Team:LIKA-CESAR-Brasil/PCR
From 2014.igem.org
(Difference between revisions)
Villaverde (Talk | contribs) (Created page with "{{CSS/Main}} <html lang="pt-br"> <head> <meta charset="utf-8"> <meta http-equiv="X-UA-Compatible" content="IE=edge"> <meta name="viewport" content="width=device-wid...") |
|||
(2 intermediate revisions not shown) | |||
Line 12: | Line 12: | ||
<link rel="stylesheet" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.2.0/css/bootstrap.min.css"> | <link rel="stylesheet" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.2.0/css/bootstrap.min.css"> | ||
- | + | <style type="text/css"> | |
+ | body { | ||
+ | font-size:12px; | ||
+ | color:#111; | ||
+ | height:100%; | ||
+ | background:#ededed; | ||
+ | /*min-width: 1326px;*/ | ||
+ | } | ||
+ | .container { | ||
+ | width:80%; | ||
+ | background: rgb(255,255,255); /* Old browsers */ | ||
+ | background: -moz-linear-gradient(top, rgba(255,255,255,1) 0%, rgba(237,237,237,1) 100%); /* FF3.6+ */ | ||
+ | background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,rgba(255,255,255,1)), color-stop(100%,rgba(237,237,237,1))); /* Chrome,Safari4+ */ | ||
+ | background: -webkit-linear-gradient(top, rgba(255,255,255,1) 0%,rgba(237,237,237,1) 100%); /* Chrome10+,Safari5.1+ */ | ||
+ | background: -o-linear-gradient(top, rgba(255,255,255,1) 0%,rgba(237,237,237,1) 100%); /* Opera 11.10+ */ | ||
+ | background: -ms-linear-gradient(top, rgba(255,255,255,1) 0%,rgba(237,237,237,1) 100%); /* IE10+ */ | ||
+ | background: linear-gradient(to bottom, rgba(255,255,255,1) 0%,rgba(237,237,237,1) 100%); /* W3C */ | ||
+ | filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#ffffff', endColorstr='#ededed',GradientType=0 ); /* IE6-9 */ | ||
+ | } | ||
- | + | .navbar-brand { | |
+ | padding: 5px; | ||
+ | } | ||
+ | .col-md-10 { | ||
+ | width:100%; | ||
+ | padding: 20px 70px 20px 50px; | ||
+ | min-height:200px; | ||
+ | padding-bottom:50px; | ||
+ | } | ||
+ | .col-md-4 { | ||
+ | padding-bottom:70px; | ||
+ | } | ||
+ | .navbar-inverse { | ||
+ | background-color: #ededed; | ||
+ | border-color: #ededed; | ||
+ | } | ||
+ | .navbar-inverse .navbar-nav > .active > a, .navbar-inverse .navbar-nav > .active > a:hover, .navbar-inverse .navbar-nav > .active > a:focus { | ||
+ | color: #006600; | ||
+ | background-color: #8cff00; | ||
+ | } | ||
+ | .navbar-inverse .navbar-nav > .open > a, .navbar-inverse .navbar-nav > .open > a:hover, .navbar-inverse .navbar-nav > .open > a:focus { | ||
+ | color: #006600; | ||
+ | background-color: #8cff00; | ||
+ | } | ||
+ | .navbar-inverse .navbar-nav > li > a:hover, .navbar-inverse .navbar-nav > li > a:focus { | ||
+ | color: #006600; | ||
+ | background-color: transparent; | ||
+ | } | ||
+ | .navbar-inverse .navbar-nav > li > a:focus { | ||
+ | color: #006600; | ||
+ | background-color: transparent; | ||
+ | } | ||
+ | .nav > li > a { | ||
+ | display: block; | ||
+ | padding: 25px 15px; | ||
+ | position: relative; | ||
+ | } | ||
+ | .menu{ | ||
+ | color:black; | ||
+ | z-index:999; | ||
+ | position:relative; | ||
+ | float:right; | ||
+ | margin:auto; | ||
+ | } | ||
- | + | .videohome{ | |
+ | background:#ededed; | ||
+ | } | ||
+ | .menu ul{ | ||
+ | margin:0 auto; | ||
+ | } | ||
+ | .jumbotron { | ||
+ | background:url("https://static.igem.org/mediawiki/2014/7/7a/Banner_top.jpg"); | ||
+ | border-top: solid 5px #8cff00; | ||
+ | border-bottom: solid 5px #8cff00; | ||
+ | background-size:cover; | ||
+ | width:80%; | ||
+ | height:331px; | ||
+ | margin:auto; | ||
+ | margin-top:40px; | ||
+ | } | ||
+ | .jumbotron02 { | ||
+ | background:url("https://static.igem.org/mediawiki/2014/5/52/Banner_top02.jpg"); | ||
+ | border-top: solid 5px #8cff00; | ||
+ | border-bottom: solid 5px #8cff00; | ||
+ | background-size:cover; | ||
+ | width:80%; | ||
+ | height:331px; | ||
+ | margin:auto; | ||
+ | margin-top:80px; | ||
+ | } | ||
+ | .jumbotronSafety { | ||
+ | background:url("https://static.igem.org/mediawiki/2014/7/7a/Banner_top.jpg"); | ||
+ | border-top: solid 5px #8cff00; | ||
+ | border-bottom: solid 5px #8cff00; | ||
+ | background-size:cover; | ||
+ | width:80%; | ||
+ | height:331px; | ||
+ | margin:auto; | ||
+ | margin-top:80px; | ||
+ | } | ||
+ | .jumbotronParts { | ||
+ | background:url("https://static.igem.org/mediawiki/2014/b/be/Banner_top04.jpg"); | ||
+ | border-top: solid 5px #8cff00; | ||
+ | border-bottom: solid 5px #8cff00; | ||
+ | background-size:cover; | ||
+ | width:80%; | ||
+ | height:331px; | ||
+ | margin:auto; | ||
+ | margin-top:80px; | ||
+ | } | ||
+ | .jumbotronHuman { | ||
+ | background:url("https://static.igem.org/mediawiki/2014/1/12/Banner_top05.jpg"); | ||
+ | border-top: solid 5px #8cff00; | ||
+ | border-bottom: solid 5px #8cff00; | ||
+ | background-size:cover; | ||
+ | width:80%; | ||
+ | height:331px; | ||
+ | margin:auto; | ||
+ | margin-top:80px; | ||
+ | } | ||
+ | .jumbotronProject { | ||
+ | background:url("https://static.igem.org/mediawiki/2014/b/be/Banner_top04.jpg"); | ||
+ | border-top: solid 5px #8cff00; | ||
+ | border-bottom: solid 5px #8cff00; | ||
+ | background-size:cover; | ||
+ | width:80%; | ||
+ | height:331px; | ||
+ | margin:auto; | ||
+ | margin-top:80px; | ||
+ | } | ||
+ | .jumbotronAdvisors { | ||
+ | background:url("https://static.igem.org/mediawiki/2014/3/3b/Banner_top03.jpg"); | ||
+ | border-top: solid 5px #8cff00; | ||
+ | border-bottom: solid 5px #8cff00; | ||
+ | background-size:cover; | ||
+ | width:80%; | ||
+ | height:331px; | ||
+ | margin:auto; | ||
+ | margin-top:80px; | ||
+ | } | ||
+ | .igem-logo{ | ||
+ | background:url("https://static.igem.org/mediawiki/2014/4/4e/Banner_top_03.png") ; | ||
+ | background-color:transparent; | ||
+ | width: 50px; | ||
+ | height:50px; | ||
+ | z-index: 99; | ||
+ | background-repeat: no-repeat; | ||
+ | } | ||
+ | |||
+ | /* | ||
+ | .navbar .container { | ||
+ | min-width: 1322px; | ||
+ | z-index: 9999; | ||
+ | } | ||
+ | */ | ||
+ | |||
+ | h2 { | ||
+ | font-size: 26px; | ||
+ | color:#339900; | ||
+ | } | ||
+ | .videocapa{ | ||
+ | width:35%; | ||
+ | float:right; | ||
+ | min-height:300px; | ||
+ | margin-top:10px; | ||
+ | } | ||
+ | p { | ||
+ | font-size: 12px; | ||
+ | color:#444; | ||
+ | } | ||
+ | footer { | ||
+ | background:#b8b8b8; | ||
+ | width:100%; | ||
+ | padding: 50px; | ||
+ | clear:both; | ||
+ | position: relative; | ||
+ | bottom:0; | ||
+ | border-top: solid 8px #8cff00; | ||
+ | } | ||
+ | footer p { | ||
+ | margin:auto; | ||
+ | padding-top:10px; | ||
+ | text-align:center; | ||
+ | width:50%; | ||
+ | color:#006600; | ||
+ | } | ||
+ | .firstHeading { | ||
+ | display:none; | ||
+ | } | ||
+ | table{ | ||
+ | color:#888; | ||
+ | font-size:16px; | ||
+ | border: solid 1px #ccc; | ||
+ | } | ||
+ | h1 { | ||
+ | font-size: 26px; | ||
+ | color:#339900; | ||
+ | } | ||
+ | h2 { | ||
+ | font-size: 22px; | ||
+ | color:#339900; | ||
+ | } | ||
+ | h3 { | ||
+ | font-size: 18px; | ||
+ | color:#339900; | ||
+ | } | ||
+ | h4 { | ||
+ | font-size: 16px; | ||
+ | color:#339900; | ||
+ | } | ||
+ | |||
+ | .listHorizontal{ | ||
+ | list-style: none; | ||
+ | display:inline-block; | ||
+ | margin-left: 0.3em; | ||
+ | } | ||
+ | |||
+ | .listHorizontal li{ | ||
+ | padding: 0px 5px 0px 5px; | ||
+ | } | ||
+ | |||
+ | div#globalWrapper { | ||
+ | position: relative; | ||
+ | font-size: 100%; | ||
+ | width: 100%; | ||
+ | margin: 0; | ||
+ | padding: 0; | ||
+ | padding-bottom: 10px; | ||
+ | } | ||
+ | |||
+ | </style> | ||
+ | </head> | ||
+ | <body> | ||
<div class="navbar navbar-inverse navbar-fixed-top" role="navigation"> | <div class="navbar navbar-inverse navbar-fixed-top" role="navigation"> | ||
<div class="container"> | <div class="container"> | ||
Line 70: | Line 299: | ||
<li><a href="https://2014.igem.org/Team:LIKA-CESAR-Brasil/Safety">SAFETY</a></li> | <li><a href="https://2014.igem.org/Team:LIKA-CESAR-Brasil/Safety">SAFETY</a></li> | ||
<li><a href="https://2014.igem.org/Team:LIKA-CESAR-Brasil/Atribuitons">ATRIBUITIONS</a></li> | <li><a href="https://2014.igem.org/Team:LIKA-CESAR-Brasil/Atribuitons">ATRIBUITIONS</a></li> | ||
+ | <li class="igem-logo"><a href="https://2014.igem.org/"></a></li> | ||
</ul> | </ul> | ||
</div><!--/.nav-collapse --> | </div><!--/.nav-collapse --> |
Latest revision as of 02:14, 18 October 2014
NOTEBOOK
PCR
Primers
Primer reverse: TCACTCAAAGGCGGTAATAC
Primer forward: CCACCTGACGTCTAAGAAAC
Quantification and amplification of plasmid DNA
- 1) The quantity and purity of genomic DNA were determined by optical density in a spectrophotometer (NanoDrop® ND-1000 UV-Vis).
- 2) Genomic DNA was amplified using PCR with primers TCACTCAAAGGCGGTAATAC (reverse primer) and CCACCTGACGTCTAAGAAAC (foward primer).
- 3) The reaction was performed in a thermocycler (Applied Biosystems® Veriti® Thermal Cycler).
- 4) The following reagents were used in the reaction: In a 0.2 ml tube: 1U Taq DNA polymerase (Invitrogen Life Technologies, Brazil); µl 2.5 of 10X PCR buffer (10 mM Tris-HCl pH 8 and 50 mM KCl - Invitrogen Life Technologies, Carlsbad, CA), 4mM MgCl 2 (Invitrogen Life Technologies, Carlsbad, CA, USA) 0.25 mM dNTPs (desorribonucleotídeo 5'-triphosphate - dATP, dCTP, dGTP and dTTP - GE Healthcare, Piscataway, NJ, USA), 15 pmol of each primer and 10.9 µl of ultrapure water qs (Invitrogen Life TechnologiesTM, Carlsbad, CA, USA). After the mixture was added 5 µl DNA from each sample a total final volume of 25 µl.
- 5) The temperature cycles consisted of initial denaturation at 94 ° C / 10 minutes, followed by 40 cycles of denaturation at 94 ° C / 1 minute, annealing at 65 ° C / 1 minute, and extension at 72 ° C / 2 minutes, followed by final extension at 72 ° C / 7 minutes. The successful amplification of DNA was verified by electrophoresis on a 2% agarose gel stained with ethidium bromide, visualized under ultraviolet light and documented with the aid of the Kodak Digital Science 1D system.