Team:Hong Kong HKUST/pneumosensor/results/module one
From 2014.igem.org
(Difference between revisions)
Line 6: | Line 6: | ||
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script> | <script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script> | ||
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script> | <script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script> | ||
- | |||
</head> | </head> | ||
- | + | </html> | |
+ | |||
+ | <html> | ||
<body> | <body> | ||
<nav role="navigation"> | <nav role="navigation"> | ||
<ul class="access-menu"> | <ul class="access-menu"> | ||
- | <li><a href=" | + | <li class="access_logo"> |
+ | <a href="http://igem.ust.hk/"><img src= "https://static.igem.org/mediawiki/2014/f/fc/Formal_HKUST_iGEM_Logo.png"></a> | ||
+ | <li class="access_logo"> | ||
+ | <a href="https://2014.igem.org/Main_Page"><img src= "https://static.igem.org/mediawiki/igem.org/6/60/Igemlogo_300px.png"></a> | ||
+ | </li> | ||
+ | <li class="access_logo"> | ||
+ | <a href="http://www.ust.hk/"><img src= "https://static.igem.org/mediawiki/2014/5/55/Hkust_logo.gif"></a> | ||
+ | </li> | ||
+ | |||
+ | </ul> | ||
+ | <ul class="access-menu"> | ||
+ | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST">Home</a></li> | ||
<li> | <li> | ||
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a> | <a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a> | ||
<ul class="access-submenu"> | <ul class="access-submenu"> | ||
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_one"> | + | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_one">Detection module</a></li> |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_two"> | + | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_two"><i>S. pneumoniae</i> sigma <br> X promoters module</a></li> |
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Parts</a></li> | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Parts</a></li> | ||
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data</a></li> | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data</a></li> | ||
Line 41: | Line 53: | ||
<ul class="access-submenu"> | <ul class="access-submenu"> | ||
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit">Start-up Kit</a></li> | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit">Start-up Kit</a></li> | ||
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/handbook" > | + | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/handbook" >Handbook</a></li> |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/report" > | + | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/report" >Report</a></li> |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/ | + | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/search_engine" >Search Engine</a></li> |
- | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" > | + | <li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" >Interview</a></li> |
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach">Outreach</a></li> | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach">Outreach</a></li> | ||
- | |||
- | |||
- | |||
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">Safety and Ethics</a></li> | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">Safety and Ethics</a></li> | ||
</ul> | </ul> | ||
Line 77: | Line 86: | ||
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/deliverable">Deliverable</a></li> | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/deliverable">Deliverable</a></li> | ||
</ul> | </ul> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
</li> | </li> | ||
Line 89: | Line 92: | ||
</nav> | </nav> | ||
<!-- ================ do not touch any thing above this, dont even think about it =========================--> | <!-- ================ do not touch any thing above this, dont even think about it =========================--> | ||
- | + | </body> | |
- | + | </html> | |
- | + | <html><div id="content_container"> | |
- | <div id="content_container"> | + | |
<div class= "banner_area"> | <div class= "banner_area"> | ||
<img src= 'https://static.igem.org/mediawiki/2014/archive/3/3c/20140930022303!HKUST_2014_pneumosensor_banner.jpg' /> | <img src= 'https://static.igem.org/mediawiki/2014/archive/3/3c/20140930022303!HKUST_2014_pneumosensor_banner.jpg' /> | ||
Line 190: | Line 192: | ||
<hr> | <hr> | ||
</div> | </div> | ||
+ | </html> | ||
+ | |||
+ | <html> | ||
+ | <body> | ||
<table class= "site_map_table" align= "center"> | <table class= "site_map_table" align= "center"> | ||
<tr> | <tr> | ||
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST">Home</a></h4> | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST">Home</a></h4> | ||
<ul class= 'site_list'> | <ul class= 'site_list'> | ||
- | <li class='site_link'><a href="">Pneumosensor</a></li> | + | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a></li> |
- | <li class='site_link'><a href="">Riboregulator</a></li> | + | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">Riboregulator</a></li> |
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice">Human Practice</a></li> | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice">Human Practice</a></li> | ||
- | <li class='site_link'><a href="">Team</a></li> | + | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team">Team</a></li> |
- | <li class='site_link'><a href="">WetLab</a></li> | + | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab">WetLab</a></li> |
- | <li class='site_link'><a href="">Achievements</a></li> | + | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/Achievements">Achievements</a></li> |
</ul> | </ul> | ||
Line 205: | Line 211: | ||
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a></h4> | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a></h4> | ||
<ul class= 'site_list'> | <ul class= 'site_list'> | ||
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_one"> | + | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_one">Detection module</a></li> |
- | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_two"> | + | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_two"><i>S. pneumoniae</i> sigma X promoters module</a></li> |
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Parts</a></li> | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Parts</a></li> | ||
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data</a></li> | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data</a></li> | ||
Line 229: | Line 235: | ||
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit">Start-up Kit</a> | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit">Start-up Kit</a> | ||
<ul> | <ul> | ||
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/handbook" > | + | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/handbook" >Handbook</a></li> |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/report" > | + | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/report" >Report</a></li> |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/ | + | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/search_engine" >Search Engine</a></li> |
- | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" > | + | <li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" >Interview</a></li> |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</ul> | </ul> | ||
</li> | </li> | ||
+ | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach">Outreach</a></li> | ||
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">Safety and Ethics</a></li> | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">Safety and Ethics</a></li> | ||
</ul> | </ul> | ||
Line 262: | Line 262: | ||
</ul> | </ul> | ||
</td> | </td> | ||
- | <td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/Achievements">Achievement</a></h4> | + | <td class= 'site_map_column' style="float: none;"><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/Achievements">Achievement</a></h4> |
<ul class= 'site_list'> | <ul class= 'site_list'> | ||
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/medal_requirement">Medal Requirements</a></li> | <li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/medal_requirement">Medal Requirements</a></li> | ||
Line 272: | Line 272: | ||
</table> | </table> | ||
- | + | ||
</body> | </body> | ||
</html> | </html> |
Revision as of 07:56, 9 October 2014
Pneumosensor Results
Detection Module
Overview
The two-component regulatory system in S. pneumoniae, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the autoinducer molecule, competence-stimulating peptide (CSP) and so detect S. pneumoniae populations correspondingly. |
Construct
Tag protein We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in comD extraction primer. Forward primer to extract comD to clone into pSB1C3: TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG [6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD] 3’ primer to extract comD with engineered FLAG tag gene sequence: GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT [6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD] comE was extracted from pKHS-come kindly sent to us by ??. Extraction was done using the following primers: Forward primer to extract comE to clone into pSB1C3: TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG [6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE] Reverse primer to extract comE to clone into pSB1C3: GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA [6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE] come contained an illegal SpeI site, so we designed primers for site-directed mutagenesis: Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) comE forward primer & mutagenesis reverse primer; (ii) comE reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly. |
Home |
Pneumosensor |
Riboregulator |
Human Practice |
Team |
WetLab |
Achievement |