Team:Hong Kong HKUST/pneumosensor/results/module one
From 2014.igem.org
Line 109: | Line 109: | ||
<td class= "content_cell"> | <td class= "content_cell"> | ||
<div class= "content_area_one_row"> | <div class= "content_area_one_row"> | ||
- | <p>The | + | <p>The two-component regulatory system in <i>S. pneumoniae</i>, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the autoinducer molecule, competence-stimulating peptide (CSP) and so detect <i>S. pneumoniae</i> populations correspondingly. </p> |
- | + | ||
- | < | + | |
</div> | </div> | ||
</td> | </td> | ||
<td class= "content_cell"> | <td class= "content_cell"> | ||
<div class= "content_area_one_row"> | <div class= "content_area_one_row"> | ||
- | <p><b><u> | + | <p><br><b><u>Construct</u></b><br><br> |
- | + | <br> | |
+ | <b>Tag protein</b> | ||
+ | We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in <i>comD</i> extraction primer. | ||
+ | <br> | ||
+ | Forward primer to extract <i>comD</i> to clone into PSB1C3: | ||
+ | TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG | ||
+ | <i>[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]</i> | ||
+ | <br> | ||
+ | <br> | ||
+ | 3’ primer to extract <i>comD</i> with engineered FLAG tag gene sequence: | ||
+ | GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT | ||
+ | <i>[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]</i> | ||
+ | <br> | ||
+ | <br> | ||
+ | <i>comE</i> was extracted from pKHS-<i>come</i> kindly sent to us by ??. Extraction was done using the following primers: | ||
+ | <br> | ||
+ | Forward primer to extract <i>comE</i> to clone into pSB1C3: | ||
+ | TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG | ||
+ | <br> | ||
+ | <i>[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]</i> | ||
+ | <br> | ||
+ | Reverse primer to extract comE to clone into pSB1C3: | ||
+ | GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA | ||
+ | <br> | ||
+ | <i>[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]</i> | ||
+ | <br> | ||
+ | <br> | ||
+ | <i>come</i> contained an illegal SpeI site, so we designed primers for site-directed mutagenesis: | ||
+ | <br> | ||
+ | Mutagenesis forward primer: | ||
+ | CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC | ||
+ | <br> | ||
+ | <br> | ||
+ | Mutagenesis reverse primer: | ||
+ | GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG | ||
+ | <br> | ||
+ | <br> | ||
+ | However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) <i>come</i> forward primer & mutagenesis reverse primer; (ii) <i>come</i> reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly.</p> | ||
+ | |||
</div> | </div> | ||
</td> | </td> |
Revision as of 14:53, 5 October 2014
Pneumosensor Results
Detection Module
Overview
The two-component regulatory system in S. pneumoniae, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the autoinducer molecule, competence-stimulating peptide (CSP) and so detect S. pneumoniae populations correspondingly. |
|
ComX Generator construct (BBa_K1379006) and comW construct
Backbone pSB1C3 was used for ComX generator construct and comW construct. comX gene / comW gene was fused with BBa_K880005 which contains a constitutive promoter (J23100) and strong RBS (B0032). The purpose of this strong constitutive promoter and strong RBS is to unsure the large production of ComX and ComW protein throughout time. Then, a double terminator (B0015) is fused with the promoter, RBS, and ComX. BBa_K880005 and B0015 was obtained from 2014 iGEM distribution kit.
comX Tag Protein |
PCelA (BBa_ K1379002) and Phelicase (BBa_ K1379003) construct
Backbone pSB1C3 was used for PCelA and Phelicase construct. PCelA / Phelicase gene was fused with BBa_E0240, which contains a medium RBS (BBa_B0032), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this GFP generator is to indicate the functionality of PCelA and Phelicase in the presence and absence of ComX protein. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E.coli used is DH10B.
|
Assembly and Characterization
Assembly
comX and comW construct contain 3 parts that needs to be assembled: K880005 which contains constitutive promoter and RBS, comX engineered with C-myc tag / comW engineered with FLAG tag, and a double terminator in pSB1C3 backbone. Promoter, RBS, comX engineered with C-myc tag, and double terminator were combined using traditional digestion and ligation method. The ligation product was confirmed by digestion check and sequencing. |
Home |
Pneumosensor |
Riboregulator |
Human Practice |
Team |
WetLab |
Achievement |