Team:Duke/Parts

From 2014.igem.org

(Difference between revisions)
 
(17 intermediate revisions not shown)
Line 1: Line 1:
{{Template:Team:Duke/CSS}}
{{Template:Team:Duke/CSS}}
{{Template:Team:DukeMenu/CSS}}
{{Template:Team:DukeMenu/CSS}}
 +
{{Template:Team:DukeParts/CSS}}
<html>
<html>
 +
<div class="parts">
 +
 +
<!--https://2014.igem.org/File:4oo8doudna.png-->
 +
 +
 +
<h2> Construction Background </h2>
<h2> Construction Background </h2>
-
Some flow this summer showed that pdCas9 with crRNA targeting this GFP1 sequence repressed nicely (as did GFP3 but not GFP2) so we picked this one to try making decoys for. The actual sequence is the 20bp of GFP1, the PAM, and then 10 more bp of spacer that come from the GFP orf. We added the spacer reasoning that dCas9 occupies space outside of just the 20bp matching crRNA, and after eyeballing the crystal structure 4008.pdb (which should be referenced & pictured) it looked like we needed about enough space for 1 additional turn of DNA outside of the 20bp. 10.5bp is ~1 turn, 3 bp is taken care of by PAM, so we added 10 to be safe.
+
 
 +
<p>During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.</p>
 +
<table>
 +
<tr><td><span style="font-weight:bold">Sequence</span></td> <td><span style="font-weight:bold">Ungated Mean</span></td><td><span style="font-weight:bold">Fluorescence Relative to Reporter-Only</span></td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>Reporter</td><td>43.7</td><td>1</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>DH5alpha ZI (no GFP background)</td> <td>0.16</td><td>0.003661327231</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>dCas9</td><td>42.73333333</td><td>0.9778794813</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP1 (ccatctaattcaacaagaat)</td><td>13.4</td><td>0.3066361556</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP2 (agtagtgcaaataaatttaa)</td><td>48.6</td><td>1.112128146</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP3 (gtagtgacaagtgttggcca)</td><td>15.43333333</td><td>0.3531655225</td></tr>
 +
</table>
 +
 
 +
<!--<table>
 +
<tr><td>Sequence</td> <td>Ungated Mean</td></tr>
 +
<tr><td>DH5alpha ZI</td> <td>0.16</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td> <td>0.003661327231</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>Reporter</td><td>43.7</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>1</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>dCas9</td><td>42.73333333</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>0.9778794813</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP1 (ccatctaattcaacaagaat)</td><td>13.4</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>0.3066361556</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP2 (agtagtgcaaataaatttaa)</td><td>48.6</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>1.112128146</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP3 (gtagtgacaagtgttggcca)</td><td>15.43333333</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>0.3531655225</td></tr>
 +
</table>-->
 +
<p>We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:</p>
 +
 
 +
<p>PCR1: oligos with prefix-decoy-spacer (top strand), decoy-spacer-decoy (top strand), and spacer-decoy-spacer (bottom strand) are combined and cycled 35 times resulting in a mixture of products</p>
 +
<!--https://2014.igem.org/File:Parts1.png-->
 +
<img src="https://static.igem.org/mediawiki/2014/5/5b/Parts1.png" />
 +
<p>PCR2: the products of PCR1 are used as a template for a bottom strand oligo that appends the BioBrick suffix and cycles 35 times. </p>
 +
<!--https://2014.igem.org/File:DukeParts2.png-->
 +
<img src="https://static.igem.org/mediawiki/2014/4/40/DukeParts2.png" />
 +
<p>The products of PCR2 are inserted in to pSB1C3 via Gibson assembly</p>
 +
<!--https://2014.igem.org/File:Parts3.png-->
 +
<img src="https://static.igem.org/mediawiki/2014/3/34/Parts3.png" />
 +
<p>These constructs can be expanded further by serial digestion/ligation</p>
 +
<!--https://2014.igem.org/File:Parts4.png-->
 +
<img src="https://static.igem.org/mediawiki/2014/c/cf/Parts4.png" />
 +
<p>From our PCR-based construction scheme we isolated 1x and 6x decoys, and then expanded the 6x array to 12x. These parts were submitted to the registry as BBa_K1545000 BBa_K1545001  and BBa_K1545001</p>
 +
 
 +
<img src="https://static.igem.org/mediawiki/2014/3/3b/4oo8doudna.png" />
 +
<p>Crystal structure 4OO8 from the Doudna Lab. Cas9 is in blue, gRNA in red, and the DNA to which the complex binds is in yellow. <a href="http://www.ncbi.nlm.nih.gov/pubmed/24529477">Click for the PubMed article</a>. </p>
 +
 
 +
 
 +
 
<br />
<br />
-
<groupparts>iGEM013 Duke</groupparts>
+
<h3>Parts Submitted to the Parts Registry </h3>
 +
<groupparts><a href="http://parts.igem.org/Part:BBa_K1545000">BBa_K1545000</a></groupparts> <br />
 +
<groupparts><a href="http://parts.igem.org/Part:BBa_K1545001">BBa_K1545001</a></groupparts> <br />
 +
<groupparts><a href="http://parts.igem.org/Part:BBa_K1545002">BBa_K1545002</a></groupparts>
 +
 
 +
</div>
</html>
</html>

Latest revision as of 03:53, 18 October 2014

Construction Background

During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.

Sequence Ungated MeanFluorescence Relative to Reporter-Only
Reporter43.71
DH5alpha ZI (no GFP background) 0.160.003661327231
dCas942.733333330.9778794813
GFP1 (ccatctaattcaacaagaat)13.40.3066361556
GFP2 (agtagtgcaaataaatttaa)48.61.112128146
GFP3 (gtagtgacaagtgttggcca)15.433333330.3531655225

We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:

PCR1: oligos with prefix-decoy-spacer (top strand), decoy-spacer-decoy (top strand), and spacer-decoy-spacer (bottom strand) are combined and cycled 35 times resulting in a mixture of products

PCR2: the products of PCR1 are used as a template for a bottom strand oligo that appends the BioBrick suffix and cycles 35 times.

The products of PCR2 are inserted in to pSB1C3 via Gibson assembly

These constructs can be expanded further by serial digestion/ligation

From our PCR-based construction scheme we isolated 1x and 6x decoys, and then expanded the 6x array to 12x. These parts were submitted to the registry as BBa_K1545000 BBa_K1545001 and BBa_K1545001

Crystal structure 4OO8 from the Doudna Lab. Cas9 is in blue, gRNA in red, and the DNA to which the complex binds is in yellow. Click for the PubMed article.


Parts Submitted to the Parts Registry

BBa_K1545000
BBa_K1545001
BBa_K1545002

Retrieved from "http://2014.igem.org/Team:Duke/Parts"