Team:SJTU-BioX-Shanghai/Parts

From 2014.igem.org

(Difference between revisions)
 
(73 intermediate revisions not shown)
Line 3: Line 3:
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}
{{Template:Team:SJTU-BioX-Shanghai/top-nav}}
{{Template:Team:SJTU-BioX-Shanghai/article}}
{{Template:Team:SJTU-BioX-Shanghai/article}}
 +
{{Template:Team:SJTU-BioX-Shanghai/preview}}
<html>
<html>
<style type="text/css">
<style type="text/css">
 +
#groupparts {
 +
    width: 100%;
 +
text-align: center; margin-left: auto; margin-right: auto;
 +
background:#FFF;}
 +
#groupparts table{visibility:visible;}
   .header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}
   .header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");}
 +
.projtile {
 +
    margin-right:1.167%;
 +
    margin-left:1.167%;
 +
    width:31%;}
 +
 +
#passage{
 +
    width:100%;}
 +
#passage p{
 +
    padding:4%;}
 +
 +
 +
 +
#subtitleyjn2{
 +
    margin-left:40%;}
 +
</style>
</style>
 +
 +
<div class="content">
<div class="content">
-
  <article class="post__article">
 
-
<h2>Overview</h2>
 
-
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br>
 
-
Those BioBricks could be divided into four groups.<br>
+
<div class="jiao" >
-
1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.<br>
+
<div class="projtile_only">
 +
      <center><h2>Parts</h2></br></center>
 +
<center>
 +
<p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool ready for potential scientific or engineering use.<br>
-
2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.<br>
+
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Those BioBricks are divided into four groups.</br>
-
3.BioBricks in application is our complete part. <br>
+
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1. BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br>
-
4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.<br>
+
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2. BioBricks in USB are our designed sequences. They can help us easily and quickly insert our target sequence and make a whole part.</br>
 +
 
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3. BioBricks in Application are our complete parts. </br>
 +
 
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;4. BioBricks in New TAL are our newly designed TAL parts, which are robust and perform better in Golden Gate method.</br>
</p>
</p>
 +
</center>
 +
 +
</div>
 +
 
 +
    <div class="projtile" >
 +
  <a href="#dingweidian2" title="Basic Parts">
 +
    <center><h2>Basic Parts</h2></center></a>
 +
    </div>
 +
     
 +
    <div class="projtile">
 +
  <a href="#dianweidian9"  title="USB">
 +
    <center> <h2>USB</h2></center></a>
 +
    </div>
 +
     
 +
    <div class="projtile">
 +
<a href="#dianweidian14" title="Application">
 +
    <center><h2>Application</h2></center></a>
 +
    </div>
 +
    <div class="projtile">
 +
<a href="#dianweidian10" title="New TAL">
 +
    <center><h2>New TAL</h2></center></a>
 +
    </div>
 +
 +
 
 +
</div>
 +
<div style="clear:both;"></div></html>
 +
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><p id="dingweidian2"></p>
 +
<html><div class="content"><article class="post__article">
 +
</br></br>
<h2>Basic Parts</h2>
<h2>Basic Parts</h2>
<h3>Review previous parts</h3>
<h3>Review previous parts</h3>
<p>
<p>
-
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br>
+
ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><a name="#dianweidian2"></a>
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai)
</p>
</p>
Line 44: Line 100:
<p>
<p>
This is a TALE protein with a flexible linker 3 before it. <br>
This is a TALE protein with a flexible linker 3 before it. <br>
 +
</p>
 +
<p>
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br>
Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br>
Line 54: Line 112:
<h3>Connector</h3>
<h3>Connector</h3>
<p>
<p>
-
We have four types of connector.</p>
+
We have four types of connector.
-
<center><img src="https://static.igem.org/mediawiki/2014/8/8e/SJTU14_Diagram_of_four_types_of_connector.jpg" width= 800px></img></center>
+
<br>
 +
<center><img src="https://static.igem.org/mediawiki/2014/f/fb/4plasmid.png" width= 800px></img></center>
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center>
</br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center>
  </br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br>
  </br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br>
-
<br>
 
<p>
<p>
-
<br>
+
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453901" target="_blank">(BBa_K1453901)</a>
-
pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br>
+
</p>
-
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br>
+
<p>
-
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br>
+
pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453001" target="_blank">(BBa_K1453001)</a>
-
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br>
+
</p>
 +
<p>
 +
pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453003" target="_blank">(BBa_K1453003)</a>  
 +
</p>
 +
<p>
 +
pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453004" target="_blank">(BBa_K1453004)</a>  
 +
</p>
 +
 
 +
<p>
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br>
Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br>
<br>
<br>
</p>
</p>
-
<br>
+
 
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3>
<h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3>
Line 74: Line 140:
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br>
<p>
<p>
-
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats <br>
+
The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats  
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.
protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.
<br>
<br>
Line 83: Line 149:
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center>
<center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center>
-
</br><center><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br>
+
</br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br>
<p>
<p>
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.
This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.
-
<br>
+
</p>
 +
<p>
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.
The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.
<br>
<br>
Line 94: Line 161:
-
 
+
<br>
<h2>USB</h2>
<h2>USB</h2>
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target  TALE or Enzyme, respectively.</p>
<p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target  TALE or Enzyme, respectively.</p>
Line 104: Line 171:
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.
We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.
</p>
</p>
-
<h3>Enzyme USB</h3>
+
<h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3>
 +
 
 +
<br>
<p>
<p>
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p>
In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p>
Line 115: Line 184:
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p>
On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p>
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p>
When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p>
-
<p>
+
 
<br>
<br>
-
<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><br>
 
-
<a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a><br>
 
-
</p>
 
-
 
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3>
<h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3>
Line 137: Line 202:
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3>
<h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3>
-
<center><img src="" width=400px></img></center>
+
<center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center>
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br>
<p>
<p>
-
 
+
This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.
<br>
<br>
</p>
</p>
Line 149: Line 214:
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3>
<h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3>
-
<center><img src="" width=400px></img></center>
+
<center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center>
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br>
<p>
<p>
-
 
+
This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.
<br>
<br>
</p>
</p>
Line 162: Line 227:
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3>
<h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3>
-
<center><img src="" width=400px></img></center>
+
<center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center>
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br>
<p>
<p>
-
 
+
This part is the combination of BBa_K1453401 and BBa_K1453006.
<br>
<br>
</p>
</p>
Line 172: Line 237:
-
<h3>Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3>
+
<h3 id="dianweidian14">Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3>
-
<center><img src="" width=400px></img></center>
+
<center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center>
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br>
<p>
<p>
-
 
+
This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.
<br>
<br>
</p>
</p>
Line 193: Line 258:
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3>
<h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3>
-
<center><img src="" width=400px></img></center>
+
<center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center>
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br>
<p>
<p>
-
 
+
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.
<br>
<br>
</p>
</p>
Line 204: Line 269:
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3>
<h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3>
-
<center><img src="" width=400px></img></center>
+
<center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center>
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br>
<p>
<p>
-
 
+
This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB
<br>
<br>
</p>
</p>
Line 215: Line 280:
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3>
<h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3>
-
<center><img src="" width=400px></img></center>
+
<center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center>
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br>
<p>
<p>
-
 
+
This part is used in our application test free in the cytoplasm.
 +
</p>
 +
<p>
 +
This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.
<br>
<br>
</p>
</p>
Line 227: Line 295:
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3>
<h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3>
-
<center><img src="" width=400px></img></center>
+
<center><img src="https://static.igem.org/mediawiki/2014/7/7e/3409.png" width=400px></img></br><p id="dianweidian10"></p></center>
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br>
</br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br>
 +
<p >
 +
This part is used in our application test free in the cytoplasm.
 +
</p>
<p>
<p>
-
 
+
This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB
-
<br>
+
</p>
</p>
-
 
<br>
<br>
Line 242: Line 311:
<h2>New TAL</h2>
<h2>New TAL</h2>
 +
<h3>New TAL with better sticky ends<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a>
 +
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(501)</a>
 +
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(502)</a>
 +
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(503)</a>
 +
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(504)</a>
 +
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(505)</a>
 +
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(506)</a></h3>
<p>
<p>
We design seven new sticky ends which get the least score when judging the similarity.<br>
We design seven new sticky ends which get the least score when judging the similarity.<br>
Line 249: Line 325:
<p>
<p>
<br>
<br>
-
<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a>
+
 
-
<a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a>
+
-
<a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br>
+
-
<a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a>
+
-
<a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a>
+
-
<a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br>
+
-
<a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br>
+
</p>
</p>
 +
<p >
 +
<b>PART-left:</b><br>
 +
…CTGACCCCGGAGACG
 +
</p>
 +
<p>
 +
<b>PART1(150bp):</b><br>
 +
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG
 +
CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT
 +
CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p>
 +
<p>
 +
<b>PART2(219bp):</b><br>
 +
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG
 +
GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA
 +
AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG
 +
CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p>
 +
<p>
 +
<b>PART3(262bp):</b><br>
 +
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG
 +
TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT
 +
GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC
 +
ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA
 +
AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center>
 +
<p>
 +
<b>PART4(224bp):</b><br>
 +
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT
 +
GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG
 +
TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA
 +
CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br>
 +
GACG
 +
</p>
 +
<p>
 +
<b>PART5(194bp):</b><br>
 +
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC
 +
CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC
 +
TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br>
 +
TCGGCGGCAAACAGGCACTCGATGAGACG
 +
</p>
 +
<p>
 +
<b>PART6(249bp):</b><br>
 +
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC
 +
TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT
 +
GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG
 +
GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br>
 +
TGCAACGCCTCTTGCCAGTTTTAGAGACG</p>
 +
<p>
 +
<b>PART-right:</b><br>
 +
CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br>
 +
 +
 +
<p>
 +
The recognition sequence of the TALE protein:
 +
<center><font size="5" color="red">TCGATATCAAGC</font></center></p>
 +
<div class="default" id="default">
 +
<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts>
 +
</div>
</article>
</article>
-
<groupparts>iGEM014 SJTU-BioX-Shanghai </groupparts>
 
   </div>
   </div>
</html>
</html>
-
 
{{Team:SJTU-BioX-Shanghai/footer}}
{{Team:SJTU-BioX-Shanghai/footer}}

Latest revision as of 23:41, 17 October 2014

Parts


We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool ready for potential scientific or engineering use.
      Those BioBricks are divided into four groups.
      1. BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.
      2. BioBricks in USB are our designed sequences. They can help us easily and quickly insert our target sequence and make a whole part.
      3. BioBricks in Application are our complete parts.
      4. BioBricks in New TAL are our newly designed TAL parts, which are robust and perform better in Golden Gate method.

Basic Parts

USB

Application

New TAL

<groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts>



Basic Parts

Review previous parts

ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (BBa_K771002, SJTU-BioX-Shanghai)

Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (BBa_K771002, SJTU-BioX-Shanghai)

mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (BBa_E1010, Antiquity )

FL3-TALE(BBa_K1453300)


Figure 2.3.1 Diagram of FL3-TALE

This is a TALE protein with a flexible linker 3 before it.

Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.

Connector

We have four types of connector.


Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion,

pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy

pBluescript II KS(+) ScaI deletion (BBa_K1453901)

pBluescript II KS(+) EcoRV deletion (BBa_K1453001)

pBluescript II KS(+)_3_copy (BBa_K1453003)

pBluescript II KS(+)_5_copy (BBa_K1453004)

Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.

ssDsbA-mRFP-Lgt-TAL1-His Tag(BBa_K1453005)


Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag

The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.



TAL1-His Tag(BBa_K1453007)


Figure 2.3.4 Diagram of TAL1-His Tag

This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.

The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.


USB

We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.

TAL USB(BBa_K1453000)


Figure 2.3.5 Diagram of TAL USB

We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.

Enzyme USB(BBa_K1453400)(BBa_K1453401)


In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker.


Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI

The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site.

On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.

When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.


TAL_USB-His Tag(BBa_K1453006)


Figure 2.3.7 Diagram of TAL_USB-His Tag

In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.

When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)


ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag(BBa_K1453402)


Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag

This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.


ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag(BBa_K1453403)


Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag

This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.


Enzyme USB(BsmAI)-TAL_USB-His Tag(BBa_K1453406)


Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag

This part is the combination of BBa_K1453401 and BBa_K1453006.


Enzyme USB(AarI)-TAL_USB-His Tag(BBa_K1453407)


Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag

This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.


Application

We chose some functional enzymes and inserted them into connectees
We want to prove that our connectees and connectors system can successfully achieve our designed function in the end.

ssDsbA-Lgt-pykF-TAL1-His Tag(BBa_K1453404)


Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag

This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.


ssDsbA-Lgt-poxB-TAL1-His Tag(BBa_K1453405)


Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag

This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB


pykF-TAL1-His Tag(BBa_K1453408)


Figure 2.3.14 Diagram of pykF-TAL1-His Tag

This part is used in our application test free in the cytoplasm.

This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.


poxB-TAL1-His Tag(BBa_K1453409)



Figure 2.3.15 Diagram of poxB-TAL1-His Tag

This part is used in our application test free in the cytoplasm.

This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB


New TAL

New TAL with better sticky ends(BBa_K1453500) (501) (502) (503) (504) (505) (506)

We design seven new sticky ends which get the least score when judging the similarity.
If you want to know how we design these ends, please go to see our project-Part3 TAL improve.


PART-left:
…CTGACCCCGGAGACG

PART1(150bp):
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG

PART2(219bp):
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG

PART3(262bp):
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG

PART4(224bp):
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA
GACG

PART5(194bp):
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA
TCGGCGGCAAACAGGCACTCGATGAGACG

PART6(249bp):
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG
TGCAACGCCTCTTGCCAGTTTTAGAGACG

PART-right:
CGTCTCATTTTGTGTCAGGCCCACGGA...


The recognition sequence of the TALE protein:

TCGATATCAAGC

iGEM014 SJTU-BioX-Shanghai

Bio-X Institutes

Shanghai Jiao Tong University

800, Dongchuan Road 200240, Shanghai, China

sunyaojin2011@foxmail.com

Retrieved from "http://2014.igem.org/Team:SJTU-BioX-Shanghai/Parts"