Team:Hong Kong HKUST/pneumosensor/results/module one
From 2014.igem.org
Line 112: | Line 112: | ||
</div> | </div> | ||
</td> | </td> | ||
+ | </tr> | ||
+ | |||
+ | </table> | ||
+ | </div> | ||
+ | <!-- end of one row of content , two column--> | ||
+ | |||
+ | <!-- one row of content , two column one picture right--> | ||
+ | <div class='content_1'><h3>Construct</h3> | ||
+ | <table class="content_table" align= "center" > | ||
+ | <tr class= "content_row"> | ||
<td class= "content_cell"> | <td class= "content_cell"> | ||
<div class= "content_area_one_row"> | <div class= "content_area_one_row"> | ||
- | |||
<br> | <br> | ||
<b>Tag protein</b> | <b>Tag protein</b> | ||
Line 153: | Line 162: | ||
<br> | <br> | ||
However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) <i>come</i> forward primer & mutagenesis reverse primer; (ii) <i>come</i> reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly.</p> | However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) <i>come</i> forward primer & mutagenesis reverse primer; (ii) <i>come</i> reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly.</p> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
</div> | </div> | ||
</td> | </td> |
Revision as of 14:56, 5 October 2014
Pneumosensor Results
Detection Module
Overview
The two-component regulatory system in S. pneumoniae, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the autoinducer molecule, competence-stimulating peptide (CSP) and so detect S. pneumoniae populations correspondingly. |
Construct
Tag protein We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in comD extraction primer. Forward primer to extract comD to clone into PSB1C3: TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG [6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD] 3’ primer to extract comD with engineered FLAG tag gene sequence: GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT [6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD] comE was extracted from pKHS-come kindly sent to us by ??. Extraction was done using the following primers: Forward primer to extract comE to clone into pSB1C3: TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG [6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE] Reverse primer to extract comE to clone into pSB1C3: GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA [6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE] come contained an illegal SpeI site, so we designed primers for site-directed mutagenesis: Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) come forward primer & mutagenesis reverse primer; (ii) come reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly. |
PCelA (BBa_ K1379002) and Phelicase (BBa_ K1379003) construct
Backbone pSB1C3 was used for PCelA and Phelicase construct. PCelA / Phelicase gene was fused with BBa_E0240, which contains a medium RBS (BBa_B0032), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this GFP generator is to indicate the functionality of PCelA and Phelicase in the presence and absence of ComX protein. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E.coli used is DH10B.
|
Assembly and Characterization
Assembly
comX and comW construct contain 3 parts that needs to be assembled: K880005 which contains constitutive promoter and RBS, comX engineered with C-myc tag / comW engineered with FLAG tag, and a double terminator in pSB1C3 backbone. Promoter, RBS, comX engineered with C-myc tag, and double terminator were combined using traditional digestion and ligation method. The ligation product was confirmed by digestion check and sequencing. |
Home |
Pneumosensor |
Riboregulator |
Human Practice |
Team |
WetLab |
Achievement |