Team:Hong Kong HKUST/pneumosensor/results

The activity of combox promoter is turned on by a specific sigma factor that is produced by a regulatory gene comX. The sigma factor X will bind to the combox promoter region and activate gene expression. Sigma factor X will serve as an inducer with high specificity as it binds to an area of several specific base pairs on the combox promoter. This comX and combox system could be used as a highly specific reporting system in our Streptococcus pneumonia detection platform. However in nature, comX protein will be degraded by clpXP enzyme which exist in E.Coli and some other bacteria. Hence, to ensure the induction of combox promoter by comX, comW protein is needed as it functions to protect comX protein from being degraded by clpXP. ComW protein will be degraded instead, increasing the amount of comX protein produced.

Contruct

The three main components of the construct are comX gene, comW gene, and combox promoter. We assemble comX and combox promoter in one vector plasmid, while comW in a different plasmid. The system will be fused with a tagging protein and a reporting protein. Tagging protein is essential for detecting the comX and comW protein expression by means of western blot. Reporting protein which is fluorescence protein is needed for reporting purpose, hence comX and combox system could serve as a specific reporting system that will be useful for many synthetic constructs. comX and combox promoter construct will be assembled separately in different plasmid before being combined into one plasmid.

Backbone pSB1C3 was used for comX generator construct and comW construct. comX gene / comW gene was fused with BBa_K880005 which contains a constitutive promoter (J23100) and strong RBS (B0032). The purpose of this strong constitutive promoter and strong RBS is to unsure the large production of comX and comW protein throughout time. Then, a double terminator (B0015) is fused with the promoter, RBS, and comX. BBa_K880005 and B0015 was obtained from 2014 iGEM distribution kit.

Construct using pSB1C3 backbone with only comX gene (BBa_K1379004), with comX gene and BBa_B0015 double terminator (BBa_K1379045) was also built.

Bacterial Strain
The bacterial strain of E.coli that were used is DH10B. Since this strain of E.Coli have clpXP degradation enzyme which target comX for degradation, an excess amount of comX protein are required to maintain enough amount of comX for combox promoter induction.

ComX and comW gene
comX gene and comW gene was cloned from NCTC 7465 E.Coli strain genomic DNA by PCR using Vent Polymerase.

ComX Tag Protein
We engineered a C-myc protein tag in the 3’ ends of comX by including the sequence in comX extraction primer.

3’ primer to extract comX with engineered C-myc tag gene sequence:

GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CAGATCCTCTTCTGAGATGAGTTTTTGTTC GTGGGTACGGATAGTAAACTCCTTAAACAC [6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [30’ C-myc protein] [30' reverse complementary of 3’ comX]

ComW Tag Protein
We engineered a FLAG protein tag in the 3’ ends of comW by including the sequence in comW extraction primer.

3’ primer to extract comW with engineered FLAG tag gene sequence:

GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CTTGTCGTCATCGTCTTTGTAGTC ACAAGAAATAAAACCCCGATTCATTACCAATT [6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [24’ FLAG protein] [32' reverse complementary of 3’ comW]

Fig 1 . Here is the potato.

Here is the description of the potato: it is a potato!

Scientific contributions focus primarily on describing related empirical facts about the universe, exploring the context and parameters concerning the 'how' of life. Science also studies and can provide recommendations for the pursuit of well-being and a related conception of morality.

The meaning of life is a philosophical question concerning the significance of life or existence in general. It can also be expressed in different forms, such as "Why are we here?", "What is life all about?", and "What is the purpose of existence?" It has been the subject of much philosophical, scientific, and theological speculation throughout history. There have been a large number of proposed answers to these questions from many different cultural and ideological backgrounds. The meaning of life is in the philosophical and religious conceptions of existence, social ties, consciousness, and happiness, and borders on many other issues, such as symbolic meaning, ontology, value, purpose, ethics, good and evil, free will, the existence of one or multiple gods, conceptions of God, the soul, and the afterlife.