"
Team:The Tech Museum/Notebook
From 2014.igem.org
(Difference between revisions)
| (10 intermediate revisions not shown) | |||
| Line 8: | Line 8: | ||
<tr> | <tr> | ||
<td colspan="3" valign="top"> | <td colspan="3" valign="top"> | ||
| - | <p>Timeline of major events:<br> | + | <p><b>Timeline of major events:</b><br></p> |
| - | May: Basic concept research and design<br> | + | <p><UL><LI>May: Basic concept research and design<br> |
| - | June: Software development initiated; plasmid design started and promoter-RBS’s picked<br> | + | <LI>June: Software development initiated; plasmid design started and promoter-RBS’s picked<br> |
| - | July: Wetlab testing of possible color protein combinations<br> | + | <LI>July: Wetlab testing of possible color protein combinations<br> |
| - | August 10: Design of complete tri-color plasmids finalized<br> | + | <LI>August 10: Design of complete tri-color plasmids finalized<br> |
| - | August 24: Assembly of tri-color plasmid pools completed (DNA2.0)<br> | + | <LI>August 24: Assembly of tri-color plasmid pools completed (DNA2.0)<br> |
| - | September 10: Tri-color plasmids optimized on museum wetlab setup<br> | + | <LI>September 10: Tri-color plasmids optimized on museum wetlab setup<br> |
| - | September 29: Software fully integrated with hardware on mobile exhibit<br> | + | <LI>September 29: Software fully integrated with hardware on mobile exhibit<br> |
| - | September 30 - October 3: Prototyping of mobile exhibit with museum staff and visitors<br> | + | <LI>September 30 - October 3: Prototyping of mobile exhibit with museum staff and visitors<br> |
| - | October 6 - October 17: Data collection on the museum floor with visitor!</p> | + | <LI>October 6 - October 17: Data collection on the museum floor with visitor!</UL></p><br> |
| - | <p><b>Biology Details</b></p> | + | <p><b>Biology Details:</b></p> |
| - | <p>Design of tri-color plasmid pool | + | <p>Design of tri-color plasmid pool <br> |
| - | 9 promoter-rbs pairs of varying strength from Kosuri et al paper (2013):< | + | <UL><LI>9 promoter-rbs pairs of varying strength from Kosuri et al paper (2013):</UL> |
<table border="1" cellpadding="0" cellspacing="0"> | <table border="1" cellpadding="0" cellspacing="0"> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td width="25"></td> |
<td>Promoter - RBS Pairs</td> | <td>Promoter - RBS Pairs</td> | ||
| - | <td>Sequence</td> | + | <td valign="top">Sequence</td> |
</tr> | </tr> | ||
| + | <br> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>1</td> |
| - | <td> | + | <td>BBa_J23117 - BBa_J61112</td> |
| - | <td> | + | <td>TTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCCAATCTCTAGAGAAAGAGGTGACATAC</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>2</td> |
| - | <td> | + | <td>BBa_J23104 - BBa_J61107</td> |
| - | <td> | + | <td>TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGCTTACGTCTAGAGAAAGAAGAGACTCAC</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>3</td> |
| - | <td> | + | <td>apFAB78 - apFAB954</td> |
| - | <td> | + | <td>TTGACATTTATCCCTTGCGGCGATAGATTTAACGTATGACGGATCTTAATCTAGCTCAGGACAATTT</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>4</td> |
| - | <td> | + | <td>apFAB76 - apFAB927</td> |
| - | <td> | + | <td>TTGACATTTATCCCTTGCGGCGATATAATAGATATCTTAATCTAGCCCGGGAGTTTTTTCATTCCGGATCTTAATCTAGCTGGGGACTGTTT</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>5</td> |
| - | <td> | + | <td>apFAB70 - apFAB844</td> |
| - | <td> | + | <td>TTGACATCGCATCTTTTTGTACCTATAATGTGTGGATAGAGTATCTTAATCTAGCAGGGGACACTTT</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>6</td> |
| - | <td> | + | <td>BBa_J23104 - apFAB909</td> |
| - | <td> | + | <td>TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGCTTACGATCTTAATCTAGCGAAGGATAGTTT</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>7</td> |
| - | <td> | + | <td>apFAB45 - apFAB901</td> |
| - | <td> | + | <td>AAAAAGAGTATTGACTTCGCATCTTTTTGTACCTATAATGTGTGGATAGCGG</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>8</td> |
| - | <td> | + | <td>apFAB92 - apFAB863</td> |
| - | <td> | + | <td>AAAAAATTTATTTGCTTTCAGGAAAATTTTTCTGCATAATTATTTCATGGAGCATCTTAATCTAGCGGGGGAGCGTTT</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| - | <td></td> | + | <td>9</td> |
| - | <td> | + | <td>apFAB71 - salis-4-10</td> |
| - | <td> | + | <td>TTGACATCGCATCTTTTTGTACCTATAATAGATTCATGATGAAATCTCTTTTATCAAATATAAGCAGGAT</td> |
</tr> | </tr> | ||
</table> | </table> | ||
| + | <br> | ||
| + | |||
| + | <p>Selection of colored reporter proteins <br> | ||
| + | <UL><LI>Co-transformation testing of multiple color combinations of proteins from DNA2.0<br> | ||
| + | <LI>Transformations on Kanamycin and IPTG</UL><br></p> | ||
| + | <center><img src="https://static.igem.org/mediawiki/2014/6/6c/Tech_Museum_Chromo-Testing.png" width="800"><br><br> | ||
| + | <img src="https://static.igem.org/mediawiki/2014/1/12/Tech_Museum_Fluoro-Testing.png" width="800"><br><br></center> | ||
| + | <p>Final tri-color plasmid designs, assembled by DNA2.0:</p> | ||
| + | <p>Chromogenic plasmid pool <br> | ||
| + | <UL><LI>Blitzen (blue) <br> | ||
| + | <LI>Kringle (yellow)<br> | ||
| + | <LI>Paprika (red)</UL></p> | ||
| + | <p>Fluorescent plasmid pool<br> | ||
| + | <UL><LI>CindyLouCFP (400/495)<br> | ||
| + | <LI>KringleYFP (520/542)<br> | ||
| + | <LI>PaprikaRFP (554/590)</UL></p> | ||
| + | |||
| + | <p>Optimization of plasmid pools with visitor-accessible museum wetlab set up. Transformation condition:<br> | ||
| + | <UL><LI>6cm plates<br> | ||
| + | <LI>400 ug/ml Amp<br> | ||
| + | <LI>0.3 ul unamplified plasmid pool in 100ul CaCl2<br> | ||
| + | <LI>20 ul competent bacteria<br> | ||
| + | <LI>Current visitor wetlab transformation protocol: 30 sec on ice, 40 sec heat shot at 42 degrees C<br> | ||
| + | <LI>Chromogenic pool maturation time ~ 5 days 37 degrees C<br> | ||
| + | <LI>Fluoroescent pool maturation time ~ 3 days 37 degrees C<br> | ||
| + | <LI>Low copy fluorescent plasmid pool gave more reliable results with most color variety </UL></p><br> | ||
| + | <p><b>Safety:</b><br></p> | ||
| + | <p>We did not use any dangerous organisms or reagents. Transformation of bacteria was done in the musuem’s existing wetlab setup. </p> | ||
Latest revision as of 21:14, 17 October 2014
| ||||||||||||||||||||||||||||||||||
Notebook | ||||||||||||||||||||||||||||||||||
|
Timeline of major events:
Biology Details: Design of tri-color plasmid pool
Selection of colored reporter proteins
  Final tri-color plasmid designs, assembled by DNA2.0: Chromogenic plasmid pool
Fluorescent plasmid pool
Optimization of plasmid pools with visitor-accessible museum wetlab set up. Transformation condition:
Safety: We did not use any dangerous organisms or reagents. Transformation of bacteria was done in the musuem’s existing wetlab setup. |
||||||||||||||||||||||||||||||||||
