Team:Bielefeld-CeBiTec/Results/CO2-fixation/Calvin-Cycle
From 2014.igem.org
Line 73: | Line 73: | ||
<div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
<div id="text"> | <div id="text"> | ||
- | + | <h6>Phosphoribulokinase</h6> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<p> | <p> | ||
</p> | </p> | ||
- | |||
- | |||
</div> | </div> | ||
</div> | </div> | ||
Line 93: | Line 83: | ||
<div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
<div id="text"> | <div id="text"> | ||
- | + | <h6>Sedoheptulose 1,7-bisphosphatase</h6> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<p> | <p> | ||
<div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
Line 165: | Line 147: | ||
</div> | </div> | ||
</div> | </div> | ||
- | |||
- | |||
<div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
<div id="text"> | <div id="text"> | ||
- | + | <h6>Gluco-Switch</h6> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<p> | <p> | ||
Line 185: | Line 157: | ||
</div> | </div> | ||
</div> | </div> | ||
- | |||
- | |||
<div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
<div id="text"> | <div id="text"> | ||
- | + | <h6>Protein purification</h6> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
<div id="text"> | <div id="text"> | ||
Line 237: | Line 199: | ||
</div> | </div> | ||
</div> | </div> | ||
- | + | ||
- | </ | + | </html> |
Revision as of 17:24, 8 October 2014
CO2 fixation
Theory
Phosphoribulokinase
Sedoheptulose 1,7-bisphosphatase
The proteins were overexpressed by adding 1 mM IPTG for the T7 promotor. The increasing amount of protein could be verified through a SDS gel.
We decided to use glpX as a target for amplification and transformation because of the shown acitivity. The finished construct of ptac_glpX in pSB1C3 was cultivated in M9 glucose in comparison to the wildtype. We performed two biological replicates and two technical replicates.
This result shows that the SBPase does not limit the growth maximum of E. coli.
References
- Stolzenberger et al., 2013. Characterization of Fructose 1,6-Bisphosphatase and Sedoheptulose 1,7-Bisphosphatase from the Facultative Ribulose Monophosphate Cycle Methylotroph Bacillus methanolicus. Journal of Bacteriology, Vol. 195, pp. 5112-5122
Gluco-Switch
Protein purification
For the purpose of characterizing our BioBricks we thought of using enzyme assays to verify the functionality of different proteins. Enzyme assays depend on purified enzymes. A typical purification approach is the His-Tag mediated purification system. The disadvantage of this system is that the tag remains attached at the enzyme after the purification and has to be cleaved afterwards. A further development of this system is the intein tag mediated purification.
By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification can be achieved. The chitin binding domain binds the column on which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows to cut the attachment of the intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column.
CTATAGGGAAAGAGGAGAAAT
>GSP_rev
CTAGTGCATCTCCCGTGATGCA
Note: The stop codon of the coding sequence has to be deleted through primer design.
Because of problems during the transformation of the coding sequences we were not able to characterize this BioBrick.