|
|
(99 intermediate revisions not shown) |
Line 3: |
Line 3: |
| {{Template:Team:SJTU-BioX-Shanghai/top-nav}} | | {{Template:Team:SJTU-BioX-Shanghai/top-nav}} |
| {{Template:Team:SJTU-BioX-Shanghai/article}} | | {{Template:Team:SJTU-BioX-Shanghai/article}} |
| + | {{Template:Team:SJTU-BioX-Shanghai/preview}} |
| <html> | | <html> |
| <style type="text/css"> | | <style type="text/css"> |
| + | #groupparts { |
| + | width: 100%; |
| + | text-align: center; margin-left: auto; margin-right: auto; |
| + | background:#FFF;} |
| + | #groupparts table{visibility:visible;} |
| .header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");} | | .header_logo{ background-image:url("/wiki/images/0/01/SJTU14_parts.png");} |
| + | .projtile { |
| + | margin-right:1.167%; |
| + | margin-left:1.167%; |
| + | width:31%;} |
| + | |
| + | #passage{ |
| + | width:100%;} |
| + | #passage p{ |
| + | padding:4%;} |
| + | |
| + | |
| + | |
| + | #subtitleyjn2{ |
| + | margin-left:40%;} |
| + | |
| </style> | | </style> |
| + | |
| + | |
| <div class="content"> | | <div class="content"> |
- | <article class="post__article">
| |
- | <h2>Overview</h2>
| |
- | <p>We have characterized and submitted 42 BioBricks which could either be used directly or serve as a universal tool readily for potential scientific or engineering use.<br>
| |
| | | |
- | Those BioBricks could be divided into four groups.<br>
| + | <div class="jiao" > |
| | | |
- | 1.BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.<br>
| + | <div class="projtile_only"> |
| + | <center><h2>Parts</h2></br></center> |
| + | <center> |
| + | <p>We have characterized and submitted 25 BioBricks which could either be used directly or serve as a universal tool ready for potential scientific or engineering use.<br> |
| | | |
- | 2.BioBricks in USB is our designed sequence. They can help us easily and quickly insert our target sequence and make a whole part.<br>
| + | Those BioBricks are divided into four groups.</br> |
- | 3.BioBricks in application is our complete part. <br>
| + | |
| | | |
- | 4.BioBricks in New TAL is our new design TAL parts which are robust and perform better in Golden Gate method.<br> | + | 1. BioBricks in Basic Parts are all basic components of the whole project. They can be assembled to carry out different tasks.</br> |
| + | |
| + | 2. BioBricks in USB are our designed sequences. They can help us easily and quickly insert our target sequence and make a whole part.</br> |
| + | |
| + | 3. BioBricks in Application are our complete parts. </br> |
| + | |
| + | 4. BioBricks in New TAL are our newly designed TAL parts, which are robust and perform better in Golden Gate method.</br> |
| | | |
| </p> | | </p> |
| + | </center> |
| + | |
| + | </div> |
| + | |
| + | <div class="projtile" > |
| + | <a href="#dingweidian2" title="Basic Parts"> |
| + | <center><h2>Basic Parts</h2></center></a> |
| + | </div> |
| + | |
| + | <div class="projtile"> |
| + | <a href="#dianweidian9" title="USB"> |
| + | <center> <h2>USB</h2></center></a> |
| + | </div> |
| + | |
| + | <div class="projtile"> |
| + | <a href="#dianweidian14" title="Application"> |
| + | <center><h2>Application</h2></center></a> |
| + | </div> |
| + | <div class="projtile"> |
| + | <a href="#dianweidian10" title="New TAL"> |
| + | <center><h2>New TAL</h2></center></a> |
| + | </div> |
| + | |
| + | |
| + | |
| + | |
| + | </div> |
| | | |
| + | <div style="clear:both;"></div></html> |
| + | <groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts><p id="dingweidian2"></p> |
| + | <html><div class="content"><article class="post__article"> |
| + | </br></br> |
| <h2>Basic Parts</h2> | | <h2>Basic Parts</h2> |
| <h3>Review previous parts</h3> | | <h3>Review previous parts</h3> |
| <p> | | <p> |
- | ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br> | + | ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.<br><a name="#dianweidian2"></a> |
| From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai) | | From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (<a href="http://parts.igem.org/Part:BBa_K771002" target="_blank">BBa_K771002</a>, SJTU-BioX-Shanghai) |
| </p> | | </p> |
Line 38: |
Line 97: |
| <h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3> | | <h3>FL3-TALE<a href="http://parts.igem.org/Part:BBa_K1453300" target="_blank">(BBa_K1453300)</a></h3> |
| <center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center> | | <center><img src="https://static.igem.org/mediawiki/parts/7/73/Fl3tal.png" width=400px></img></center> |
| + | </br><center><small><strong>Figure 2.3.1 Diagram of FL3-TALE</strong></small></center></br> |
| <p> | | <p> |
| This is a TALE protein with a flexible linker 3 before it. <br> | | This is a TALE protein with a flexible linker 3 before it. <br> |
| + | </p> |
| + | <p> |
| Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br> | | Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.<br> |
| | | |
| </p> | | </p> |
| + | |
| + | |
| + | |
| + | |
| | | |
| <h3>Connector</h3> | | <h3>Connector</h3> |
| <p> | | <p> |
- | We have four types of connector.</p> | + | We have four types of connector. |
- | <center><img src="https://static.igem.org/mediawiki/2014/0/0a/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-17_%E4%B8%8B%E5%8D%883.30.10.png" width= 800px></img></center> | + | <br> |
| + | <center><img src="https://static.igem.org/mediawiki/2014/f/fb/4plasmid.png" width= 800px></img></center> |
| + | </br><center><small><strong>Figure 2.3.2 Diagram of four types of connector: pBluescript II KS(+) ScaI deletion, </strong></small></center> |
| + | </br><center><small><strong>pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy and pBluescript II KS(+)_5_copy</strong></small></center></br> |
| + | <p> |
| + | pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453901" target="_blank">(BBa_K1453901)</a> |
| + | </p> |
| + | <p> |
| + | pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453001" target="_blank">(BBa_K1453001)</a> |
| + | </p> |
| + | <p> |
| + | pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453003" target="_blank">(BBa_K1453003)</a> |
| + | </p> |
| + | <p> |
| + | pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453004" target="_blank">(BBa_K1453004)</a> |
| + | </p> |
| | | |
- | <center><img src="https://static.igem.org/mediawiki/2014/b/b1/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-17_%E4%B8%8B%E5%8D%883.30.16.png" width= 800px></img></center> | + | <p> |
| + | Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br> |
| + | <br> |
| + | </p> |
| | | |
| + | <h3>ssDsbA-mRFP-Lgt-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453005" target="_blank">(BBa_K1453005)</a></h3> |
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/4/41/Membrane_TAL1.png" width=800px></img></center> |
| + | </br><center><small><strong>Figure 2.3.3 Diagram of ssDsbA-mRFP-Lgt-TAL1-His Tag</strong></small></center></br> |
| <p> | | <p> |
| + | The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats |
| + | protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. |
| <br> | | <br> |
- | pBluescript II KS(+) ScaI deletion <a href="http://parts.igem.org/Part:BBa_K1453301" target="_blank">(BBa_K1453301)</a><br>
| + | </p> |
- | pBluescript II KS(+) EcoRV deletion <a href="http://parts.igem.org/Part:BBa_K1453302" target="_blank">(BBa_K1453302)</a><br>
| + | <br> |
- | pBluescript II KS(+)_3_copy <a href="http://parts.igem.org/Part:BBa_K1453303" target="_blank">(BBa_K1453303)</a> <br>
| + | <br> |
- | pBluescript II KS(+)_5_copy <a href="http://parts.igem.org/Part:BBa_K1453304" target="_blank">(BBa_K1453304)</a> <br>
| + | <h3>TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453007" target="_blank">(BBa_K1453007)</a></h3> |
- | Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.<br>
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/e/e6/Free_TAL1.png" width=400px></img></center> |
| + | </br><center id="dianweidian9"><small><strong>Figure 2.3.4 Diagram of TAL1-His Tag</strong></small></center></br> |
| + | <p> |
| + | This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test. |
| + | </p> |
| + | <p> |
| + | The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. |
| <br> | | <br> |
| </p> | | </p> |
| | | |
| + | |
| + | |
| + | |
| + | <br> |
| <h2>USB</h2> | | <h2>USB</h2> |
| <p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p> | | <p>We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.</p> |
| <h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3> | | <h3>TAL USB<a href="http://parts.igem.org/Part:BBa_K1453000" target="_blank">(BBa_K1453000)</a></h3> |
| <center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center> | | <center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width= 800px></img></center> |
| + | |
| + | </br><center><small><strong>Figure 2.3.5 Diagram of TAL USB</strong></small></center></br> |
| <p> | | <p> |
| We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB. | | We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB. |
| </p> | | </p> |
- | <h3>Enzyme USB</h3> | + | <h3>Enzyme USB<a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a></h3> |
| + | |
| + | <br> |
| <p> | | <p> |
| In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p> | | In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker. </p> |
| <center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center> | | <center><img src="https://static.igem.org/mediawiki/parts/5/5c/Aari.png" width=400px></img></center> |
| <center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center> | | <center><img src="https://static.igem.org/mediawiki/parts/9/91/Bsmai.png" width=400px></img></center> |
| + | </br><center><small><strong>Figure 2.3.6 Diagram of two kinds of enzyme USB: AarI and BsmBI</strong></small></center></br> |
| <p> | | <p> |
| | | |
Line 78: |
Line 184: |
| On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p> | | On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.</p><p> |
| When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p> | | When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.</p> |
| + | |
| + | <br> |
| + | |
| + | <h3>TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453006" target="_blank">(BBa_K1453006)</a></h3> |
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/0/0d/FL-TAL_USB-His_Tag.png" width=400px></img></center> |
| + | </br><center><small><strong>Figure 2.3.7 Diagram of TAL_USB-His Tag</strong></small></center></br> |
| <p> | | <p> |
| + | In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI. |
| + | <p> |
| + | When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095) |
| <br> | | <br> |
- | <a href="http://parts.igem.org/Part:BBa_K1453400" target="_blank">(BBa_K1453400)</a><br>
| |
- | <a href="http://parts.igem.org/Part:BBa_K1453401" target="_blank">(BBa_K1453401)</a><br>
| |
| </p> | | </p> |
| | | |
| + | <br> |
| | | |
| + | <h3>ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453402" target="_blank">(BBa_K1453402)</a></h3> |
| | | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/f/fe/3402.png" width=800px></img></center> |
| + | </br><center><small><strong>Figure 2.3.8 Diagram of ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br> |
| + | <p> |
| + | This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai. |
| + | <br> |
| + | </p> |
| | | |
| + | <br> |
| | | |
| | | |
| + | <h3>ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453403" target="_blank">(BBa_K1453403)</a></h3> |
| | | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/2/29/3403.png" width=800px></img></center> |
| + | </br><center><small><strong>Figure 2.3.9 Diagram of ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br> |
| + | <p> |
| + | This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai. |
| + | <br> |
| + | </p> |
| + | |
| + | <br> |
| + | |
| + | |
| + | |
| + | <h3>Enzyme USB(BsmAI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453406" target="_blank">(BBa_K1453406)</a></h3> |
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/4/4a/3406.png" width=400px></img></center> |
| + | </br><center><small><strong>Figure 2.3.10 Diagram of Enzyme USB(BsmAI)-TAL_USB-His Tag</strong></small></center></br> |
| + | <p> |
| + | This part is the combination of BBa_K1453401 and BBa_K1453006. |
| + | <br> |
| + | </p> |
| + | |
| + | <br> |
| + | |
| + | |
| + | <h3 id="dianweidian14">Enzyme USB(AarI)-TAL_USB-His Tag<a href="http://parts.igem.org/Part:BBa_K1453407" target="_blank">(BBa_K1453407)</a></h3> |
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/0/09/3407.png" width=400px></img></center> |
| + | </br><center><small><strong>Figure 2.3.11 Diagram of Enzyme USB(AarI)-TAL_USB-His Tag</strong></small></center></br> |
| + | <p> |
| + | This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai. |
| + | <br> |
| + | </p> |
| + | |
| + | <br> |
| + | |
| + | <h2>Application</h2> |
| + | <p> |
| + | We chose some functional enzymes and inserted them into <strong><em>connectees</em></strong> |
| + | <br> |
| + | We want to prove that our <strong><em>connectees and connectors</em></strong> system can successfully achieve our designed function in the end. |
| + | <br> |
| + | </p> |
| + | |
| + | <h3>ssDsbA-Lgt-pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453404" target="_blank">(BBa_K1453404)</a></h3> |
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/9/93/3404.png" width=800px></img></center> |
| + | </br><center><small><strong>Figure 2.3.12 Diagram of ssDsbA-Lgt-pykF-TAL1-His Tag</strong></small></center></br> |
| + | <p> |
| + | This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF. |
| + | <br> |
| + | </p> |
| + | |
| + | <br> |
| + | |
| + | <h3>ssDsbA-Lgt-poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453405" target="_blank">(BBa_K1453405)</a></h3> |
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/a/ab/3405.png" width=800px></img></center> |
| + | </br><center><small><strong>Figure 2.3.13 Diagram of ssDsbA-Lgt-poxB-TAL1-His Tag</strong></small></center></br> |
| + | <p> |
| + | This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB |
| + | <br> |
| + | </p> |
| + | |
| + | <br> |
| + | |
| + | <h3>pykF-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453408" target="_blank">(BBa_K1453408)</a></h3> |
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/f/ff/3408.png" width=400px></img></center> |
| + | </br><center><small><strong>Figure 2.3.14 Diagram of pykF-TAL1-His Tag</strong></small></center></br> |
| + | <p> |
| + | This part is used in our application test free in the cytoplasm. |
| + | </p> |
| + | <p> |
| + | This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF. |
| + | <br> |
| + | </p> |
| + | |
| + | <br> |
| + | |
| + | |
| + | <h3>poxB-TAL1-His Tag<a href="http://parts.igem.org/Part:BBa_K1453409" target="_blank">(BBa_K1453409)</a></h3> |
| + | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/7/7e/3409.png" width=400px></img></br><p id="dianweidian10"></p></center> |
| + | </br><center><small><strong>Figure 2.3.15 Diagram of poxB-TAL1-His Tag</strong></small></center></br> |
| + | <p > |
| + | This part is used in our application test free in the cytoplasm. |
| + | </p> |
| + | <p> |
| + | This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB |
| + | </p> |
| + | <br> |
| | | |
| | | |
Line 97: |
Line 311: |
| | | |
| <h2>New TAL</h2> | | <h2>New TAL</h2> |
| + | <h3>New TAL with better sticky ends<a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a> |
| + | <a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(501)</a> |
| + | <a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(502)</a> |
| + | <a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(503)</a> |
| + | <a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(504)</a> |
| + | <a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(505)</a> |
| + | <a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(506)</a></h3> |
| <p> | | <p> |
| We design seven new sticky ends which get the least score when judging the similarity.<br> | | We design seven new sticky ends which get the least score when judging the similarity.<br> |
Line 104: |
Line 325: |
| <p> | | <p> |
| <br> | | <br> |
- | <a href="http://parts.igem.org/Part:BBa_K1453500" target="_blank">(BBa_K1453500)</a>
| + | |
- | <a href="http://parts.igem.org/Part:BBa_K1453501" target="_blank">(BBa_K1453501)</a>
| + | |
- | <a href="http://parts.igem.org/Part:BBa_K1453502" target="_blank">(BBa_K1453502)</a><br>
| + | |
- | <a href="http://parts.igem.org/Part:BBa_K1453503" target="_blank">(BBa_K1453503)</a>
| + | |
- | <a href="http://parts.igem.org/Part:BBa_K1453504" target="_blank">(BBa_K1453504)</a>
| + | |
- | <a href="http://parts.igem.org/Part:BBa_K1453505" target="_blank">(BBa_K1453505)</a><br>
| + | |
- | <a href="http://parts.igem.org/Part:BBa_K1453506" target="_blank">(BBa_K1453506)</a><br>
| + | |
| </p> | | </p> |
| + | <p > |
| + | <b>PART-left:</b><br> |
| + | …CTGACCCCGGAGACG |
| + | </p> |
| + | <p> |
| + | <b>PART1(150bp):</b><br> |
| + | CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG |
| + | CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT |
| + | CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG</p> |
| + | <p> |
| + | <b>PART2(219bp):</b><br> |
| + | CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG |
| + | GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA |
| + | AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG |
| + | CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG</p> |
| + | <p> |
| + | <b>PART3(262bp):</b><br> |
| + | CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG |
| + | TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT |
| + | GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC |
| + | ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA |
| + | AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG</p></center> |
| + | <p> |
| + | |
| + | <b>PART4(224bp):</b><br> |
| + | CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT |
| + | GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG |
| + | TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA |
| + | CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA<br> |
| + | GACG |
| + | </p> |
| + | <p> |
| + | <b>PART5(194bp):</b><br> |
| + | CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC |
| + | CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC |
| + | TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA<br> |
| + | TCGGCGGCAAACAGGCACTCGATGAGACG |
| + | </p> |
| + | <p> |
| + | <b>PART6(249bp):</b><br> |
| + | CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC |
| + | TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT |
| + | GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG |
| + | GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG<br> |
| + | TGCAACGCCTCTTGCCAGTTTTAGAGACG</p> |
| + | <p> |
| + | |
| + | <b>PART-right:</b><br> |
| + | CGTCTCATTTTGTGTCAGGCCCACGGA...</p><br> |
| + | |
| + | |
| + | <p> |
| + | The recognition sequence of the TALE protein: |
| + | <center><font size="5" color="red">TCGATATCAAGC</font></center></p> |
| + | <div class="default" id="default"> |
| + | <groupparts>iGEM014 SJTU-BioX-Shanghai</groupparts> |
| + | </div> |
| </article> | | </article> |
| </div> | | </div> |
| + | |
| </html> | | </html> |
- | <groupparts>iGEM012 SJTU-BioX-Shanghai</groupparts>
| + | |
| {{Team:SJTU-BioX-Shanghai/footer}} | | {{Team:SJTU-BioX-Shanghai/footer}} |