Team:Duke/Notebook/August
From 2014.igem.org
Line 173: | Line 173: | ||
</ul> | </ul> | ||
- | <ul | + | <ul> |
+ | <li>with MfeI and XbaI/PstI</li> | ||
+ | </ul> | ||
+ | |||
+ | <ul> | ||
+ | <li>pSB1C3-R0011-I13500 #19 from 7/29 colony PCR</li> | ||
+ | </ul> | ||
+ | |||
+ | <ul> | ||
+ | <li>with MfeI and XbaI/PstI</li></ul><ul class="c7 lst-kix_aluoitp9k8n4-0"><li class="c1"><span>pSB1C3-K608012 as a control for MfeI activity</span></li></ul><ul class="c7 lst-kix_aluoitp9k8n4-1 start"><li class="c2"><span>with MfeI</span></li></ul><ul class="c7 lst-kix_aluoitp9k8n4-0"><li class="c1"><span>pSB1C3-I13500 as a control for MfeI activity</span></li></ul><ul class="c7 lst-kix_aluoitp9k8n4-1 start"><li class="c2"><span>with MfeI</span></li></ul><p class="c6 c16"><span class="c4">Agarose gel of digest results</span></p><ul class="c7 lst-kix_7gggt811h1p2-0 start"><li class="c1"><span>Gel one: (see later entries for details on lanes 1-8)</span></li></ul><ul class="c7 lst-kix_7gggt811h1p2-1 start"><li class="c2"><span>Lanes 1-4: pSB4K5-R0040-anti-tracrRNA cut with XbaI/PstI</span></li><li class="c2"><span>Lanes 5-6: pSB1C3-dCas9-tracrRNA cut with XbaI/PstI</span></li><li class="c2"><span>Lanes 7-8: pSB1C3-dCas9-tracrRNA cut with XbaI/NheI</span></li><li class="c2"><span>Lanes 9-10: pSB1C3-R0011 (2 copies) cut with XbaI/PstI</span></li><li class="c2"><span>Lanes 11-12: pSB1C3-R0011 (2 copies) cut with MfeI</span></li><li class="c2"><span>Lane 13: pSB1C3-R0011-I13500 #19 cut with XbaI/PstI</span></li><li class="c2"><span>Lane 14: pSB1C3-R0011-I13500 #19 cut with MfeI</span></li><li class="c2"><span>Lane 15: sample for Tony Burnetti</span></li></ul><ul class="c7 lst-kix_7gggt811h1p2-0"><li class="c1"><span>Gel two:</span></li></ul><ul class="c7 lst-kix_7gggt811h1p2-1 start"><li class="c2"><span>1: pSB1C3-K608012 cut with MfeI</span></li><li class="c2"><span>2. pSB1C3-I13500 cut with MfeI</span></li><li class="c2"><span>3. pSB1C3-K608012 uncut</span></li><li class="c2"><span>4. pSB1C3-I13500 uncut</span></li></ul> | ||
<p class="obj">Objective: Switch R0040-anti-tracrRNA into pSB4K5</span></p><p class="c6"><span class="c3"> </span><span class="c4">Minipreps</span></p><ul class="c7 lst-kix_q0fuoq696ozh-0 start"><li class="c1"><span>pSB4K5-R0040-anti-tracrRNA (4 copies)</span></li></ul><ul class="c7 lst-kix_q0fuoq696ozh-1 start"><li class="c2"><span>concentrations 204, 154.2, 206.7, and 189.3 ng/uL</span></li></ul><p class="c6 c16"><span class="c4">Analytical digests</span></p><ul class="c7 lst-kix_gd3qsjcj7cg5-0 start"><li class="c1"><span>pSB4K5-R0040-anti-tracrRNA (4 copies)</span></li></ul><ul class="c7 lst-kix_gd3qsjcj7cg5-1 start"><li class="c2"><span>with XbaI/PstI</span></li></ul><ul class="c7 lst-kix_gd3qsjcj7cg5-0"><li class="c1"><span>See gel above for results</span></li></ul><ul class="c7 lst-kix_gd3qsjcj7cg5-1 start"><li class="c2"><span>All 4 copies appear successful</span></li></ul> | <p class="obj">Objective: Switch R0040-anti-tracrRNA into pSB4K5</span></p><p class="c6"><span class="c3"> </span><span class="c4">Minipreps</span></p><ul class="c7 lst-kix_q0fuoq696ozh-0 start"><li class="c1"><span>pSB4K5-R0040-anti-tracrRNA (4 copies)</span></li></ul><ul class="c7 lst-kix_q0fuoq696ozh-1 start"><li class="c2"><span>concentrations 204, 154.2, 206.7, and 189.3 ng/uL</span></li></ul><p class="c6 c16"><span class="c4">Analytical digests</span></p><ul class="c7 lst-kix_gd3qsjcj7cg5-0 start"><li class="c1"><span>pSB4K5-R0040-anti-tracrRNA (4 copies)</span></li></ul><ul class="c7 lst-kix_gd3qsjcj7cg5-1 start"><li class="c2"><span>with XbaI/PstI</span></li></ul><ul class="c7 lst-kix_gd3qsjcj7cg5-0"><li class="c1"><span>See gel above for results</span></li></ul><ul class="c7 lst-kix_gd3qsjcj7cg5-1 start"><li class="c2"><span>All 4 copies appear successful</span></li></ul> |
Revision as of 14:53, 26 August 2014
August 1
Objective: Create pSB1C3-R0011-I13500
Minipreps
- 2 copies of pSB1C3-R0011 from streak plate of original frozen stock
- Concentrations 187.0, 197.1 ng/uL
Analytical digest
- To help determine what is causing the difficulties in this construct
- 2 copies of pSB1C3-R0011 from frozen stock
- with MfeI and XbaI/PstI
- pSB1C3-R0011-I13500 #19 from 7/29 colony PCR
- with MfeI and XbaI/PstI
- pSB1C3-K608012 as a control for MfeI activity
- with MfeI
- pSB1C3-I13500 as a control for MfeI activity
- with MfeI
Agarose gel of digest results
- Gel one: (see later entries for details on lanes 1-8)
- Lanes 1-4: pSB4K5-R0040-anti-tracrRNA cut with XbaI/PstI
- Lanes 5-6: pSB1C3-dCas9-tracrRNA cut with XbaI/PstI
- Lanes 7-8: pSB1C3-dCas9-tracrRNA cut with XbaI/NheI
- Lanes 9-10: pSB1C3-R0011 (2 copies) cut with XbaI/PstI
- Lanes 11-12: pSB1C3-R0011 (2 copies) cut with MfeI
- Lane 13: pSB1C3-R0011-I13500 #19 cut with XbaI/PstI
- Lane 14: pSB1C3-R0011-I13500 #19 cut with MfeI
- Lane 15: sample for Tony Burnetti
- Gel two:
- 1: pSB1C3-K608012 cut with MfeI
- 2. pSB1C3-I13500 cut with MfeI
- 3. pSB1C3-K608012 uncut
- 4. pSB1C3-I13500 uncut
Objective: Switch R0040-anti-tracrRNA into pSB4K5
Minipreps
- pSB4K5-R0040-anti-tracrRNA (4 copies)
- concentrations 204, 154.2, 206.7, and 189.3 ng/uL
Analytical digests
- pSB4K5-R0040-anti-tracrRNA (4 copies)
- with XbaI/PstI
- See gel above for results
- All 4 copies appear successful
Objective: Triple-transformation of R0040-anti-tracrRNA into Z1-reporter-crRNA_GFP cells
Prepared chemically competent cells
- DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP1
- DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP3
- From 50 mL overnight culture each
- Made about 10 tubes each of 750 uL
Triple Transformation
- pSB4K5-R0040-anti-tracrRNA into two strains
- DH5alpha-ZI + pSB6A1-K608012 + pdCas9-GFP1
- DH5alpha-ZI + pSB6A1-K608012 + pdCas9-GFP3
- Transformed via heat shock, plated on LB+Cm+Amp+Kan
Objective: Switch tracrRNA-dCas9 and tracrRNA-dCas9-crRNA into pSB1C3
Minipreps
- 2 copies of potential pSB1C3-tracrRNA-dCas9
- concentrations 185.9, 150.7 ng/uL
Analytical digests
- pSB1C3-tracrRNA-dCas9 (2 copies)
- with XbaI/PstI and with XbaI/NheI
- See gel above for results
- neither copy appears successful
Ligations of tracrRNA-dCas9-crRNA and tracrRNA-dCas9 into pSB1C3
- Two ligations of different inserts into the same backbone
- pSB1C3 backbone 100ng = 1 uL
- gel extract of XbaI/PstI digest treated with Antarctic Phosphatase
- tracrRNA-dCas9-crRNA 3x molar insert 600 ng = 2uL
- PCR digested with XbaI/PstI/DpnI
- tracrRNA-dCas9 3x molar insert 600 ng = 2 uL
- PCR digested with XbaI/PstI/DpnI
- Backbone-only and two insert-only controls
- Transformed via heat shock into DH5alpha and plated on LB+Cm
Objective: Put R0040 in front of Csy4 and Repeat scaffolds
Antarctic Phosphatase treatment
- pSB1C3-R0040 cut with SpeI/PstI
- 2 copies combined into one 100 uL reaction
- >1 hr at 37C
PCR cleanup of AP treatment
- Qiagen kit
- Concentration 130 ng/uL
Ligation of Repeat-scaffold and Csy4-scaffold into pSB1C3-R0040
- Two ligations of different inserts into the same backbone
- pSB1C3-R0040 backbone 100 ng = 0.75 uL
- SpeI/PstI digest treated with Antarctic Phosphatase
- Repeat-seq scaffold excess insert 7.75 uL
- gel extract of XbaI/PstI digest
- Csy4-scaffold excess insert 7.75 uL
- gel extract of XbaI/PstI digest
- Backbone-only and two insert-only controls
- Transformed via heat shock into DH5alpha and plated on LB+Cm
Objective: Obtain new backbone for tracrRNA-dCas9-crRNAs
Transformation from kit plate
- Plate 4-4D: pSB3C5-J04450
- Transformed into DH5alpha and plated on LB+Cm
Objective: Measurement interlab study
Antarctic Phosphatase treatment
- pSB1C3-K823005 cut with SpeI/PstI
- 2 copies combined into one 100 uL reaction
- pSB1C3-K823012 cut with SpeI/PstI
- 2 copies combined into one 100 uL reaction
- >1 hr at 37C
PCR cleanup of AP treatment
- Qiagen kit
August 2
Objective: Test anti-tracrRNA induction effect on reporter
Plate results:
- Triple-transformation seems to have worked
- Many colonies on both plates
Culture colonies to prepare for flow
- All strains cultured in +aTc and -aTc
- +aTc = 5 uL of 100 ug/mL aTc/EtOH into 5 mL media
- final concentration of aTc 100 ng/mL (full induction)
- -aTc = 5 uL of 100% EtOH into 5 mL media
- to control for effect of solvent on cells
- 3 colonies each from triple transformation plates
- DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP1 + R0040-anti-tracrRNA
- DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP1 + R0040-anti-tracrRNA
- DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP1
- straight from frozen stock #1
- DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP3
- straight from frozen stock #1
- DH5alpha-ZI + pSB6A1-K608012
- straight from frozen stock
- DH5alpha-ZI background strain
- separate colonies from streak plate
- All frozen stock and transformation colonies were inoculated into 50 uL SOC, which was divided between the +aTc and -aTc samples
- this ensures that +aTc and -aTc samples are from the same parent copy
- All samples grown to stationary phase (~18 hrs) in LB+(appropriate antibiotics)
Streak plates
- 3 strains for which frozen stocks were used directly above
Objective: Put R0040 in front of Csy4 and Repeat scaffolds
Plate results:
- Lots of colonies on Experimental and Backbone-only controls
- Possibly more on experimentals?
- None on insert-only control
Colony PCR
- 8 colonies each:
- pSB1C3-R0040-Csy4-scaffold
- pSB1C3-R0040-Repeat-scaffold
- Taq polymerase, oligos SB1C3-up and SB1C3-dn
- 20 sec extension, 62C anneal temp
Agarose gel of colony PCR results
- Csy4 scaffold colonies showed clear distinction between higher and lower
- copies 3,4, and 5 are promising samples
- Repeat scaffold bands are harder to differentiate
- copies 1,3, and 4 may be promising
Cultured colonies
- pSB1C3-R0040-Csy4-scaffold #3,4,5
- pSB1C3-R0040-Repeat-seq scaffold #1,3,4
Objective: Obtain new backbone for tracrRNA-dCas9-crRNAs
Plate results
- Many colonies on plate
Cultured colonies
- 4 copies of pSB3C5-J04450
Objective: Measurement interlab study
Cultured colonies
- 4 copies of pSB1C3-E0240
August 3
Objective: Obtain new backbone for tracrRNA-dCas9-crRNAs
Minipreps
- 4 copies of pSB3C5-J04450
- Saved glycerol stock of 1 copy
Objective: Measurement interlab study
Minipreps
- 4 copies of pSB1C3-E0240
Objective: Put R0040 in front of Csy4 and repeat scaffolds
Minipreps
- pSB1C3-R0040-Csy4-scaffold #3,4,5
- saved glycerol stocks
- pSB1C3-R0040-Repeat-seq scaffold #1,3,4
- saved glycerol stocks
Objective: Test anti-tracrRNA induction effect on reporter
Dilute cultures and flow cytometry
- 1/1000 initial dilution: 5 uL overnight culture into 5 uL media
- media same as overnight culture, including +aTc concentrations and noninduced (NI) EtOH concentrations
- Initial dilution was grown for 4.5 hrs at 37C
- 1/50 Final dilution: 20 uL initial dilution into 1 mL PBS, placed on ice until run
- 3 replicates of each strain
- All controls were replicates taken from a single overnight culture
- Full triple-transformation strains were 3 independent colonies
- 1-3: DH5alpha-ZI (background) NI
- 4-6: DH5alpha-ZI (background) +aTc
- 7-9: DH5alpha-ZI + pSB6A1-K608012 NI
- 10-12: DH5alpha-ZI + pSB6A1-K608012 +aTc
- 13-15: DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP1 NI
- 16-18: DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP1 +aTc
- 19-21: DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP3 NI
- 22-24: DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP3 +aTc
- 25-27: DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP1 + pSB1C3-R0040-anti-tracrRNA NI
- 28-30: DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP1 + pSB1C3-R0040-anti-tracrRNA +aTc
- 31-33: DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP3 + pSB1C3-R0040-anti-tracrRNA NI
- 34-36: DH5alpha-ZI + pSB6A1-K608012 + pdCas9_GFP3 + pSB1C3-R0040-anti-tracrRNA +aTc
August 4
Objective: Put R0040 promoter in front of Csy4 and repeat scaffolds
Analytical digests
- Plasmids from 8/3 minipreps
- pSB1C3-R0040-Csy4-scaffold (3 copies)
- pSB1C3-R0040-Repeat-scaffold (3 copies)
- All digested with BsaI/EcoRV, as well as with XbaI/PstI
- 1.5 hrs at 37C
Agarose gel of digest results
- Gel I:
- 1-3. pSB1C3-R0040-Repeat-scaffold, copies 1,3,4, BsaI/EcoRV
- 4-6. pSB1C3-R0040-Csy4-scaffold, copies 3,4,5, BsaI/EcoRV
- 7. Sample for Tony Burnetti
- Gel 2:
- 1-3. pSB1C3-R0040-Repeat-scaffold, copies 1,3,4, XbaI/PstI
- 4-6. pSB1C3-R0040-Csy4-scaffold, copies 3,4,5, XbaI/PstI
- Results: all samples look correct
Objective: Switch R0040-anti-tracrRNA into pSB3C5
Prep-scale digests
- Plasmids from 8/3 minipreps
- pSB3C5-J04450 (4 copies) with SpeI/EcoRI
- Each miniprep tube used in a 100 uL reaction
Gel extraction and cleanup of digests
- Loaded 200 uL (two reaction tubes) per lane
- Gel 4:
- ladder in between two lanes of pSB3C5-J04450
- Extracted top band (pSB3C5) from both lanes
- Zymoclean prep kit
- Final concentrations: 325 ng/uL both tubes in 30 uL each
Objective: Measurement interlab study
Prep-scale digests
- Plasmids from 8/3 minipreps
- pSB1C3-E0240 (4 copies) with XbaI/PstI
- Each miniprep tube used in a 100 uL reaction
Gel extraction and cleanup of digests
- Loaded 200 uL (two reaction tubes) per lane
- Gel 3:
- lanes 1 and 3: pSB1C3-E0240
- middle lane blank
- Extracted lower band (E0240) from both lanes
- Zymoclean prep kit
- Final concentrations: 75 ng/uL both tubes in 30 uL each
August 5
DUGSIM Order 1699
- BigDye Version 1.1
- 1-2: pSB1C3-R0011 (from frozen stock) with SB1C3-up, SB1C3-dn
- 3-4: pSB1C3-R0011 #1 with SB1C3-up, SB1C3-dn
- 5-6: pSB1C3-R0040-Csy4-scaffold #3 with SB1C3-up, SB1C3-dn
- 7-8: pSB1C3-R0040-Csy4-scaffold #4 with SB1C3-up, SB1C3-dn
- 9-10: pSB1C3-R0040-Repeat-scaffold #1 with SB1C3-up, SB1C3-dn
- 11-12: pSB1C3-R0040-Repeat-scaffold #3 with SB1C3-up, SB1C3-dn
- Results:
- R0011 stocks are not correct
- Both scaffolds are correct with Tet promoters (all copies)
Objective: Switch R0040-anti-tracrRNA into pSB3C5
Antarctic Phosphatase treatment
- pSB3C5 gel extracts from 8/4
- Two tubes combined into one reaction of 100 uL
- 2 hrs at 37C
PCR Cleanup of AP treatment
- Qiagen kit
- Final concentration 323.8 ng/uL in 30 uL
Ligation of R0040-anti-tracrRNA into pSB3C5
- pSB3C5 backbone SpeI/EcoRI/AP: 100 ng = 0.3 uL
- R0040-anti-tracrRNA insert SpeI/EcoRI: 30 ng = 0.3 uL
- Backbone-only and insert-only controls
- T4 Ligase for 45 minutes at rt, then transformed via heat shock
- plated on LB+Cm
Objective: Switch tracrRNA-dCas9 and tracrRNA-dCas9-crRNA into pSB1C3
Ligation of tracrRNA-dCas9 and tracrRNA-dCas9-crRNA into pSB1C3
- 2 “inserts” into the same “backbone”
- Used 3x molar “backbone” pSB1C3 because insert is larger
- pSB1C3 backbone XbaI/PstI: 150 ng = 1.5 uL
- tracrRNA-dCas9 insert XbaI/PstI/DpnI: 100 ng = 0.3 uL
- tracrRNA-dCas9-crRNA insert XbaI/PstI/DpnI: 100 ng = 0.3 uL
- Backbone-only and 2 insert-only controls
- T4 Ligase for 45 minutes at rt, then transformed via heat shock
- plated on LB+Cm
Objective: Measurement interlab study
Ligation of E0240 into pSB1C3-K823005 and into pSB1C3-K823012
- 2 backbones with the same insert
- pSB1C3-K823005 backbone SpeI/PstI/AP: 100 ng = 0.33 uL
- pSB1C3-K823012 backbone SpeI/PstI/AP: 100 ng = 0.66 uL
- E0240 insert XbaI/PstI: 150 ng = 2 uL
- 2 Backbone-only and 1 insert-only controls
- T4 Ligase for 45 minutes at rt, then transformed via heat shock
- plated on LB+Cm
Objective: Swapping various backbones
Cultured colonies
- 6 colonies of pSB1A2-R0011 (transformed from 2013 kit plate)
- 4 copies of pSB4K5-J04450
- 4 copies of pSB1C3-R0040-anti-tracrRNA
August 6
Objective: Swapping various backbones
Minipreps
- 6 colonies of pSB1A2-R0011 (transformed from 2013 kit plate)
- 4 copies of pSB4K5-J04450
- 4 copies of pSB1C3-R0040-anti-tracrRNA
Objective: Switching R0040-anti-tracrRNA into pSB3C5
Plate results:
- 1 colony on the experimental plate
- 0 colonies on backbone-only control
- ~25 colonies on insert-only control
- Is is possible that naming got switched? This result is abnormal
Cultured colonies:
- One colony from ligation plate of pSB3C5-R0040-anti-tracrRNA
- 3 colonies from insert-only plate
Objective: Switch tracrRNA-dCas9 and tracrRNA-dCas9-crRNA into pSB1C3
Plate results:
- No colonies on pSB1C3-tracrRNA-dCas9-crRNA ligation plate
- 1 colony on pSB1C3-tracrRNA-dCas9 ligation plate
- 2 colonies on backbone-only control, none on insert-only controls
Cultured colony
- One colony from pSB1C3-tracrRNA-dCas9 ligation
Objective: Measurement interlab study
Plate results:
- Hundreds of colonies on both experimental and both backbone-only plates
- No colonies on insert-only controls
Colony PCR
- 8 colonies each from pSB1C3-K823005-E0240 and pSB1C3-K823012-E0240
- Taq polymerase with oligos SB1C3-up and SB1C3-dn
- Anneal temp 62C, extension time 45 sec
Agarose gel of Colony PCR results
- 1-8: pSB1C3-K823005-E0240
- 9-16: pSB1C3-K823012-E0240
- Results: no successes, looks like clear amplification of promoter-only
August 7
Objective: Backbone switching
Minipreps abandoned
- Accidentally poured off the DNA-containing liquid into the waste container
- Frozen stocks were saved--those can be grown to miniprep another day
- pSB1C3-tracrRNA-dCas9 ligation (1 copy, need to test)
- pSB3C5-R0040-anti-tracrRNA (4 copies, need to test)
- More LB+Cm was added to empty culture tubes and grown at 37C
- An attempt to salvage the minipreps--probably not useful
Objective: Sequencing
Order 1708
- Big Dye version 1.1
- 1. pSB1C3-R0040-anti-tracrRNA-1 with SB1C3-up
- 2. pSB1C3-R0040-anti-tracrRNA-1 with SB1C3-dn
- 3. pSB1C3-R0040-anti-tracrRNA-2 with SB1C3-up
- 4. pSB1C3-R0040-anti-tracrRNA-2 with SB1C3-dn
August 8
Redo minipreps from yesterday - culture tubes grew overnight from salvaged cells
- pSB1C3-dCas9-tracrRNA - 171.3 ng/ul
- pSB3C5-R0040-a-tracr 1 - 257.5 ng/ul
- pSB3C5-R0040-a-tracr 2 - 202.7 ng/ul
- pSB3C5-R0040-a-tracr 3 - 200.5 ng/ul
- pSB3C5-R0040-a-tracr 4 - 198.3 ng/ul
Analytical digest of Tube 1 (pSB1C3-dCas9-tracrRNA) using XhoI and BamHI
- 2 hour digest at 37 degrees C
- 3X Master Mix:
- 3 ul Cutsmart
- 22.5 ul water
- 0.75 ul XhoI
- 0.75 ul BamHI
- 9 ul Master Mix added to 1 ul of pdCas9 in one tube and 1 ul of pSB1C3-dCas9-tracrRNA in another tube
- Gel results were consistent with an unsuccessful ligation. 3 bands in the experimental column (4kb, 1.8 kb, and 0.9 kb) were expected. The results were more consistent with pSB1C3 and no insert. The band size in the pdCas9 control lane also looked wrong because it was too big. The pdCas9 tube may have been faulty or the BamHI might have been faulty.
August 11
The two types of cells to make competent were DH5-aZ1 cells containing the reporter gene and cells with the reporter and GFP1 site. Charlie started cultures on Saturday evening from a plate into LB + antibiotics. The antibiotics used were ampicillin in the reporter-only cells and ampicillin plus chloramphenicol in the reporter/GFP1 cells. On Sunday morning, he put them in the cold room and then took the OD that evening by adding 100 uL of culture to 900 uL broth plus antibiotics:
- R: 0.276
- R+G1: 0.268
He then started four cultures by adding 120 mL LB/appropriate antibiotic(s) to the following and growing them at 24 C:
- 70 uL R
- 0.7 mL R (denser culture)
- 70 uL R+G1
- 0.7 mL R+G1 (denser culture)
Today, at 10:25 AM, OD was measured again, but undiluted.
- dense R: 0.023
- R: -0.001
- dense R+G1: 0.0037
- R+G1: -0.000
Measurements were repeated at 12:34 PM, but only on the denser cultures.
- dense R: 0.038
- dense R+G1: 0.061
The temperature was increased to improve doubling time.
August 12
Objective: Analyze gel from 8/11/14's analytical digest
- Lanes 1-4 (pSB1C3-R0040-antitracr) identical and consistent with expected results (2000 and 200 bp bands)
- Lanes 5-8 (pSB3C5-R0040-antitracr) not identical but should be. Expected was 2.7 kb, 36 bp, and 163 bp bands. 163 and 36 bp bands may blur together
- Lanes 5 and 7 had a ~3 kb band and a ~200 kb band, which is unexpected
- Lanes 6 and 8 may have worked.
- Next steps: A second analytical digest to confirm these ambiguous results
Objective: Perform a second analytical digest using AgeI and XhoI
- Gel Design:
- Lane 1: pSB1C3-R0040-antitracr, tube #1 (from 8/5/14); Expected results: 892 bp and 1353 bp bands
- Lane 2: pSB3C5-R0040-antitracr, tube #1 (from 8/7/14); Expected results: 323 bp and 2590 bp bands
- Lane 3: pSB3C5-R0040-antitracr, tube #2 (from 8/7/14); Expected results: 323 bp and 2590 bp bands
- Lane 4: pSB3C5-R0040-antitracr, tube #3 (from 8/7/14); Expected results: 323 bp and 2590 bp bands
- Lane 5: pSB3C5-R0040-antitracr, tube #4 (from 8/7/14); Expected results: 323 bp and 2590 bp bands
- 6X Master Mix:
- 6 uL Cutsmart
- 1.5 uL AgeI
- 1.5 uL XhoI
- 45 uL dH2O
- 9 uL MM added to 1 uL DNA at 37 C
- Results: Tube #1 of pSB3C5-R0040-antitracr had the expected results, so the remaining tubes 2-4 were discarded
Objective: Transform 8/11/14's CCEC with pSB4K5-J04450
- Used tube #4 of pSB4K5-J04450 from 8/6/14 : 135.8 ng/uL concentration
- 10X serial dilution of DNA: 5 uL previous tube + 45 uL EB
- 6 transformants were 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, and EB only
- Cells were plated using appropriate antibiotics (Amp + Kan for Reporter only, Amp + Kan + Cm for Reporter+GFP1 cells)
August 13
Objective: Analyze yesterday's transformation results
- pink lawn on 10^-1 R and G plates, no colonies on other plates; unexpected
- expected: 10-fold reduction in colonies on each successive dilution plate
- could be explained by pipetting errors
- Next steps: repeat transformation with following modifications:
- Increase recovery time in SOC from 1 hour to 2 hours
- Introduce antibiotics to the SOC media (Amp for R cells, Amp + Cm for G cells)
- Use a 5-fold dilution instead of a 10-fold dilution
- Instead of adding cells to DNA, add DNA to cells
- Vortex the dilutions before adding them to the cell tubes
Objective: Retry transformation
- Tube #4 of pSB4K5-J04450 was used again.
- The 6 transformants were:
- 10X dilution : 3 uL DNA + 27 uL EB
- 5X dilution of 10X: 5 uL previous tube + 20 uL EB
- 5X dilution of (10^-1*5^-1): 5 uL previous tube + 20 uL EB
- 5X dilution of (10^-1*5^-2): 5 uL previous tube + 20 uL EB
- 5X dilution of (10^-1*5^-3): 5 uL previous tube + 20 uL EB
- EB only
August 14
Objective: Analyze yesterday's transformation
- Success: All plates except EB had colonies that were faintly pink
Dilution | Reporter Only | Reporter+GFP1 |
10^-1 | lawn | lawn |
10^-1*5^-1 | lawn | lawn |
10^-1*5^-2 | lawn | lawn |
10^-1*5^-3 | dense colonies | dense colonies |
10^-1*5^-4 | 1530 colonies | 2402 colonies |
EB only | none | none |
Objective: Transform cells with highly dilute DNA
- Accidentally left tube #4 of pSB4K5-J04450 on benchtop overnight, so used tube #1 instead, just in case. Concentration: 162.1 ng/uL
- Dilutions:
- 10^-1: 5 uL tube #1 DNA + 45 uL EB
- 10^-1*5^-4: 5 uL previous tube to 625 uL EB
- 10^-2*5^-4: 5 uL previous tube to 45 uL EB
- 10^-3*5^-4: 5 uL previous tube to 45 uL EB
- 10^-4*5^-4: 5 uL previous tube to 45 uL EB
- Transformation was done using the lowest 4 concentrations of DNA (not 10^-1). No control was tested, and yesterday's (8/13/14) modified transformation protocol was used.
August 15
Objective: Analyze results of diluted transformation
- The transformation was successful; each plate had fewer colonies than the previous.
Dilution: | 10^-1*5^-4 | 10^-2*5^-4 | 10^-3*5^-4 | 10^-4*5^-4 |
Reporter Only: | dense colonies | 905 colonies | 134 colonies | 20 colonies |
Reporter+GFP1: | dense colonies | 1280 colonies | 108 colonies | 24 colonies |
Objective: Test validity of molecular titration approach using anti-tracr oligos and flow cytometry
Oligos ordered on Wednesday arrived today: 2 tubes of both antitracrDNA and not-antitracrDNA. Calculations:antitracrDNA aaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatgctgttttgaatggttccaac
notantitracr acaattttaggcttttgatgtgttgtcgtaatctgtaccacaattgcatatattgagaaccaagctactgaagcatcctttcccggc
%% cells_per_tube_R = .086 * 5 * 8E8 / 200; % http://www.genomics.agilent.com/biocalculators/calcODBacterial.jsp?_requestid=290172 cells_per_tube_RG = .0859 * 5 * 8E8 / 200; d = 162.1; % ng/uL original tube d1 = 16.21; d2 = d1/5^4; ngDNA = [d2 d2/1E1 d2/1E2 d2/1E3]; % ng in each transformation tube pmolDNA = ngDNA * 1E-3 / 660 * 1E6 / 5578; % http://www.promega.com/a/apps/biomath/index.html?calc=ugpmols
One tube of each was resuspended in dH2O: 82 uL in antitracr (A) and 71.4 uL in not-antitracr (NA). Then, 2 uL of each oligo were transformed into both R and G cells, using 8/14/14's protocol without recovery time. Starting at t=0 minutes, samples were taken and placed on ice in cold room every 30 minutes, from t=0 to t=240 (9 time points). Flow cytometry was used to analyze the expression of GFP.Expected results: | ||
Reporter Only Cells | Reporter + GFP1 Cells | |
A | GFP expression | GFP expression |
NA | GFP expression | No GFP expression |
- Samples taken every hour, not half hour
- Samples collected all day so there are more data points
- Samples analyzed using flow cytometry immediately, instead of after being placed in cold room