Team:Aachen/Notebook/Wetlab/July
From 2014.igem.org
AZimmermann (Talk | contribs) (Created page with "__NOTOC__ {{Team:Aachen/Header}} = July = == 1st == * transformation efficiency kit is broken → run an agarose gel with the kit plasmids to check for nuclease activity/ ban...") |
(→25th) |
||
(42 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
__NOTOC__ | __NOTOC__ | ||
+ | {{CSS/Main}} | ||
+ | {{Team:Aachen/Stylesheet}} | ||
{{Team:Aachen/Header}} | {{Team:Aachen/Header}} | ||
+ | |||
+ | <html> | ||
+ | <center> | ||
+ | <ul class="menusmall-grid"> | ||
+ | |||
+ | <!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> --> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | </ul> | ||
+ | </center> | ||
+ | </html> | ||
= July = | = July = | ||
Line 16: | Line 90: | ||
** K1319042: 2.5 | ** K1319042: 2.5 | ||
* made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc | * made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc | ||
+ | <center> | ||
+ | {{Team:Aachen/Figure|Aachen_14-07-03_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 first try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5% agar. A) befor induction with IPTG B) 1 h after induction C) 4.5 h after induction a) induced with 2x 2 µl 1 mM IPTG b) induced with 2x 2 µl 10 mM IPTG c) induced with 2x 2 µl 0.1 mM IPTG d) induced with 2x 2 µl 100 mM IPTG|width=900px}} | ||
+ | </center> | ||
* print K1319042 Chip on LB plate | * print K1319042 Chip on LB plate | ||
* overnight culture of E0030 for plasmid prep | * overnight culture of E0030 for plasmid prep | ||
Line 33: | Line 110: | ||
== 9th == | == 9th == | ||
* made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc | * made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc | ||
+ | <center> | ||
+ | {{Team:Aachen/Figure|Aachen_14-07-09_M9_iLOV_serie.png|title=Sensor Chips with K1319042 in M9 second try|subtitle=Sensor chips with K1319042 in M9 medium with 1,5% agar. A) befor induction with IPTG B) 1.5 h after induction C) 3 h after induction a) induced with 2x 2 µl 1 mM IPTG b) induced with 2x 2 µl 10 mM IPTG c) induced with 2x 2 µl 0.1 mM IPTG d) induced with 2x 2 µl 100 mM IPTG|width=900px}} | ||
+ | </center> | ||
* made OmpA-linker_iLOV 3A-Assambley | * made OmpA-linker_iLOV 3A-Assambley | ||
* colony PCR | * colony PCR | ||
Line 59: | Line 139: | ||
***pSEVE641_BsFbFP pSEVA234_LasR | ***pSEVE641_BsFbFP pSEVA234_LasR | ||
***pSEVE641_BsFbFP pSB1C3_C0179 | ***pSEVE641_BsFbFP pSB1C3_C0179 | ||
- | * made chips with K1319042 in Hartman, Hartman + 20 | + | * made chips with K1319042 in Hartman, Hartman + 20% glycerol, M9 medium images were taken every 30 min with the Geldoc |
+ | * The PCR of Biobrick E0030 in vector pSB1C3 with primers for RFC 25 was made. The expected length is | ||
+ | ** forward primer EYFP_RFC25_F: ACGTTGAATTCGCGGCCGCTTCTAGATGGCCGGCGTGAGCAAGGGCGAGGAG | ||
+ | ** rewerse primer EYFP_RFC25_R: ATCCTGCAGCGGCCGCTACTAGTATTAACCGGTGTACAGCTCGTCCATGC | ||
+ | * PCR product gets number K1319000 | ||
+ | |||
+ | |||
+ | <center> | ||
+ | {| class="wikitable" | ||
+ | ! step !! temperature [°C] !! duration | ||
+ | |- | ||
+ | | denature || 94 || 60" | ||
+ | |- | ||
+ | | denature || 94 || 30" | ||
+ | |- | ||
+ | | anneal || 50/60,4/64,9 || 30" | ||
+ | |- | ||
+ | | elongate || 72 || 60" | ||
+ | |- | ||
+ | | elongate || 72 || 5' | ||
+ | |- | ||
+ | | store || 8 || indefinite | ||
+ | |} | ||
+ | </center> | ||
+ | |||
+ | * The agarose gel with PCR product was made. Expected length is 778 kb. | ||
+ | |||
+ | <center> | ||
+ | {{Team:Aachen/Figure|Aachen_14-09-17_E0030_with_RFC25.png|title=Agarose gel with PCR products after PCR from E0030 to K1319000 |width=400px}} | ||
+ | </center> | ||
+ | * as it can be seen on the picture PCR worked with all annealing temperatures, all samples were used for a transformation in DH5α after the restriction with DpnI. | ||
+ | |||
+ | == 17th == | ||
+ | * the PCR product was purificated and the concentration was measured. | ||
+ | * Restriktion of PCR product for the insert and E0030 for the vector with ''Eco''RI and PstI with following purification from agarose gel was made. | ||
+ | |||
+ | == 21st == | ||
+ | * the ligation of PCR product (K1319000) and the vector that was purified from agarose (from E0030) was made. | ||
+ | * ligated product was tranformed in DH5α. | ||
== 22nd == | == 22nd == | ||
Line 67: | Line 185: | ||
== 23rd == | == 23rd == | ||
- | * made 25 new HM+C plates with 1 | + | * made 25 new HM+C plates with 1% agar and 4 g/L glucose |
- | * | + | * added 170 µL of the glucose stock (500 g/L) to the glucose-free HM+C-plates |
* 1 L of sterile HM+glucose was prepared | * 1 L of sterile HM+glucose was prepared | ||
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5 mL HM+C+Glucose precultures were inoculated (17:00) | * K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5 mL HM+C+Glucose precultures were inoculated (17:00) | ||
Line 76: | Line 194: | ||
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20 mL supplement stock solution that can be added to 1x HM media | * Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20 mL supplement stock solution that can be added to 1x HM media | ||
+ | <center> | ||
{| class="wikitable" | {| class="wikitable" | ||
|- | |- | ||
Line 88: | Line 207: | ||
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L | | CaCl{{sub|2}} || 0.011 || 0.1 mmol/L | ||
|} | |} | ||
- | + | </center> | |
- | We made 250 mL of HM+C+Glucose+Supplements plates with 1.5 | + | The powders for 1 L of 1x HM were dissolved in 20 mL of a 10% w/v Casamino acid stock solution and filter-sterilized (.22 µm PES). To make agar chips, we can add 1 mL to the hot agar mixture, together with the three 500 µL 100x stocks for the HM. |
+ | |||
+ | We made 250 mL of HM+C+Glucose+Supplements plates with 1.5% agar. | ||
Then we plated the following combinations: | Then we plated the following combinations: | ||
+ | <center> | ||
{| class="wikitable" | {| class="wikitable" | ||
|- | |- | ||
Line 102: | Line 224: | ||
| J23101.E0240 || + || + | | J23101.E0240 || + || + | ||
|} | |} | ||
+ | </center> | ||
We also prepared a 150 mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th. | We also prepared a 150 mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th. | ||
Line 110: | Line 233: | ||
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR: | The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, we set up a colony PCR: | ||
+ | <center> | ||
{| class="wikitable" | {| class="wikitable" | ||
|- | |- | ||
Line 128: | Line 252: | ||
| 7 || water || none || | | 7 || water || none || | ||
|} | |} | ||
+ | </center> | ||
Reaction volume per tube was 15 µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below: | Reaction volume per tube was 15 µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below: | ||
+ | <center> | ||
{| class="wikitable" | {| class="wikitable" | ||
! parameter !! duration !! temp [°C] | ! parameter !! duration !! temp [°C] | ||
|- | |- | ||
- | | denature||10:00||95 | + | | denature || 10:00 || 95 |
|- | |- | ||
- | | '''denature'''||00:30||95 | + | | '''denature''' || 00:30 || 95 |
|- | |- | ||
- | | '''anneal'''||00:30||49 | + | | '''anneal''' || 00:30 || 49 |
|- | |- | ||
- | | '''elongate'''||02:36||72 | + | | '''elongate''' || 02:36 || 72 |
|- | |- | ||
- | | elongate||05:00||72 | + | | elongate || 05:00 || 72 |
|- | |- | ||
- | | store||forever||8 | + | | store || forever|| 8 |
|} | |} | ||
+ | </center> | ||
We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3 mL instead of 1.5 mL culture medium and eluted twice with 25 µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit]. | We mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3 mL instead of 1.5 mL culture medium and eluted twice with 25 µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit]. | ||
Line 151: | Line 278: | ||
The resulting DNA concentrations are listed in this table: | The resulting DNA concentrations are listed in this table: | ||
+ | <center> | ||
{| class="wikitable" | {| class="wikitable" | ||
! clone # !! concentration [ng/µl] | ! clone # !! concentration [ng/µl] | ||
Line 166: | Line 294: | ||
| 6 || 138 | | 6 || 138 | ||
|} | |} | ||
+ | </center> | ||
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.) | In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, we re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.) | ||
+ | <center> | ||
{| class="wikitable" | {| class="wikitable" | ||
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements | ! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements | ||
Line 174: | Line 304: | ||
| J23101.E0240 || NEB10β || ++ || - || ++ | | J23101.E0240 || NEB10β || ++ || - || ++ | ||
|- | |- | ||
- | | K1319042 || | + | | K1319042 || DH5α || ++ || - || (+) |
|- | |- | ||
| K131026 || NEB10β || ++ || - || - | | K131026 || NEB10β || ++ || - || - | ||
|- | |- | ||
- | | K131026 || | + | | K131026 || DH5α || ++ || - || + |
|} | |} | ||
+ | </center> | ||
We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements. | We inoculated J23101.E0240 in LB and HM+C+Glucose+supplements. | ||
Line 188: | Line 319: | ||
== 29th == | == 29th == | ||
* inoculate 2x 150 ml cultures HM+Glucose+C | * inoculate 2x 150 ml cultures HM+Glucose+C | ||
- | * prepared 200 ml 1.5 | + | * prepared 200 ml 1.5% agar |
* pre-cool centrifuge | * pre-cool centrifuge | ||
* centrifuge 1x 50, 1x 100 and 1x 150 ml | * centrifuge 1x 50, 1x 100 and 1x 150 ml | ||
Line 202: | Line 333: | ||
+ | <html> | ||
+ | <center> | ||
+ | <ul class="menusmall-grid"> | ||
+ | |||
+ | <!-- <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/March" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to March</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/7/7a/Aachen_14-10-10_March_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> --> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to April</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to May</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to June</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to July</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to August</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to September</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | <li style="width:106px;margin-left: 12px;margin-right: 12px;" > | ||
+ | <a class="menulink" href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"> | ||
+ | <div class="menusmall-item menusmall-info" style="height:100px; width: 100px;" ><div class="menukachel" style="top: 30%; font-size: 16px;">Go to October</div></div> | ||
+ | <div class="menusmall-item menusmall-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%; height:100px; width: 100px;"> | ||
+ | </div> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | </ul> | ||
+ | </center> | ||
+ | </html> | ||
{{Team:Aachen/Footer}} | {{Team:Aachen/Footer}} |
Latest revision as of 16:16, 17 October 2014
|