Team:Duke/Parts

From 2014.igem.org

(Difference between revisions)
 
(24 intermediate revisions not shown)
Line 1: Line 1:
{{Template:Team:Duke/CSS}}
{{Template:Team:Duke/CSS}}
 +
{{Template:Team:DukeMenu/CSS}}
 +
{{Template:Team:DukeParts/CSS}}
<html>
<html>
-
<style type="text/css">
+
<div class="parts">
-
#groupparts {text-align: center; margin-left: auto; margin-right: auto;}
+
-
</style>
+
-
<!--main content -->
+
-
<table width="70%" align="center">
+
 +
<!--https://2014.igem.org/File:4oo8doudna.png-->
-
<!--welcome box -->
 
-
<tr>
 
-
<td style="border:1px solid black;" colspan="3" align="center" height="150px" bgColor=#FF404B>
 
-
<h1 >WELCOME TO iGEM 2014! </h1>
 
-
<p>Your team has been approved and you are ready to start the iGEM season!
 
-
<br>On this page you can document your project, introduce your team members, document your progress <br> and share your iGEM experience with the rest of the world! </p>
 
-
<br>
 
-
<p style="color:#E7E7E7"> <a href="https://2014.igem.org/wiki/index.php?title=Team:Duke/Parts&action=edit"style="color:#FFFFFF"> Click here  to edit this page!</a> </p>
 
-
</td>
 
-
</tr>
 
-
<tr> <td colspan="3"  height="5px"> </td></tr>
 
-
<!-- end welcome box -->
 
-
<tr>
 
-
<!--navigation menu -->
+
<h2> Construction Background </h2>
-
<td align="center" colspan="3">
+
-
<table  width="100%">
+
<p>During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.</p>
-
<tr heigth="15px"></tr>
+
<table>
-
<tr heigth="75px">  
+
<tr><td><span style="font-weight:bold">Sequence</span></td> <td><span style="font-weight:bold">Ungated Mean</span></td><td><span style="font-weight:bold">Fluorescence Relative to Reporter-Only</span></td></tr>
-
 
+
<tr><td></td><td></td></tr>
-
 
+
<tr><td>Reporter</td><td>43.7</td><td>1</td></tr>
-
<td style="border:1px solid black;" align="center" height ="45px" onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>
+
<tr><td></td><td></td></tr>
-
<a href="https://2014.igem.org/Team:Duke"style="color:#000000">Home </a> </td>
+
<tr><td>DH5alpha ZI (no GFP background)</td> <td>0.16</td><td>0.003661327231</td></tr>
-
 
+
<tr><td></td><td></td></tr>
-
<td style="border:1px solid black;" align="center" height ="45px" onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>  
+
<tr><td>dCas9</td><td>42.73333333</td><td>0.9778794813</td></tr>
-
<a href="https://2014.igem.org/Team:Duke/Team"style="color:#000000"> Team </a> </td>
+
<tr><td></td><td></td></tr>
-
 
+
<tr><td>GFP1 (ccatctaattcaacaagaat)</td><td>13.4</td><td>0.3066361556</td></tr>
-
<td style="border:1px solid black;" align="center"  height ="45px"  onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>  
+
<tr><td></td><td></td></tr>
-
<a href="https://igem.org/Team.cgi?year=2014&team_name=Duke"style="color:#000000"> Official Team Profile </a></td>
+
<tr><td>GFP2 (agtagtgcaaataaatttaa)</td><td>48.6</td><td>1.112128146</td></tr>
-
 
+
<tr><td></td><td></td></tr>
-
<td style="border:1px solid black" align="center"  height ="45px" onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>
+
<tr><td>GFP3 (gtagtgacaagtgttggcca)</td><td>15.43333333</td><td>0.3531655225</td></tr>
-
<a href="https://2014.igem.org/Team:Duke/Project"style="color:#000000"> Project</a></td>
+
-
 
+
-
<td style="border:1px solid black;" align="center"  height ="45px" onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>  
+
-
<a href="https://2014.igem.org/Team:Duke/Parts"style="color:#000000"> Parts</a></td>
+
-
 
+
-
<td style="border:1px solid black;" align="center" height ="45px" onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>  
+
-
<a href="https://2014.igem.org/Team:Duke/Modeling"style="color:#000000"> Modeling</a></td>
+
-
 
+
-
<td style="border:1px solid black;" align="center" height ="45px" onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>
+
-
<a href="https://2014.igem.org/Team:Duke/Notebook"style="color:#000000"> Notebook</a></td>
+
-
 
+
-
<td style="border:1px solid black;" align="center"  height ="45px" onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>  
+
-
<a href="https://2014.igem.org/Team:Duke/Safety"style=" color:#000000"> Safety </a></td>
+
-
 
+
-
<td style="border:1px solid black;" align="center"  height ="45px" onMouseOver="this.bgColor='#d3d3d3'" onMouseOut="this.bgColor='#e7e7e7'" bgColor=#e7e7e7>  
+
-
<a href="https://2014.igem.org/Team:Duke/Attributions"style="color:#000000"> Attributions </a></td>
+
-
 
+
-
 
+
-
<td align ="center"> <a href="https://2014.igem.org/Main_Page"> <img src="https://static.igem.org/mediawiki/igem.org/6/60/Igemlogo_300px.png" width="55px"></a> </td>
+
-
</tr>
+
</table>
</table>
-
<!--end navigation menu -->
+
<!--<table>
-
</tr>
+
<tr><td>Sequence</td> <td>Ungated Mean</td></tr>
 +
<tr><td>DH5alpha ZI</td> <td>0.16</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td> <td>0.003661327231</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>Reporter</td><td>43.7</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>1</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>dCas9</td><td>42.73333333</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>0.9778794813</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP1 (ccatctaattcaacaagaat)</td><td>13.4</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>0.3066361556</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP2 (agtagtgcaaataaatttaa)</td><td>48.6</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>1.112128146</td></tr>
 +
<tr><td></td><td></td></tr>
 +
<tr><td>GFP3 (gtagtgacaagtgttggcca)</td><td>15.43333333</td></tr>
 +
<tr><td>fluorescence relative to reporter-only</td><td>0.3531655225</td></tr>
 +
</table>-->
 +
<p>We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:</p>
 +
<p>PCR1: oligos with prefix-decoy-spacer (top strand), decoy-spacer-decoy (top strand), and spacer-decoy-spacer (bottom strand) are combined and cycled 35 times resulting in a mixture of products</p>
 +
<!--https://2014.igem.org/File:Parts1.png-->
 +
<img src="https://static.igem.org/mediawiki/2014/5/5b/Parts1.png" />
 +
<p>PCR2: the products of PCR1 are used as a template for a bottom strand oligo that appends the BioBrick suffix and cycles 35 times. </p>
 +
<!--https://2014.igem.org/File:DukeParts2.png-->
 +
<img src="https://static.igem.org/mediawiki/2014/4/40/DukeParts2.png" />
 +
<p>The products of PCR2 are inserted in to pSB1C3 via Gibson assembly</p>
 +
<!--https://2014.igem.org/File:Parts3.png-->
 +
<img src="https://static.igem.org/mediawiki/2014/3/34/Parts3.png" />
 +
<p>These constructs can be expanded further by serial digestion/ligation</p>
 +
<!--https://2014.igem.org/File:Parts4.png-->
 +
<img src="https://static.igem.org/mediawiki/2014/c/cf/Parts4.png" />
 +
<p>From our PCR-based construction scheme we isolated 1x and 6x decoys, and then expanded the 6x array to 12x. These parts were submitted to the registry as BBa_K1545000 BBa_K1545001  and BBa_K1545001</p>
-
</tr>
+
<img src="https://static.igem.org/mediawiki/2014/3/3b/4oo8doudna.png" />  
-
+
<p>Crystal structure 4OO8 from the Doudna Lab. Cas9 is in blue, gRNA in red, and the DNA to which the complex binds is in yellow. <a href="http://www.ncbi.nlm.nih.gov/pubmed/24529477">Click for the PubMed article</a>. </p>
-
</td>
+
<br />
 +
<h3>Parts Submitted to the Parts Registry </h3>
 +
<groupparts><a href="http://parts.igem.org/Part:BBa_K1545000">BBa_K1545000</a></groupparts> <br />
 +
<groupparts><a href="http://parts.igem.org/Part:BBa_K1545001">BBa_K1545001</a></groupparts> <br />
 +
<groupparts><a href="http://parts.igem.org/Part:BBa_K1545002">BBa_K1545002</a></groupparts>
-
<tr> <td colspan="3"  height="15px"> </td></tr>
+
</div>
-
<tr><td bgColor="#e7e7e7" colspan="3" height="1px"> </tr>
+
-
<tr> <td colspan="3"  height="5px"> </td></tr>
+
-
 
+
-
 
+
-
<!--Parts Submitted to the Registry  -->
+
-
<tr><td > <h3> Parts Submitted to the Registry </h3></td>
+
-
<td ></td >
+
-
<td > <h3>What information do I need to start putting my parts on the Registry? </h3></td>
+
-
</tr>
+
-
<tr>
+
-
<td width="45%"  valign="top">
+
-
<p>
+
-
An important aspect of the iGEM competition is the use and creation of standard  biological parts. Each team will make new parts during iGEM and will submit them to the <a href="http://partsregistry.org"> Registry of Standard Biological Parts</a>. The iGEM software provides an easy way to present the parts your team has created. The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. 
+
-
 
+
-
<p>
+
-
<strong>Note that if you want to document a part you need to document it on the <a href="http://partsregistry.org Registry"> Registry</a>, not on your team wiki.</strong> Future teams and other users and are much more likely to find parts on the Registry than on your team wiki.
+
-
</p>
+
-
 
+
-
<p>
+
-
Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without a need to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.
+
-
</p>
+
-
 
+
-
 
+
-
 
+
-
<h3>When should you put parts into the Registry?</h3>
+
-
 
+
-
<p>
+
-
As soon as possible! We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better recall you will have of all details surrounding your parts. Remember you don't need to send us the DNA to create an entry for a part on the Registry. However, you must send us the sample/DNA before the Jamboree. Only parts for which you have sent us samples/DNA are eligible for awards and medal requirements.
+
-
</p>
+
-
</td>
+
-
 
+
-
<td > </td>
+
-
<td width="45%" valign="top">
+
-
 
+
-
<p>
+
-
The information needed to initially create a part on the Registry is:
+
-
</p>
+
-
<ol>
+
-
 
+
-
<li>Part Name</li>
+
-
<li>Part type</li>
+
-
<li>Creator</li>
+
-
<li>Sequence</li>
+
-
<li>Short Description (60 characters on what the DNA does)</li>
+
-
<li>Long Description (Longer description of what the DNA does)</li>
+
-
<li>Design considerations</li>
+
-
</ol>
+
-
 
+
-
<p>
+
-
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. Check out part <a href="http://parts.igem.org/Part:BBa_K404003">BBa_K404003</a> for an excellent example of a highly characterized part.
+
-
</p>
+
-
 
+
-
<p>
+
-
You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry"> Add a Part to the Registry</a> link.
+
-
</p>
+
-
</td>
+
-
</tr>
+
-
 
+
-
 
+
-
<tr> <td colspan="3"  height="15px"> </td></tr>
+
-
 
+
-
<tr><td colspan="3" > <h3> Parts Table</h3></td></tr>
+
-
 
+
-
 
+
-
<tr><td width="45%" colspan="3"  valign="top">
+
-
Any parts your team has created will appear in this table below:</td></tr>
+
-
 
+
-
</table>
+
</html>
</html>
-
 
-
<groupparts>iGEM013 Duke</groupparts>
 

Latest revision as of 03:53, 18 October 2014

Construction Background

During the summer we tested repression of GFP (pSB6A1-K608012) by pdCas9 with crRNA targeting the sequences below.

Sequence Ungated MeanFluorescence Relative to Reporter-Only
Reporter43.71
DH5alpha ZI (no GFP background) 0.160.003661327231
dCas942.733333330.9778794813
GFP1 (ccatctaattcaacaagaat)13.40.3066361556
GFP2 (agtagtgcaaataaatttaa)48.61.112128146
GFP3 (gtagtgacaagtgttggcca)15.433333330.3531655225

We chose to first test decoy binding sites for GFP1 crRNA and designed an assembly scheme that proceeds as follows:

PCR1: oligos with prefix-decoy-spacer (top strand), decoy-spacer-decoy (top strand), and spacer-decoy-spacer (bottom strand) are combined and cycled 35 times resulting in a mixture of products

PCR2: the products of PCR1 are used as a template for a bottom strand oligo that appends the BioBrick suffix and cycles 35 times.

The products of PCR2 are inserted in to pSB1C3 via Gibson assembly

These constructs can be expanded further by serial digestion/ligation

From our PCR-based construction scheme we isolated 1x and 6x decoys, and then expanded the 6x array to 12x. These parts were submitted to the registry as BBa_K1545000 BBa_K1545001 and BBa_K1545001

Crystal structure 4OO8 from the Doudna Lab. Cas9 is in blue, gRNA in red, and the DNA to which the complex binds is in yellow. Click for the PubMed article.


Parts Submitted to the Parts Registry

BBa_K1545000
BBa_K1545001
BBa_K1545002

Retrieved from "http://2014.igem.org/Team:Duke/Parts"