            {|
 +
            |-
 +
            | T5 prom. Primer || 3µl
 +
            |-
 +
            | Plasmid || 12µl
 +
            |}
 +
            {|
 +
            |-
 +
            | A4 || 6µl
 +
            |-
 +
            | B3 || 6µl
 +
            |-
 +
            | C5 || 6µl
 +
            |-
 +
            | D2 || 6µl
 +
            |} 
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">                                   
 +
            <h2 class="sub-content-project-headline"> 04/17 Thursday - Expression of BfR and FTNA1/2 </h2>
 +
            4x sterile 250ml Erlenmeyer<br />
 +
            +50ml LB<br />
 +
            +50µl amp<br />
 +
            +2,5ml preculture<br />
 +
            Incubation: 1h at 30°C
 +
            {| class="wikitable"
 +
            |-
 +
            ! No. !! Title !! Wavelength !! Absorbance
 +
            |-
 +
            | 1 || BfR || 600nm || 0,909A
 +
            |-
 +
            | 2 || FTNA1 || 600nm || 0,980A
 +
            |-
 +
            | 3 || FTNA2 || 600nm || 0,930A
 +
            |-
 +
            | 4 || BfR+20?? || 600nm || 0,970A
 +
            |}
 +
            →Take SDS-Sample<br />
 +
            →Induction with 50µl IPTG<br />
 +
            →Addition of 0,0525g Fe-citrate (20mM dissolved in 1ml sterile Water)<br />
 +
            →Incubation for 3h at 30°C<br />
 +
            →continue incubation o/n<br />
 +
            →Centrifuge with 6800g for 5min<br />
 +
            </div>
 +
 
 +
            <div class="sub-content-project">       
 +
            <h2 class="sub-content-project-headline"> 04/18 Friday - Production of LB-Plates </h2>
 +
 
 +
            ===Production of a Mutaflor-Supression-culture===
 +
            →10ml sterile LB<br />
 +
            →Add the content of a Mutaflor capsula (white pouder)<br />
 +
            Incubation: 37°C at 220rpm<br />
 +
            ===Production of Dilutions of the Supression-culture and out streaking===
 +
            →1µl of the supression-culture to 999µl LB (1:1000)<br />
 +
            →100µl of that dilution to 900µl LB (1:10<sup>4</sup>)<br />
 +
            →10µl of that dilution to 990µl LB (1:10<sup>5</sup>)<br />
 +
            →Streak out 50µl of each culture on LB with sterile beads<br />
 +
            Incubation: 37°C
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 04/24 Thursday - Mini-Prep </h2>
 +
            (Ammar Al-Shameri)
 +
            {| class="wikitable"
 +
            |-
 +
            | 1 || PSB || D40 || 9fP || CR/LB
 +
            |-
 +
            | 2 || PSB || D20 || 9fP || CR/LB
 +
            |-
 +
            | 3 || PSB || D40 || fs || LB/CR
 +
            |-
 +
            | 4 || PSB || D40 || LB/CR
 +
            |-
 +
            | 5 || PSB || AB || Turyu || CR/LB
 +
            |-
 +
            | 6 || PSB || D48 || 9fP || CB/CR
 +
            |}
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 04/28 Monday -PCR Plasmid/ Primer and Parameter Check </h2>
 +
            (Salah and Christina)<br />
 +
 
 +
            Check of:<br />
 +
            -Plasmids/Primer<br />
 +
            -Annealing temperature<br />
 +
            -Phusion and Q5 Polymerase
 +
 
 +
            ===Plasmids===
 +
 
 +
            iGEM Plasmid pkD4 (Stock 200ng/µl) =>1:200 diluted = 1ng/µl
 +
 
 +
            WH (Willi Hauke) Plasmid pkD4 (0,72ng/µl)
 +
 
 +
            ===Primer===
 +
 
 +
            P1 FieF (iGEM)                                  fwd tnaA KO (WH)
 +
 
 +
            P2 FieF (iGEM)                                  rev  tnaA KO (WH)
 +
 
 +
 
 +
            ===Combinations===
 +
 
 +
            (4 combinations with Phusion; 4 combinations with Q5 )
 +
 
 +
 
 +
            {| border="2"
 +
            |
 +
            | '''Plasmid'''
 +
            | '''Primer'''
 +
            | '''Primer'''
 +
            |-
 +
            | '''1. '''
 +
            | iGEM Plasmid
 +
            | P1 (iGEM)
 +
            | P2 (iGEM)
 +
            |-
 +
            | '''2. '''
 +
            | WH Plasmid 
 +
            | fwd tnaA KO
 +
            | rev  tnaA KO            '''POSITIVCONTROL'''
 +
            |-
 +
            | '''3. '''
 +
            | iGEM Plasmid
 +
            | fwd tnaA KO
 +
            | rev  tnaA KO
 +
            |-
 +
            | '''4. '''
 +
            | WH Plasmid
 +
            | P1 (iGEM)
 +
            | P2 (iGEM)
 +
            |}
 +
 
 +
            Each of the four combinations was prepared 3 times => for Gradient PCR
 +
 
 +
           
 +
 
 +
            ===Phusion Polymerase PCR Assay===
 +
 
 +
            20µl Reaction
 +
            {| class="wikitable"
 +
            |-
 +
            !  !! Plasmid !! Primer !! Primer
 +
            |-
 +
            | 1. || iGEM Plasmid || P1 (iGEM) || P2 (iGEM)
 +
            |-
 +
            | 2. || WH Plasmid || fwd tnaA KO || rev  tnaA KO            POSITIVCONTROL
 +
            |-
 +
            | 3. || iGEM Plasmid || fwd tnaA KO || rev  tnaA KO
 +
            |-
 +
            | 4. || WH Plasmid || P1 (iGEM) || P2 (iGEM)
 +
            |-
 +
 
 +
            |}
 +
 
 +
 
 +
 
 +
            ===Q5 Polymerase PCR Assay===
 +
 
 +
            20µl Reaction
 +
            {| {{table}}
 +
            | align="center" style="background:#f0f0f0;"|'''5xQ5 Reaction Puffer (G2 runder Behälter)'''
 +
            | align="center" style="background:#f0f0f0;"|'''4µl'''
 +
            | align="center" style="background:#f0f0f0;"|'''1x'''
 +
            |-
 +
            | 10mM dNTPs ||0,4µl||200µM
 +
            |-
 +
            | 10µM forward Primer||1µl||0,5µM
 +
            |-
 +
            | 10µM reverse Primer||1µl||0,5µM
 +
            |-
 +
            | Template DNA||1µl||1pg-1ng sein
 +
            |-
 +
            | Q5 High Fidelity DNA Polymerase||0,2µl||0,02U/µl
 +
            |-
 +
            | GC enhancer||4 µl||
 +
            |-
 +
            | Nuclease-Free Water ||to 20µl||
 +
            |-
 +
            | ||||
 +
            |-
 +
            | ||8,4µl||
 +
            |-
 +
            |
 +
            |}
 +
 
 +
            ===FUR PCR Assay===
 +
 
 +
            (Along with the above mentioned PCR Assays another Gradient PCR with FUR-Primer is performed)
 +
 
 +
            Aliquot of the FUR Primer (100µM) 1:10 diluted =>10µM
 +
 
 +
            20µl Reaction with Phusion-Polymerase (see above)
 +
 
 +
            with WH Plasmid and P1 FUR & P2 FUR Primer
 +
 
 +
           
 +
 
 +
            ===Gradient PCR Program===
 +
 
 +
            Thermocycling Conditions for the Gradient PCR
 +
 
 +
            Programm-NAME: Q5 grad trp KO
 +
 
 +
            {| {{table}}
 +
            | align="center" style="background:#f0f0f0;"|'''Step'''
 +
            | align="center" style="background:#f0f0f0;"|'''TEMP'''
 +
            | align="center" style="background:#f0f0f0;"|'''TIME'''
 +
            |-
 +
            | Initial Denaturation||98°C||30 sec
 +
            |-
 +
            | 5 Cycles||98°C||8 sec
 +
            |-
 +
            | ||64±5°C||25 sec    GRADIENT
 +
            |-
 +
            | ||72°C||Trp ko: 1528bpà45s
 +
            |-
 +
            | 25 Cycles||98°C||8 sec
 +
            |-
 +
            | ||72°C||70 sec
 +
            |-
 +
            | Final Extension||72°C||2 min
 +
            |-
 +
            | Hold||8°C||
 +
            |-
 +
            |
 +
            |}
 +
 
 +
 
 +
            ===Gel-Electrophoresis===
 +
 
 +
            1% Agarose Gel
 +
 
 +
            5µl Sample +1µl loading dye (1:6)
 +
 
 +
            8µl diluted GeneRuler Mix ladder
 +
 
 +
            MODE: 90V 25min
 +
 
 +
           
 +
 
 +
            '''Sample label:'''
 +
 
 +
           
 +
 
 +
            P = with Phusion Polymerase
 +
 
 +
            Q = with Q5 Polymerase
 +
 
 +
            1 = 1. Kombination
 +
 
 +
            2 = 2. Kombination
 +
 
 +
            3 = 3. Kombination
 +
 
 +
            4 = 4. Kombination
 +
 
 +
           
 +
 
 +
            '''Gradient'''
 +
 
 +
            1 = 59°C
 +
 
 +
            4 = 63°C
 +
 
 +
            8 = 69°C
 +
 
 +
            {| {{table}}
 +
            | align="center" style="background:#f0f0f0;"|'''Gel 1 Phusion'''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            |-
 +
            | P FUR||P1||P1||P1||P2||P2||P2||Marker||P3||P3||P3||P4||P4||P4
 +
            |-
 +
            | ||||||||||||||||||||||||||
 +
            |-
 +
            | 8||1||4||8||1||4||8||||1||4||8||1||4||8
 +
            |-
 +
            | Gel 2 Q5||||||||||||||||||||||||||
 +
            |-
 +
            | ||Q1||Q1||Q1||Q2||Q2||Q2||Marker||Q3||Q3||Q3||Q4||Q4||Q4
 +
            |-
 +
            | ||||||||||||||||||||||||||
 +
            |-
 +
            | ||1||4||8||1||4||8||||1||4||8||1||4||8
 +
            |-
 +
            |
 +
            |}
 +
 
 +
 
 +
           
 +
 
 +
            ====Results====
 +
 
 +
 
 +
            {| {{table}}
 +
            | align="center" style="background:#f0f0f0;"|'''Gel 1 Phusion Result:'''
 +
            | align="center" style="background:#f0f0f0;"|'''For FUR-Primer no Amplifikation'''
 +
            |-
 +
            | ||
 +
            |-
 +
            | ||For iGEM-Plasmid no Amplifikation
 +
            |-
 +
            | ||
 +
            |-
 +
            | ||Combination 2 (WH Plasmid & Primer)= only non-specific amplification
 +
            |-
 +
            | ||
 +
            |-
 +
            | ||Combination 4 (WH Plasmid & iGEM Primer)=Bands for 59°C and 63°C + non-specific amplification
 +
            |-
 +
            | ||
 +
            |-
 +
            | ||
 +
            |-
 +
            | align="center" style="background:#f0f0f0;"|'''Gel 2 Q5 Result:'''||For iGEM-Plasmid no Amplifikation
 +
            |-
 +
            | ||
 +
            |-
 +
            | ||Combination 2  (WH Plasmid & Primer) = bands for all three annealing temperature observed+non-specific amplification
 +
            |-
 +
            | ||
 +
            |-
 +
            | ||Combination 4 (WH Plasmid & iGEM Primer)= Bands at all three annealing temperature+non-specific amplification
 +
            |-
 +
            |
 +
            |}
 +
            [[Datei:Sm033 fam.jpg|miniatur|zentriert]]
 +
            [[Datei:2014.04.28 Phusion KnR KO gradPCR.JPEG|miniatur|zentriert]] <br />
 +
            [[Datei:2014.28,04 Phusion gradPCR KnR KO.JPEG|miniatur|zentriert]]
 +
            <br />
 +
            iGEM Plasmid not to be used anymore.
 +
            FUR need to be checked again.
 +
            </div>
 +
 
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 04/29 Tuesday - Mini-Prep </h2>
 +
            (Aritra)<br />
 +
            [pKD46 + DH5α]→ 155ng/µl<br />
 +
            [pKD4 + DH5α]→ 302ng/µl<br />
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 05/02 Friday - Genomic DNA extraction from Psedomonas putida </h2>
 +
            (Johann)<br />
 +
 
 +
            -->see Protocol Wizard ® Genomic DNA Purification Kit
 +
            [[Datei:Wizard dna purification kit promega.png|miniatur|zentriert]]
 +
 
 +
                - Strain from VLB Martin Senz PHO Psedomonas putida KT2242  B_0712  from 29.04.2014 culture
 +
                - 2 days in 30°C  Shaking Incubator.
 +
                - Mikro 22R Centrifuge Hettich (16000g)
 +
 
 +
            Final DNA Concentration measured after purification = 95ng/µl
 +
            </div>
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 02.05.2014 - DNA Digestion to test Plasmids </h2>
 +
 
 +
            {| {{table}}
 +
            | align="center" style="background:#f0f0f0;"|'''Samples'''
 +
            | align="center" style="background:#f0f0f0;"|'''Conc. DNA (ng/µl)'''
 +
            | align="center" style="background:#f0f0f0;"|'''Enzymes used'''
 +
            | align="center" style="background:#f0f0f0;"|'''Expected band length'''
 +
            | align="center" style="background:#f0f0f0;"|'''Evaluation'''
 +
            |-
 +
            | pKD4||302||Xbal||1874,1393||Possible plasmid, failed
 +
            |-
 +
            | pKD46||40||EcoRI||4820,1509||Failed
 +
            |-
 +
            | pKD46||39||EcoRI||4820,1509||Failed
 +
            |-
 +
            | pKD4||60||Xbal||1874,1393||Possible(passed); whole plasmid
 +
            |-
 +
            | pSBAC3||88||SpeI/EcoRI||2047,22||Possible (passed); smallpattern
 +
            |-
 +
            | pSBAC3-D20-GFP||115||SpeI/EcoRI||2047,957||whole plasmid; failed
 +
            |-
 +
            | pSBAC3-D40-Bfr||86||SpeI/EcoRI||2047, 774||Whole plasmid; failed
 +
            |-
 +
            | pSBAC3-D40-GFP||80||SpeI/EcoRI||2047,1014||Whole plasmid; failed
 +
            |-
 +
            | pSBAC3-AB-Tyrosin||110||SpeI/EcoRI||2047,3319||Failed
 +
            |-
 +
            | pSBAC3-D40||164||SpeI/EcoRI||2047,267||Failed
 +
            |-
 +
            | pSBAC3-D40-GFP-ssr||106||SpeI/EcoRI||2047,1032||Passed; whole plasmid
 +
            |-
 +
            |
 +
            |}
 +
            ==Gel Electrophoresis==
 +
            '''Key:'''<br>
 +
            -band1: Ladder<br />
 +
            -band5:Ladder<br />
 +
            -residual bands, see table above
 +
            [[Datei:Sm033 fam.jpg|miniatur|zentriert]]
 +
            [[Datei:20140501 Restriktionsammar.JPEG|miniatur|zentriert]]
 +
            ===Results===
 +
 
 +
            pKD4 with 60(ng/µl) best candidate for PCR.
 +
            </div>
 +
 
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 05/05 Monday - Preculture of strains from Budisa strain database in LB Medium </h2>
 +
            (Johann)
 +
 
 +
            1. BU31 (pKD4) in 50 ml LB+Kanamycin+Ampicillin  37°C 220 rpm
 +
            2. BU32 (pKD46) in 50 ml LB+Ampicillin 30°C 240rpm
 +
            3. BU31 (pKD46) in LB plate+Ampicillin  30°C
 +
 
 +
            ==Midiprep==
 +
            (christina)
 +
 
 +
            Midiprep of BU31 (pKD4) and BU32 (pKD46) from strain Database.
 +
 
 +
            Concentration pKD4 = 104 ng/µl
 +
 
 +
            Concentartion pKD46 = 161 ng/µl
 +
            </div>
 +
 
 +
 
 +
 
 +
            <div class="sub-content-project">                         
 +
            <h2 class="sub-content-project-headline"> 05/06 Tuesday - Gel-Electrophoresis </h2>
 +
            (Aritra)
 +
            Kanamycin Cassette PCR (pKD4 from MidiPrep 05.05.2014 104ng/µl Christina)<br />
 +
 
 +
            '''Key:'''<br />
 +
            - 1st: Ladder<br />
 +
 
 +
            - 2nd and 3rd: Fief<br />
 +
 
 +
            - 4th: Negative control<br />
 +
            - 7th and 8th: FUR<br />
 +
            [[Datei:Sm033 fam.jpg|miniatur|zentriert]]
 +
            [[Datei:20140506 SN VW PCR Kan pKD4 FUR Fif.JPEG|miniatur|zentriert]]
 +
            ===Results===
 +
            FieF worked well; FUR no bands
 +
 
 +
           
 +
            ==Restriction digest of Plasmid pKD4 and pKD46==
 +
            {| {{table}}
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            | align="center" style="background:#f0f0f0;"|''''''
 +
            |-
 +
            | ||pKD4||pKD46
 +
            |-
 +
            | Plamid ||19.2µl||12.5µl
 +
            |-
 +
            | Digestion Enzym||Xbal 1µl||Xmal 1µl
 +
            |-
 +
            | nuclease free H2O||24.8µl||31.5µl
 +
            |-
 +
            | 10xFO green Buffer||5µl||5µl
 +
            |-
 +
            | Total||50µl||50µl
 +
            |-
 +
            |
 +
            |}
 +
              - Both the reaction mix incubated at 37°C for 1 hr.
 +
              - After that another 1 hr at RT.
 +
 
 +
 
 +
 
 +
 
 +
            ===Gel-Electrophoresis===
 +
            - 20µl of both the samples together with whole plasmids loaded on 1% Agarose Gel<br />
 +
            ====Results====
 +
            '''Key:'''<br />
 +
            -1st: pKD4 (XbaI digested)<br />
 +
            -2nd: pKD4 (undigested)<br />
 +
            - 3rd: Ladder<br />
 +
            - 4th: pKD46 (undigested)<br />
 +
            -5th: pKD46 (XmaI digested)<br />
 +
 
 +
 
 +
            <gallery>
 +
            Datei:06.05.2014 dig pKD4 , pKD46.JPEG|
 +
            </gallery>
 +
 
 +
 
 +
            ===Gel Extraction===
 +
            -Used GeneJet GelExtraction Kit by Thermo Scientific
 +
            [[Datei:140605 DNA conc.jpg|miniatur|zentriert]]
 +
            ====Results====
 +
            DNA Concentration: 16ng/µl
 +
            </div>
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 05/16 Friday - Biotransformation of Ferritin and pKD46 in Nissle and DH5-α strain </h2>
 +
            concentration Ferritin 120ng/µl<br>
 +
            concentration pKD 46 95 ng/µl
 +
 
 +
            Protocol
 +
            *electro competent cells of DH5α and Nissle were thawed on ice
 +
            *0.4µl of Ferritin and 0.53 µl of pKD46 was added to the cells
 +
            *cells with DNA were transferred to cuvettes for electroporation, then 950ml (LB-medium) was added to the cells immediately
 +
            *incubation at 37°C for ferritin, 30°C for pKd46 for 1 h with shaking
 +
            *the cells were plated on Amp plates for pKD46 and CM for Ferritin
 +
            *Transformation did not work.
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 05/21 Wednesday - PCR Gel-Extraction of FieF </h2>
 +
            (Christina)<br />
 +
 
 +
            1% Agarosegel + 0,5µl EtBr<br />
 +
            45µl Sample+9µl Loading Dye<br />
 +
            8µl Ladder<br />
 +
            --> Gel-Extraction Kit used with 50µl nuclease-free water for elution<br />
 +
            [[Datei:140521 DNA conc.jpg|miniatur|zentriert]]
 +
            ==Gene Knockout of FieF==
 +
            (Salah)
 +
            ===Preparation of the preculture===
 +
            '''Used Precultures:'''<br />
 +
            - RV +pKD46<br />
 +
            - WM10 +pKD46<br />
 +
            The precultures was diluted to OD<sub>600</sub>=0,1 and then incubated for 2h at 30°C until they reach OD<sub>600</sub>=0,6<br />
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! Title !! Wavelength !! Absorbance
 +
            |-
 +
            | Reference || 600nm || 0,000A
 +
            |-
 +
            | RV+pKD46 || 600nm || 0,066A
 +
            |-
 +
            | WM10+pKD46 || 600nm || 0,050A
 +
            |}
 +
            (The culture was diluted 1/10 for the OD measurement)<br />
 +
            →The precultures are ready for the Rekombinase induction with Arabinose
 +
            ===Induction with Arabinose===
 +
            The cultures have been induced with 500µl arabinose (1M)
 +
            →After the induction, the cultures have to be incubated for further 30min at 30°C
 +
            {| class="wikitable"
 +
            |-
 +
            ! Title !! Wavelength !! Absorbance
 +
            |-
 +
            | Reference || 600nm || 0,000A
 +
            |-
 +
            | RV+pKD46 || 600nm || 0,084A
 +
            |-
 +
            | WM10+pKD46 || 600nm || 0,067A
 +
            |}
 +
            →From now on the cultures need to be cooled on ice
 +
            ===Preparation for the Electroporation===
 +
 
 +
            ===Electroporation===
 +
            '''Electroporation-Program: Ec1'''<br />
 +
            -Amount of DNA sample: 75-150ng<br />
 +
            {| class="wikitable"
 +
            |-
 +
            ! Sample !! Conc !! Used Volume !! Strain !! Electroporation Time
 +
            |-
 +
            | FieF1 || 42ng/µl || 2µl (84ng) || RV || 4,4ms
 +
            |-
 +
            | FieF2 || 9ng/µl || 10µl (90ng) || RV || 4,1ms
 +
            |-
 +
            | FieF1 || 42ng/µl || 2µl (84ng) || WM10 || 4,3ms
 +
            |-
 +
            | FieF2 || 9ng/µl || 10µl (90ng) || WM10 || 4,8ms
 +
            |}
 +
            After the transformation, the cultures was immediately prepared with 950µl SOC and incubated for 60min at 30°C without antibiotics --> recovery
 +
            ===Selection-cultures===
 +
            The selection of positive clones is done by using LB plates with kan+amp<br />
 +
            Incubation: 30°C o/n
 +
            </div>
 +
 
 +
 
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 05/22 Thursday - Transformation of pKD46 </h2>
 +
            (Salah)
 +
            ===Preparation of the preculture===
 +
            '''Used Precultures:'''<br />
 +
            - MG1655<br />
 +
            - Nissle<br />
 +
            The precultures was diluted to OD<sub>600</sub>=0,1 and then incubated for 2h at 30°C until they reach OD<sub>600</sub>=0,6<br />
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! Title !! Wavelength !! Absorbance
 +
            |-
 +
            | Reference || 600nm || 0,000A
 +
            |-
 +
            | MG1655 || 600nm || 0,062A
 +
            |-
 +
            | NIssle || 600nm || 0,054A
 +
            |}
 +
            (The culture was diluted 1/10 for the OD measurement)<br />
 +
 
 +
            →From now on the cultures need to be cooled on ice
 +
            ===Preparation for the Electroporation===
 +
 
 +
            ===Electroporation===
 +
            '''Electroporation-Program: Ec1'''<br />
 +
            -Amount of DNA sample: 75-150ng<br />
 +
            {| class="wikitable"
 +
            |-
 +
            ! Sample !! Conc !! Used Volume !! Strain !! Electroporation Time
 +
            |-
 +
            | MG1655 1 || 42ng/µl || 2µl (84ng) || RV || 5,4ms
 +
            |-
 +
            | MG1655 2 || 9ng/µl || 10µl (90ng) || RV || 5,8ms
 +
            |-
 +
            | Nissle 1 || 42ng/µl || 2µl (84ng) || WM10 || 0,7ms (thrown away)
 +
            |-
 +
            | Nissle 2 || 9ng/µl || 10µl (90ng) || WM10 || 5,8ms
 +
            |}
 +
            After the transformation, the cultures was immediately prepared with 950µl SOC and incubated for 60min at 30°C without antibiotics --> recovery
 +
            ===Selection-cultures===
 +
            The selection of positive clones is done by using LB plates with amp<br />
 +
            Incubation: 30°C o/n
 +
 
 +
            == PCR of ATPCS and PPMT ==
 +
            {| class="wikitable"
 +
            |-
 +
            ! Mastermix !! ATPCS !! PPMT
 +
            |-
 +
            | nuc.free water|| 18.9 || 17.5
 +
            |-
 +
            | 2x Fusion Mastermix || 25 || 25
 +
            |-
 +
            | Fw Primar || 2.5 || 2.5
 +
            |-
 +
            | Rw Primar || 2.5|| 2.5
 +
            |-
 +
            | template DNA || 1.1 || 2.5
 +
            |}
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! ATPCS !! Programm
 +
            |-
 +
            | 98°C || 10
 +
            |-
 +
            | 98°C|| 5 30 cycles
 +
            |-
 +
            | 62°C|| 5 30 cycles
 +
            |-
 +
            | 72°C || 5  30 cycles
 +
            |-
 +
            | 72°C||  60 secs
 +
            |-
 +
            | 8°C|| store
 +
            |}
 +
            {| class="wikitable"
 +
            |-
 +
            ! PPMT!! Programm
 +
            |-
 +
            | 98°C || 10
 +
            |-
 +
            | 98°C|| 5 30 cycles
 +
            |-
 +
            | 63,1°C|| 5  30 cycles
 +
            |-
 +
            | 72°C || 21  30 cycles
 +
            |-
 +
            | 72°C||  60 secs
 +
            |-
 +
            | 8°C|| store
 +
            |}
 +
 
 +
            ATPCS 1469 bp; PPMT 234 bp
 +
            --> wrong Programm
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 05/23 Friday - Digestion of Vector for Cloning </h2>
 +
            Plasmid: pQE80L<br />
 +
 
 +
            Old Plasmid of Johann: <br />
 +
            -P1≈1000ng
 +
            -P3≈400ng
 +
 
 +
            {| class="wikitable"
 +
            |-
 +
            ! P3 !! !! P1 !!
 +
            |-
 +
            | SacI || 1µl || SacI || 1µl
 +
            |-
 +
            | HindIII || 1µl || BamHI || 1µl
 +
            |-
 +
            | Buffer || 2µl || Buffer || 2µl
 +
            |-
 +
            | Plasmid 1 || 4µl || Plasmid 3 || 16µl
 +
            |-
 +
            | nuc.water || 12µl || nuc. water || 0µl
 +
            |}
 +
            --> Incubation: 1,5h at 37°C<br />
 +
            --> Deactivation: 20min at 80°C
 +
            </div>
 +
 
 +
 
 +
            <div class="sub-content-project">
 +
            <h2 class="sub-content-project-headline"> 05/27 Tuesday - Production of LB Plates </h2>
 +
            (Salah and Christina)
 +
 
 +
            LB Agar Plates prepared:
 +
 
 +
            4x with Ampicillin  (25µl in 25ml)
 +
 
 +
            4x with Ampicillin+ Kanamycin  (25µl+25µl in 25ml)
 +
 
 +
            4x Cm (25µl in 25ml)
 +
            </div>                   
     </div>
     </div>
 +
 +
   </div>     
   </div>     
</div>
</div>

Revision as of 22:32, 14 October 2014

1

What is it all about?

  As previous iGEM teams have shown, synthesizing fully functional magnetosomes in E. coli is highly difficult as more than 60 highly regulated genes are involved. As a more feasible alternative, we simply want to synthesize magnetic nanoparticles in E. coli in order to attract cells with strong magnetic fields.
Therefore we want to use different strategies including manipulation of the iron homeostasis of E. coli, expression of different metal binding proteins such as ferritins and metallothioneins as well as a high-throughput growth medium optimization.

Furthermore, we will work with other metal binding proteins such as metallothioneins and phytochelatin synthases in order to achieve nanoparticle synthesis. Once we have discovered the best way to magnetize E. coli bacteria, we will build and characterize suitable BioBricks that can be used by any research lab or iGEM team in the world in order to remote control the cellular movement.

2

Visualisation

  Animation, jo!

3

Detailes Description

  MORE DETAILS, jo!

4

Flow Chart

 

5

The Results

  Results, jo!

6

Lab Summary

 

Week 1: 02.04.2014 – 06.04.2014

Cultivation of E. coli Nissle 1917
Genomic DNA extraction of E.coli Nissle strain
Production of BfR, FTNA1 and FTNA2
Restriction digest
PCR Purification
Ligation Assay
Transformation into DH5α-Cells

Week 2: 07.04.2014 – 13.04.2014

Colony PCR to check the results
Bfr, FTNA 1, FTNA 2 primar designed for amplification
Transformation of pQE_80L into DH5α
Cultivation of BfR, FTNA 1, FTNA 2 in LB

Week 3: 14.04.2014 – 20.04.2014

Miniprep of the cells from Week 2
DNA concentration determination and sequencing
Expression of BfR, FTNA 1, FTNA 2 and induction with IPTG
Production of a Mutaflor-Supression culture and streaking

Week 4: 21.04.2014 – 27. 04.2014

Minirep

Week 5: 28.04.2014 – 04.05.2014

PCR Plasmid/Primar and Parameter check with Q5 Polymerase and Phusion Polymerase
Miniprep of [pKD46+ DH5α] and [pKD4 + DH5 α]
Genomic DNA extraction from Pseudomonas putida
Enzyme digestion of different plasmids

Week 6: 05.05.2014 – 11.05.2014

Preculture of strains from Budisa strain databse in LB medium and Midiprep
Canamycin cassette PCR of pKD4
Restriction digest of Plasmid pKD4 and pKD46v

Week 7: 12.05.2014 – 18.05.2014

Biotransformation of Ferritin and pKD46 in Nissle and DH5 α strains

Week 8: 19.05.2014 – 25.05.2014

Gel extraction of FieF PCR
Gene Knockout of FieF in [RV + pKD46] and [WM10+pKD46]
Transformation of pKD46 in Nissle and MG 1655
PCR of ATPCS and PPMT
Digestion of pQE_80L for cloning

Week 9: 26.05.2014 – 01.06.2014

Production of LB plates
AMB-1 and Microfluidic Chip were picked up from Max-Plank Institute

Week 10: 02.06.2014 – 08.06.2014

Colony PCR and analytical gel electrophoresis for identifying the right clones
PCR of ATPCS and PPMT to identify the correct amplification parameter.
Colony PCR for Knockout.
PCR of ATPCS and PPMT with Q5 High Fidelity Mastermix.

Week 11: 09.06.2014 – 15.06.2014

Refine the PCR of PPMT and ATPCS with DMSO

Week 12: 16.06.2014 – 22.06.2014

PCR amplification of ATPCS from cDNA
Colony PCR to seperate cells with FieF Knockout
Restrcition digest of pQE_80L and ATPCS-PCR Fragment
Test expression of Ferritin in RV308 (pSB1C3_Ferritin) and Nissle (pSB1C3_Ferritin)

Week 13: 23.06.2014 – 29.06.2014

Amplification of ATPCS from cDNA and PCR Purification
Preparation of Nissle, Nissle + Ferritin, RV 308, Rv 308 + Ferritin pre-cultures
Transformation of human Ferritin on PC514 to Nissle and RV 308
Induction of Ferritin expression with IPTG

Week 14: 30.06.2014 – 06.07.2014

Colony PCR and Ligation of ATPCS
Knockout of FieF and FUR in RV308 and Nissle
Transformation of RFP device and Ferritin in RV308, Nissle and WM110 strains.
PCR amplification of knockout cassette FUR/FieF
Expression of RV308 (RFP) and RV308 (RFP + Ferritin) after Induction with IPTG

Week 15: 07.07.2014 – 13.07.2014

Preparation of cryostocks and pre-cultures of ATPCS clone 1-10, WM 110, RV 308, Nissle
PCR of PPMT with goTaq Polymerase
Miniprep of ATPCS clone number 3

Week 16: 14.07.2014-20.07.2014

Midiprep of pQE_80L , PMA-T_PPMT, pKD46
Digestion of pQE_80L with Hind III and SacI

Week 17: 21.07.2014-27.07.2014

Miniprep and Restriction of pBADex-mYFP Venus (Amp); pEx-HisII (Amp); pJS418_Phagemid (dummy) (Cm)
Ligation of PPMT Fragment from pMAC_PPMT into pEX_HisII

Week 18: 28.07.2014-3.08.2014

Degradation test of prepped TB-Expression Plasmids
Transformation of pEX_His_PPMT in MG1655, DH5α, DH10B strains
Colony PCR of the PPMT clones
Miniprep and Sequencing of pEX_His_PPMT in DH5 α
Ligation of ATPCS PCR Fragment into pQE_80 L
Colony PCR of pQE_80L_ATPCS

Week 19: 04.08.2014 -10.08.2014

Preculture of ATPCS clones for Sequencing
PCR of BamHI_PPMT_GS, GS_ATPCS_HindIII, BamHi_HuFerritin_HindIII
Transformation of BFR M52H in DH10B.

Week 20: 11.08.2014 - 17.08.2014

Prepare chemically competent cells
Generation of Heme-free BFR by Site-directed Mutagenesis
Digestion of various PCR fragements for cloning into pQE_80L
Colony PCR of pQE_80L
Clone Sequencing

Week 21: 18.08.2014 – 24.08.2014

SDS-PAGE with Coomasie staining for identification of protein expression

Week 22: 25.08.2014 – 31.08.2014

Calibration curve for iron concentration measurement

Week 23: 15.09.2014 – 21.09.2014

Preparing cultures for fluorescence microscopy
Constructing pQE_80L_T5_ATPCS_lac_PPMT
Digest and Dephosphorylation of vector pQE_80L_ATPCS
PCR of Biobrick parts (BB0-BB3)
Digest of pSB1C3-Ferritin

Week 24: 22.09.2014 – 28.09.2014

Preparation of pre-cultures
Checking insertion of gene in ATPCS_PPMT clones by colony PCR
Digestion of miniprepped pSB1C3_Ferritin (Calgary) for extraction of vector for Biobrick preparation
Mutagenesis of ATPCS in different plasmid_ATPCS construct
Berlin Vector – pQE-80L-JBFS- huFerritin Assembly PCR
Isolation of plasmid DNA of pQE80L_ATPCSMut_GS_PPMT and pQE80L_ATPCS_PPMT
Repeat PCR of Biobricks

Week 25: 29.09.2014 – 05.10.2014

Digestion of Biobrick parts
Ligation of Biobrick parts with pSB1C3 backbone
Plasmid Digestion and checked with PCR

Week 25 06.10.2014 – 12.10.2014

Colony PCR
Miniprep of cultures and preparation of sequencing samples
Preculture of knockouts
PCR of pSB1C3 backbone
Extraction of PCR Product (pSB1C3 linearised)
Iron concentration measurement in knockout strains
7

Notebook

 

04/02 Wednesday - Cultivating E. coli Nissle 1917

LB plates were produced without antibiotic. Therefore 10 ml MQ-H2O were sterile filtered in 15 ml falcon tube. 1 capsule Mutaflor 331800 was solved in the sterile water. The E. coli Nissle solution was incubated at 37°C and 200 rpm for 1 h and crossed out at 4 plates to get different dilution of cells.

04/03 Thursday - Genomic DNA extraction of ECN - first step

For extraction of the genomic DNA of E. coli Nissle, 2 E. coli colonies were oicked from LB plate (dilution 1:103) and used for inocculation of 6 ml LB precultures. These were grown over night at 37°C and 200 rpm.

04/04 Friday - Genomic DNA extraction of ECN - second step

For preperation of the genomic DNA 1 ml of each preculture was taken and a genomic extraction performed using the Wizard Genomic DNA purification Kit. See instructions of the purification Kit by Promega. Genomic DNA was stored at 12°C in fridge. As E. coli Nissle is a natural organism without resistence genes both precultures were streaked out on LB, LB+KAN and LB+AMP. All plates were incuvated over the weekend at 37°C. DNA concentration was meassured by 260 nm using Goldi. DNA was diluted 1:40 in a UV cuvette and DNA absorption meassured at 260/28 nm in goldi. '''For genomic DNA:''' {| class="wikitable" |- | 1: || 1390 ng/µl |- | 2: || 988 ng/µl |} [[Datei:Wizard_dna_purification_kit_promega.png]]

04/05 Saturday - Genomic DNA extraction of ECN - results

Bacteria growth only on LB plate indicates that there was no contamination with AMP or KAN restinatant E. coli. This doesn´t mean that there is no contamination at all. See for sure on PCR. {| class="wikitable" |- ! LB !! LB+KAN !! LB+AMP |- | + || - || - |}

04/06 Sunday

==Production of BfR, FTNA1 and FTNA2== ===Restriction digest=== After 2 purifications of plasmids: {| class="wikitable" |- | p1 || 84ng/µl || 10µl |- | p2 || 72,2ng/µl || 10µl |- | p3 || 54,8ng/µl || 23µl |} ====Restriction program==== {| class="wikitable" |- | || 1x || 4x |- | plasmid P2 || 3µl || 12µl |- | BamHI (FD) || 1µl || 4µl |- | HindIII (FD) || 1µl || 4µl |- | Buffer (FD) || 2µl || 8µl |- | H2O || 13µl || 52µl |} --> 37°C for 1h (restriction) --> 80°C for 10min (deactivation) {| class="wikitable" |- | PCR || 6,38µl || 4,56µl || 2,71µl |- | BamHI (FD) || 1µl || 1µl || 1µl |- | HindIII (FD) || 1µl || 1µl || 1µl |- | Buffer (FD) || 2µl || 2µl || 2µl |- | H2O || 19,62µl || 21,44µl || 23,29µl |} --> 37°C for 1h (restriction) --> 80°C for 10min (deactivation) {| class="wikitable" |- | Plasmid || 1 || 2 || 3 |- | P || 10µl || 10µl || 18µl |- | BamHI (FD) || 1µl || 1µl || 1µl |- | HindIII (FD) || 1µl || 1µl || 1µl |- | Buffer (FD) || 2µl || 2µl || 3µl |- | nuc.free H2O || 6µl || 6µl || 7µl |} --> 37°C for 1h (restriction) --> 80°C for 10min (deactivation) ===PCR Purification (without isopropanol)=== Elution buffer 20µl; 1min incubated {| class="wikitable" |- | plasmid P1-3 || 45,3ng/µl |- | BfR || 12,9ng/µl |- | FTNA1 || 34,4 ng/µl |- | FTNA2 || 29,9ng/µl |} ===Ligation Assay=== {| class="wikitable" |- ! - !! Control !! BFR !! BFR !! BFR !! FTNA1 !! FTNA1 !! FTNA1 !! FTNA2 !! FTNA2 !! FTNA2 !! BFR_E !! BFR_E !! BFR_E |- | Dilution || - || 1x || 3x || 5x||1x|| 3x || 5x||1x || 3x || 5x ||1x || 3x || 5x |- | Vector DNA || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 || 1,1 |- | Insert DNA || 0 || 0,4 || 1,6 || 2,0 || 0,10 || 0,47 || 0,79 || 0,18 || 0,52 || 0,90 || 0,40 || 1,16 || 2,0 |- | Buffer || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 || 1 |- | T4 DNA-Ligase || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 || 0,25 |- | H2O || 7,65 || 7,25 || 6,5 || 5,65 || 7,5 || 7,20 || 6,85 || 7,50 || 7,20 || 6,85 || 7,25 || 6,50 || 5,65 |- |} ===Transformation=== --> Transformation of 5µl Sample into DH5α-Cells --> Incubation o/n at 37°C after streating out on LB+amp plates using sterile beads {| class="wikitable" |- ! BFR !! FTNA1 !! FTNA2 |- | 5,2ng || 5,51ng || 5,43ng |- | 15,6ng || 16,5ng || 16,27ng |- | 26,0ng || 27,4ng || 27,13ng |}

04/07 Monday - Cloning Results

{| class="wikitable" |- ! Sample !! CFU |- | Control || 13 |- | tBFR 1 || 121 |- | tBFR 3 || 38 |- | tBFR 5 || 664 |- | BFR 1 || 87 |- | BFR 3 || 151 |- | BFR 5 || 150 |- | FTNA1 1 || 65 |- | FTNA1 3 || 131 |- | FTNA1 6 || 191 |- | FTNA2 1 || 84 |- | FTNA2 3 || 114 |- | FTNA2 5 || 151 |} --> picked 5 colos per construct for coloPCR (50µl TE-buffer; 96°C; 10min) --> rescue plate '''colPCR Programm''' {| class="wikitable" |- ! - !! 1x !! Mastermix 23x |- | nuc.free H2O || 13,7µl || 315,1µl |- | 10x Dream Taq Buffer || 2µl || 46µl |- | 25mM MgCl2 || 1,2µl || 27,6µl |- | 10mM dNTPs || 0,5µl || 11,5µl |- | Primer T5 prom (PB16) || 0,5µl || 11,5µl |- | Primer T5 term (PB17) || 0,5µl || 11,5µl |- | |- | boiled colos || 1µl + 18,4ml Mastermix |- | Taq Polymerase || 0,5µl |} {| class="wikitable" |- ! Temperature !! Time |- | 95°C || 3' |- |30 cycles |- | 95°C || 30'' |- | 55°C || 30'' |- | 72°C || 1' |- | |- | 72°C || 10' |- | 12°C || hold |}

04/08 Tuesday - Amplification of ferritin genes

Primer designed for amplification: '''primer Bfr:''' FW: 5' GC G| G A T C C AAAGGTGATACTAAAGTTATAAATTATCTC(GC 23,33% Tm = 57,5) 3' OK RW: 5' GC A| A G C T T TCAACCTTCTTCGCG(GC 50% Tm = 58,5) 3' OK '''primer FtnA1:''' FW: 5' GC G| G A T C C GCAACCGCTGGAATG(GC 60% Tm = 60,5) 3' OK RW: 5' GC A| A G C T T TCAATGCAGCTGATGC(GC 50,0% Tm = 58,5) 3' OK '''primer FtnA2:''' FW: 5' GC G| G A T C C CTGAAACCAGAAATGATTG(GC 36,8% Tm = 65,1) 3' OK RW: 5' GC A| A G C T T TTAGTTTTGTGTGTCGAGG(GC 42,1% Tm = 56,8) 3' OK Using the Thermoscientific PCR mastermix phusion polymerase, 2x 50 µl reactions per amplification: {| class="wikitable" |- | Nuc-free H2O || 39,5 µl |- | 2x mastermix || 50,0 µl |- | FW primer || 5,0 µl |- | RW primer || 5,0 µl |- | template DNA || 0,5 µl |} '''PCR programs:''' {| class="wikitable" |- | || 98°C || 10s || 1x |- | || 98°C || 5s || 30x |- |primer|| Bfr/ FtnA1/ FtnA2 || 60,5°C/ 58,9°C/ 56,1°C || 30x |- | || 72°C || 10s || 30x |- | 72°C || 60s || Beispiel || 1x |} == '''Transformation of pQE_80L into DH5alpha''' == Plasmid from plasmid database of TU workgroup by Prof. Budisa was taken: plasmid ID: 4; concentration = 308 ng/µl Unthaw 50 µl aliquot of DH5alpha or BL21 DE3 gold on ice for 10 min.Than Use 308 ng and 616 ng of plasmids to bind on Ca2+-surface of the cell membranes. Heat shock was performed for 30-90 s. The cells were incubated on ice for 2 min and than there was added 950 µl LB media. The cells were incubated at 37°C for 60 min. After this 70 µl of transformed E. coli suspension was streacked out onto a plate with the appropriate selection marker. The plate was incubated over night at 37°C. To prepare preculture 2 colonies were picked and added into 5 ml LB media + 5 µl AMP. The precultures were incubated over night at 37°C and 200 rpm.

04/10 Thursday - Expression of Ferritin in LB

→Innoculate 20ml LB + amp with 1ml of a preculture
{| |- ! Title !! No. !! Wavelength !! Absobance !! Volume |- | BfR || 1 || 600nm || 0,529A || 1,51ml |- | FTNA1|| 2 || 600nm || 0,307A || 3,25ml |- | FTNA2 || 3 || 600nm || 0,605A || 1,32ml |} →Incubation for 2h until OD600=0,6-08
{| |- ! Title !! No. !! Wavelength !! Absobance |- | BfR || 1 || 600nm || 0,825A |- | FTNA1|| 2 || 600nm || 0,883A |- | FTNA2 || 3 || 600nm || 0,859A |} → Take SDS Sample non-induced
→Induce with 20µl IPTG
→Add Fe2+
→Expression: 4h at 22°C
Cultivation was aborted because of heat development
.

04/14 Monday - Miniprep

Miniprep of the cell-seperation streak out of the cloning procedure from december 2013
'''Miniprep-Kit of ThermoScientific'''
{| class="wikitable" |- ! - !! Title !! Concentration in ng/µl |- | A4 || BfR || 66 |- | B3 || FTNA1 || 138 |- | C5 || FTNA2 || 88 |- | D2 || BfR_Electro || 144 |} =='''DNA Concentration Determination'''== {| |- | Dilution Factor || 20 |- | Integration Time || 1s |- | Factor || 50 |- | Units || µg/ml |} {| class="wikitable" |- ! - !! Title !! No. !! 260nm !! 280nm !! 320nm !! Ratio !! Conc. |- | A4 || BfR || 1 || 0,056 || -0,022|| -0,010 || 2,05 || 66 |- | B3 || FTNA1 || 2 || 0,135 || 0,067 || -0,003 || 1,96 || 138 |- | C5 || FTNA2 || 3 || 0,078 || 0,035|| -0,008 || 2,00 || 86 |- | D2 || BfR-Electro || 4 || 0,150 || 0,078 || 0,006 || 2,02 || 144 |}

04/16 Wednesday - Sequencing

Preparation of the sequencing for the Samples from 16.01.2013 {| |- | T5 prom. Primer || 3µl |- | Plasmid || 12µl |} {| |- | A4 || 6µl |- | B3 || 6µl |- | C5 || 6µl |- | D2 || 6µl |}

04/17 Thursday - Expression of BfR and FTNA1/2

4x sterile 250ml Erlenmeyer
+50ml LB
+50µl amp
+2,5ml preculture
Incubation: 1h at 30°C {| class="wikitable" |- ! No. !! Title !! Wavelength !! Absorbance |- | 1 || BfR || 600nm || 0,909A |- | 2 || FTNA1 || 600nm || 0,980A |- | 3 || FTNA2 || 600nm || 0,930A |- | 4 || BfR+20?? || 600nm || 0,970A |} →Take SDS-Sample
→Induction with 50µl IPTG
→Addition of 0,0525g Fe-citrate (20mM dissolved in 1ml sterile Water)
→Incubation for 3h at 30°C
→continue incubation o/n
→Centrifuge with 6800g for 5min

04/18 Friday - Production of LB-Plates

===Production of a Mutaflor-Supression-culture=== →10ml sterile LB
→Add the content of a Mutaflor capsula (white pouder)
Incubation: 37°C at 220rpm
===Production of Dilutions of the Supression-culture and out streaking=== →1µl of the supression-culture to 999µl LB (1:1000)
→100µl of that dilution to 900µl LB (1:104)
→10µl of that dilution to 990µl LB (1:105)
→Streak out 50µl of each culture on LB with sterile beads
Incubation: 37°C

04/24 Thursday - Mini-Prep

(Ammar Al-Shameri) {| class="wikitable" |- | 1 || PSB || D40 || 9fP || CR/LB |- | 2 || PSB || D20 || 9fP || CR/LB |- | 3 || PSB || D40 || fs || LB/CR |- | 4 || PSB || D40 || LB/CR |- | 5 || PSB || AB || Turyu || CR/LB |- | 6 || PSB || D48 || 9fP || CB/CR |}

04/28 Monday -PCR Plasmid/ Primer and Parameter Check

(Salah and Christina)
Check of:
-Plasmids/Primer
-Annealing temperature
-Phusion and Q5 Polymerase ===Plasmids=== iGEM Plasmid pkD4 (Stock 200ng/µl) =>1:200 diluted = 1ng/µl WH (Willi Hauke) Plasmid pkD4 (0,72ng/µl) ===Primer=== P1 FieF (iGEM) fwd tnaA KO (WH) P2 FieF (iGEM) rev tnaA KO (WH) ===Combinations=== (4 combinations with Phusion; 4 combinations with Q5 ) {| border="2" | | '''Plasmid''' | '''Primer''' | '''Primer''' |- | '''1. ''' | iGEM Plasmid | P1 (iGEM) | P2 (iGEM) |- | '''2. ''' | WH Plasmid | fwd tnaA KO | rev tnaA KO '''POSITIVCONTROL''' |- | '''3. ''' | iGEM Plasmid | fwd tnaA KO | rev tnaA KO |- | '''4. ''' | WH Plasmid | P1 (iGEM) | P2 (iGEM) |} Each of the four combinations was prepared 3 times => for Gradient PCR ===Phusion Polymerase PCR Assay=== 20µl Reaction {| class="wikitable" |- ! !! Plasmid !! Primer !! Primer |- | 1. || iGEM Plasmid || P1 (iGEM) || P2 (iGEM) |- | 2. || WH Plasmid || fwd tnaA KO || rev tnaA KO POSITIVCONTROL |- | 3. || iGEM Plasmid || fwd tnaA KO || rev tnaA KO |- | 4. || WH Plasmid || P1 (iGEM) || P2 (iGEM) |- |} ===Q5 Polymerase PCR Assay=== 20µl Reaction {| {{table}} | align="center" style="background:#f0f0f0;"|'''5xQ5 Reaction Puffer (G2 runder Behälter)''' | align="center" style="background:#f0f0f0;"|'''4µl''' | align="center" style="background:#f0f0f0;"|'''1x''' |- | 10mM dNTPs ||0,4µl||200µM |- | 10µM forward Primer||1µl||0,5µM |- | 10µM reverse Primer||1µl||0,5µM |- | Template DNA||1µl||1pg-1ng sein |- | Q5 High Fidelity DNA Polymerase||0,2µl||0,02U/µl |- | GC enhancer||4 µl|| |- | Nuclease-Free Water ||to 20µl|| |- | |||| |- | ||8,4µl|| |- | |} ===FUR PCR Assay=== (Along with the above mentioned PCR Assays another Gradient PCR with FUR-Primer is performed) Aliquot of the FUR Primer (100µM) 1:10 diluted =>10µM 20µl Reaction with Phusion-Polymerase (see above) with WH Plasmid and P1 FUR & P2 FUR Primer ===Gradient PCR Program=== Thermocycling Conditions for the Gradient PCR Programm-NAME: Q5 grad trp KO {| {{table}} | align="center" style="background:#f0f0f0;"|'''Step''' | align="center" style="background:#f0f0f0;"|'''TEMP''' | align="center" style="background:#f0f0f0;"|'''TIME''' |- | Initial Denaturation||98°C||30 sec |- | 5 Cycles||98°C||8 sec |- | ||64±5°C||25 sec GRADIENT |- | ||72°C||Trp ko: 1528bpà45s |- | 25 Cycles||98°C||8 sec |- | ||72°C||70 sec |- | Final Extension||72°C||2 min |- | Hold||8°C|| |- | |} ===Gel-Electrophoresis=== 1% Agarose Gel 5µl Sample +1µl loading dye (1:6) 8µl diluted GeneRuler Mix ladder MODE: 90V 25min '''Sample label:''' P = with Phusion Polymerase Q = with Q5 Polymerase 1 = 1. Kombination 2 = 2. Kombination 3 = 3. Kombination 4 = 4. Kombination '''Gradient''' 1 = 59°C 4 = 63°C 8 = 69°C {| {{table}} | align="center" style="background:#f0f0f0;"|'''Gel 1 Phusion''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | P FUR||P1||P1||P1||P2||P2||P2||Marker||P3||P3||P3||P4||P4||P4 |- | |||||||||||||||||||||||||| |- | 8||1||4||8||1||4||8||||1||4||8||1||4||8 |- | Gel 2 Q5|||||||||||||||||||||||||| |- | ||Q1||Q1||Q1||Q2||Q2||Q2||Marker||Q3||Q3||Q3||Q4||Q4||Q4 |- | |||||||||||||||||||||||||| |- | ||1||4||8||1||4||8||||1||4||8||1||4||8 |- | |} ====Results==== {| {{table}} | align="center" style="background:#f0f0f0;"|'''Gel 1 Phusion Result:''' | align="center" style="background:#f0f0f0;"|'''For FUR-Primer no Amplifikation''' |- | || |- | ||For iGEM-Plasmid no Amplifikation |- | || |- | ||Combination 2 (WH Plasmid & Primer)= only non-specific amplification |- | || |- | ||Combination 4 (WH Plasmid & iGEM Primer)=Bands for 59°C and 63°C + non-specific amplification |- | || |- | || |- | align="center" style="background:#f0f0f0;"|'''Gel 2 Q5 Result:'''||For iGEM-Plasmid no Amplifikation |- | || |- | ||Combination 2 (WH Plasmid & Primer) = bands for all three annealing temperature observed+non-specific amplification |- | || |- | ||Combination 4 (WH Plasmid & iGEM Primer)= Bands at all three annealing temperature+non-specific amplification |- | |} [[Datei:Sm033 fam.jpg|miniatur|zentriert]] [[Datei:2014.04.28 Phusion KnR KO gradPCR.JPEG|miniatur|zentriert]]
[[Datei:2014.28,04 Phusion gradPCR KnR KO.JPEG|miniatur|zentriert]]
iGEM Plasmid not to be used anymore. FUR need to be checked again.

04/29 Tuesday - Mini-Prep

(Aritra)
[pKD46 + DH5α]→ 155ng/µl
[pKD4 + DH5α]→ 302ng/µl

05/02 Friday - Genomic DNA extraction from Psedomonas putida

(Johann)
-->see Protocol Wizard ® Genomic DNA Purification Kit [[Datei:Wizard dna purification kit promega.png|miniatur|zentriert]] - Strain from VLB Martin Senz PHO Psedomonas putida KT2242 B_0712 from 29.04.2014 culture - 2 days in 30°C Shaking Incubator. - Mikro 22R Centrifuge Hettich (16000g) Final DNA Concentration measured after purification = 95ng/µl

02.05.2014 - DNA Digestion to test Plasmids

{| {{table}} | align="center" style="background:#f0f0f0;"|'''Samples''' | align="center" style="background:#f0f0f0;"|'''Conc. DNA (ng/µl)''' | align="center" style="background:#f0f0f0;"|'''Enzymes used''' | align="center" style="background:#f0f0f0;"|'''Expected band length''' | align="center" style="background:#f0f0f0;"|'''Evaluation''' |- | pKD4||302||Xbal||1874,1393||Possible plasmid, failed |- | pKD46||40||EcoRI||4820,1509||Failed |- | pKD46||39||EcoRI||4820,1509||Failed |- | pKD4||60||Xbal||1874,1393||Possible(passed); whole plasmid |- | pSBAC3||88||SpeI/EcoRI||2047,22||Possible (passed); smallpattern |- | pSBAC3-D20-GFP||115||SpeI/EcoRI||2047,957||whole plasmid; failed |- | pSBAC3-D40-Bfr||86||SpeI/EcoRI||2047, 774||Whole plasmid; failed |- | pSBAC3-D40-GFP||80||SpeI/EcoRI||2047,1014||Whole plasmid; failed |- | pSBAC3-AB-Tyrosin||110||SpeI/EcoRI||2047,3319||Failed |- | pSBAC3-D40||164||SpeI/EcoRI||2047,267||Failed |- | pSBAC3-D40-GFP-ssr||106||SpeI/EcoRI||2047,1032||Passed; whole plasmid |- | |} ==Gel Electrophoresis== '''Key:'''
-band1: Ladder
-band5:Ladder
-residual bands, see table above [[Datei:Sm033 fam.jpg|miniatur|zentriert]] [[Datei:20140501 Restriktionsammar.JPEG|miniatur|zentriert]] ===Results=== pKD4 with 60(ng/µl) best candidate for PCR.

05/05 Monday - Preculture of strains from Budisa strain database in LB Medium

(Johann) 1. BU31 (pKD4) in 50 ml LB+Kanamycin+Ampicillin 37°C 220 rpm 2. BU32 (pKD46) in 50 ml LB+Ampicillin 30°C 240rpm 3. BU31 (pKD46) in LB plate+Ampicillin 30°C ==Midiprep== (christina) Midiprep of BU31 (pKD4) and BU32 (pKD46) from strain Database. Concentration pKD4 = 104 ng/µl Concentartion pKD46 = 161 ng/µl

05/06 Tuesday - Gel-Electrophoresis

(Aritra) Kanamycin Cassette PCR (pKD4 from MidiPrep 05.05.2014 104ng/µl Christina)
'''Key:'''
- 1st: Ladder
- 2nd and 3rd: Fief
- 4th: Negative control
- 7th and 8th: FUR
[[Datei:Sm033 fam.jpg|miniatur|zentriert]] [[Datei:20140506 SN VW PCR Kan pKD4 FUR Fif.JPEG|miniatur|zentriert]] ===Results=== FieF worked well; FUR no bands ==Restriction digest of Plasmid pKD4 and pKD46== {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | ||pKD4||pKD46 |- | Plamid ||19.2µl||12.5µl |- | Digestion Enzym||Xbal 1µl||Xmal 1µl |- | nuclease free H2O||24.8µl||31.5µl |- | 10xFO green Buffer||5µl||5µl |- | Total||50µl||50µl |- | |} - Both the reaction mix incubated at 37°C for 1 hr. - After that another 1 hr at RT. ===Gel-Electrophoresis=== - 20µl of both the samples together with whole plasmids loaded on 1% Agarose Gel
====Results==== '''Key:'''
-1st: pKD4 (XbaI digested)
-2nd: pKD4 (undigested)
- 3rd: Ladder
- 4th: pKD46 (undigested)
-5th: pKD46 (XmaI digested)
Datei:06.05.2014 dig pKD4 , pKD46.JPEG| ===Gel Extraction=== -Used GeneJet GelExtraction Kit by Thermo Scientific [[Datei:140605 DNA conc.jpg|miniatur|zentriert]] ====Results==== DNA Concentration: 16ng/µl

05/16 Friday - Biotransformation of Ferritin and pKD46 in Nissle and DH5-α strain

concentration Ferritin 120ng/µl
concentration pKD 46 95 ng/µl Protocol *electro competent cells of DH5α and Nissle were thawed on ice *0.4µl of Ferritin and 0.53 µl of pKD46 was added to the cells *cells with DNA were transferred to cuvettes for electroporation, then 950ml (LB-medium) was added to the cells immediately *incubation at 37°C for ferritin, 30°C for pKd46 for 1 h with shaking *the cells were plated on Amp plates for pKD46 and CM for Ferritin *Transformation did not work.

05/21 Wednesday - PCR Gel-Extraction of FieF

(Christina)
1% Agarosegel + 0,5µl EtBr
45µl Sample+9µl Loading Dye
8µl Ladder
--> Gel-Extraction Kit used with 50µl nuclease-free water for elution
[[Datei:140521 DNA conc.jpg|miniatur|zentriert]] ==Gene Knockout of FieF== (Salah) ===Preparation of the preculture=== '''Used Precultures:'''
- RV +pKD46
- WM10 +pKD46
The precultures was diluted to OD600=0,1 and then incubated for 2h at 30°C until they reach OD600=0,6
{| class="wikitable" |- ! Title !! Wavelength !! Absorbance |- | Reference || 600nm || 0,000A |- | RV+pKD46 || 600nm || 0,066A |- | WM10+pKD46 || 600nm || 0,050A |} (The culture was diluted 1/10 for the OD measurement)
→The precultures are ready for the Rekombinase induction with Arabinose ===Induction with Arabinose=== The cultures have been induced with 500µl arabinose (1M) →After the induction, the cultures have to be incubated for further 30min at 30°C {| class="wikitable" |- ! Title !! Wavelength !! Absorbance |- | Reference || 600nm || 0,000A |- | RV+pKD46 || 600nm || 0,084A |- | WM10+pKD46 || 600nm || 0,067A |} →From now on the cultures need to be cooled on ice ===Preparation for the Electroporation=== ===Electroporation=== '''Electroporation-Program: Ec1'''
-Amount of DNA sample: 75-150ng
{| class="wikitable" |- ! Sample !! Conc !! Used Volume !! Strain !! Electroporation Time |- | FieF1 || 42ng/µl || 2µl (84ng) || RV || 4,4ms |- | FieF2 || 9ng/µl || 10µl (90ng) || RV || 4,1ms |- | FieF1 || 42ng/µl || 2µl (84ng) || WM10 || 4,3ms |- | FieF2 || 9ng/µl || 10µl (90ng) || WM10 || 4,8ms |} After the transformation, the cultures was immediately prepared with 950µl SOC and incubated for 60min at 30°C without antibiotics --> recovery ===Selection-cultures=== The selection of positive clones is done by using LB plates with kan+amp
Incubation: 30°C o/n

05/22 Thursday - Transformation of pKD46

(Salah) ===Preparation of the preculture=== '''Used Precultures:'''
- MG1655
- Nissle
The precultures was diluted to OD600=0,1 and then incubated for 2h at 30°C until they reach OD600=0,6
{| class="wikitable" |- ! Title !! Wavelength !! Absorbance |- | Reference || 600nm || 0,000A |- | MG1655 || 600nm || 0,062A |- | NIssle || 600nm || 0,054A |} (The culture was diluted 1/10 for the OD measurement)
→From now on the cultures need to be cooled on ice ===Preparation for the Electroporation=== ===Electroporation=== '''Electroporation-Program: Ec1'''
-Amount of DNA sample: 75-150ng
{| class="wikitable" |- ! Sample !! Conc !! Used Volume !! Strain !! Electroporation Time |- | MG1655 1 || 42ng/µl || 2µl (84ng) || RV || 5,4ms |- | MG1655 2 || 9ng/µl || 10µl (90ng) || RV || 5,8ms |- | Nissle 1 || 42ng/µl || 2µl (84ng) || WM10 || 0,7ms (thrown away) |- | Nissle 2 || 9ng/µl || 10µl (90ng) || WM10 || 5,8ms |} After the transformation, the cultures was immediately prepared with 950µl SOC and incubated for 60min at 30°C without antibiotics --> recovery ===Selection-cultures=== The selection of positive clones is done by using LB plates with amp
Incubation: 30°C o/n == PCR of ATPCS and PPMT == {| class="wikitable" |- ! Mastermix !! ATPCS !! PPMT |- | nuc.free water|| 18.9 || 17.5 |- | 2x Fusion Mastermix || 25 || 25 |- | Fw Primar || 2.5 || 2.5 |- | Rw Primar || 2.5|| 2.5 |- | template DNA || 1.1 || 2.5 |} {| class="wikitable" |- ! ATPCS !! Programm |- | 98°C || 10 |- | 98°C|| 5 30 cycles |- | 62°C|| 5 30 cycles |- | 72°C || 5 30 cycles |- | 72°C|| 60 secs |- | 8°C|| store |} {| class="wikitable" |- ! PPMT!! Programm |- | 98°C || 10 |- | 98°C|| 5 30 cycles |- | 63,1°C|| 5 30 cycles |- | 72°C || 21 30 cycles |- | 72°C|| 60 secs |- | 8°C|| store |} ATPCS 1469 bp; PPMT 234 bp --> wrong Programm

05/23 Friday - Digestion of Vector for Cloning

Plasmid: pQE80L
Old Plasmid of Johann:
-P1≈1000ng -P3≈400ng {| class="wikitable" |- ! P3 !! !! P1 !! |- | SacI || 1µl || SacI || 1µl |- | HindIII || 1µl || BamHI || 1µl |- | Buffer || 2µl || Buffer || 2µl |- | Plasmid 1 || 4µl || Plasmid 3 || 16µl |- | nuc.water || 12µl || nuc. water || 0µl |} --> Incubation: 1,5h at 37°C
--> Deactivation: 20min at 80°C

05/27 Tuesday - Production of LB Plates

(Salah and Christina) LB Agar Plates prepared: 4x with Ampicillin (25µl in 25ml) 4x with Ampicillin+ Kanamycin (25µl+25µl in 25ml) 4x Cm (25µl in 25ml)
Müller-Breslau-Str. 10
10623 Berlin
Phone: +49 1778800244
Mail: mail@igem.berlin
©2014 iGem Berlin, Layout/Umsetzung: Valerian Blos, Marius Wessel

Retrieved from "http://2014.igem.org/Team:Berlin/Project"