"
Team:Duke/Parts
From 2014.igem.org
| Line 57: | Line 57: | ||
<br /> | <br /> | ||
| - | + | <h3>Parts Submitted to the Parts Registry </h3> | |
<groupparts><a href="http://parts.igem.org/Part:BBa_K1545000">BBa_K1545000</a></groupparts> <br /> | <groupparts><a href="http://parts.igem.org/Part:BBa_K1545000">BBa_K1545000</a></groupparts> <br /> | ||
<groupparts><a href="http://parts.igem.org/Part:BBa_K1545001">BBa_K1545001</a></groupparts> <br /> | <groupparts><a href="http://parts.igem.org/Part:BBa_K1545001">BBa_K1545001</a></groupparts> <br /> | ||
Revision as of 01:48, 18 October 2014
Construction Background
Some flow this summer showed that pdCas9 with crRNA targeting this GFP1 sequence repressed nicely (as did GFP3 but not GFP2) so we picked this one to try making decoys for. The actual sequence is the 20bp of GFP1, the PAM, and then 10 more bp of spacer that come from the GFP orf. We added the spacer reasoning that dCas9 occupies space outside of just the 20bp matching crRNA, and after eyeballing the crystal structure 4008.pdb (which should be referenced & pictured) it looked like we needed about enough space for 1 additional turn of DNA outside of the 20bp. 10.5bp is ~1 turn, 3 bp is taken care of by PAM, so we added 10 to be safe.During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.
| Sequence | Ungated Mean |
| DH5alpha ZI | 0.16 |
| fluorescence relative to reporter-only | 0.003661327231 |
| Reporter | 43.7 |
| fluorescence relative to reporter-only | 1 |
| dCas9 | 42.73333333 |
| fluorescence relative to reporter-only | 0.9778794813 |
| GFP1 (ccatctaattcaacaagaat) | 13.4 |
| fluorescence relative to reporter-only | 0.3066361556 |
| GFP2 (agtagtgcaaataaatttaa) | 48.6 |
| fluorescence relative to reporter-only | 1.112128146 |
| GFP3 (gtagtgacaagtgttggcca) | 15.43333333 |
| fluorescence relative to reporter-only | 0.3531655225 |
We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:
PCR1: oligos with prefix-decoy-spacer (top strand), decoy-spacer-decoy (top strand), and spacer-decoy-spacer (bottom strand) are combined and cycled 35 times resulting in a mixture of products
PCR2: the products of PCR1 are used as a template for a bottom strand oligo that appends the BioBrick suffix and cycles 35 times.
The products of PCR2 are inserted in to pSB1C3 via Gibson assembly
These constructs can be expanded further by serial digestion/ligation
From our PCR-based construction scheme we isolated 1x and 6x decoys, and then expanded the 6x array to 12x. These parts were submitted to the registry as BBa_K1545000 BBa_K1545001 and BBa_K1545001
Crystal structure 4OO8 from the Doudna Lab. Cas9 is in blue, gRNA in red, and the DNA to which the complex binds is in yellow. Click for the PubMed article.
