Team:Aachen/Notebook/Wetlab

From 2014.igem.org

(Difference between revisions)
(Our Work in the Lab)
 
(64 intermediate revisions not shown)
Line 1: Line 1:
 +
__NOTOC__
 +
{{CSS/Main}}
 +
{{Team:Aachen/Stylesheet}}
{{Team:Aachen/Header}}
{{Team:Aachen/Header}}
 +
<span id="partners"></span>
-
__TOC__
+
=Our Work in the Lab=
-
= April =
+
<center>
-
== 1st ==
+
<html><ul class="team-grid" style="width:1064px;">
-
'''Organization'''
+
<!-- Overview -->
-
where to get:
+
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;">
-
* key cards and keys for the lab
+
<a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black">
-
* cooled centifuge
+
    <div class="team-item team-info" style="width:214px;height:214px;" >
-
* space in -80&nbsp;°C
+
      <br/><br/>
-
* bottles for 70&nbsp;% ethanol
+
<b>
-
* ... (problems of a first year team ^^)
+
preparation of competent cells
 +
<br/><br/>
 +
test on transformation efficiency
 +
<br/><br/>
 +
development of quenchers
 +
</b>
 +
      <br/><br/>
 +
      <!-- click for more information -->
 +
    </div>
 +
    <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a>
 +
  </li>
-
== 12th ==
+
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;">
-
* chemically competent NEB Top10, DH5α and BL21 were made
+
<a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black">
 +
    <div class="team-item team-info" style="width:214px;height:214px;" >
 +
      <br/><br/>
 +
<b>
 +
development of quenchers
 +
<br/><br/>
 +
first transformation of BioBricks
 +
<br/><br/>
 +
test of BioBricks
 +
</b>
 +
      <br/><br/>
 +
      <!-- click for more information -->
 +
    </div>
 +
    <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a>
 +
  </li>
-
== 15th ==
+
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;">
-
* 800&nbsp;ml LB for plates with 1.5% agar and kanamycin (50&nbsp;µg/L) were prepared([[User:StefanReinhold|Stefan]])
+
<a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black">
-
* efficiency of our competent cells was tested([[User:aschechtel|Anna]])
+
    <div class="team-item team-info" style="width:214px;height:214px;" >
-
Colonies on the agar plates were counted after transformation with 1&nbsp;µl DNA 147&nbsp;ng/µl and afterwards incubated in SOC or LB medium.
+
      <br/><br/>
-
{| class="wikitable"
+
<b>
-
! Dilution !! 200&nbsp;µl (stock) !! 100&nbsp;µl (stock) !! 1:5 !! 1:10 !! 1:100
+
BioBrick transformation marathon
-
|-
+
<br/><br/>
-
|  '''DH5α''' || SOC: 30 LB: 10 ||SOC: 7 LB: 1 || SOC: 1 LB: 2 || SOC: 2 LB: 1 ||
+
construction of first own BioBrick
-
|-
+
<br/><br/>
-
| '''NEB Top 10''' || SOC: 170 LB: 135 ||SOC: 100 LB: 79 || SOC: 25 LB: 22 || SOC: 9 LB: 9 || SOC: 1 LB:0
+
processing of Biobricks
-
|-
+
</b>
-
|}
+
      <br/><br/>
-
* BL21 cells were centrifuged and plated. Only 128 colonies grew in total indicating a very bad efficiency (~482.11).
+
      <!-- click for more information -->
 +
    </div>
 +
    <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a>
 +
  </li>
-
following formula was used to calculate the efficiency:
+
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;">
-
efficiency = (CFU /µg DNA) / dilution
+
<a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black">
-
* for DH5α: medial efficiency in SOC: 1864.36 and in LB: 440.68
+
    <div class="team-item team-info" style="width:214px;height:214px;" >
-
* for NEB: medial efficiency in SOC: 6779.66 and in LB: 4698.30
+
      <br/><br/>
-
*:'''Higher efficiency when using SOC!'''
+
<b>
 +
preparation of 2D-detection chips
 +
<br/><br/>
 +
testing our chip system
 +
<br/><br/>
 +
development of chip measurement methods
 +
</b>
 +
      <br/><br/>
 +
      <!-- click for more information -->
 +
    </div>
 +
    <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a>
 +
  </li>
-
== 22th ==
+
</ul></html>
 +
</center>
-
'''Pcq lab PCR'''  advanced primus 25, 96
+
<center>
-
{| class="wikitable"
+
<html><ul class="team-grid" style="width:798px;">
-
!  !! Lenght [bp] !! % GC !! T<sub>m</sub> !! T<sub>A</sub>
+
<!-- Overview -->
-
|-
+
-
|  '''EYFP_RFC25''' || 778 || 61 || 84 || 56
+
-
|-
+
-
| '''REACh1_C''' || 481 || 62 || 84 || 57
+
-
|-
+
-
| '''REACh1_N''' || 320 || 59 || 82 || 54
+
-
|-
+
-
| '''REACh2_C''' || 487 || 62 || 83 || 57
+
-
|-
+
-
| '''REACh2_N''' || 320 || 59 || 82 || 54
+
-
|-
+
-
|}
+
-
Program name IGEM.cyc
+
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;">
 +
<a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black">
 +
    <div class="team-item team-info" style="width:214px;height:214px;" >
 +
      <br/><br/>
 +
<b>
 +
start of Gal3 approach
 +
<br/><br/>
 +
detection of HSL with chip system
 +
<br/><br/>
 +
testing of <i> Pseudomonas fluorescens </i>
 +
</b>
 +
      <br/><br/>
 +
      <!-- click for more information -->
 +
    </div>
 +
    <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a>
 +
  </li>
-
{| class="wikitable"
+
  <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;">
-
! Parameter !! Duration !! Temp [°C]
+
<a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black">
-
|-
+
    <div class="team-item team-info" style="width:214px;height:214px;" >
-
| Denature||10:00||98
+
      <br/><br/>
-
|-
+
<b>
-
| '''Denature'''||00:30||98
+
interlab study
-
|-
+
<br/><br/>
-
| '''Anneal'''||00:30||52
+
construction of GFP-quencher-fusions
-
|-
+
<br/><br/>
-
| '''Elongate'''||02:36||72
+
further devolopment of BioBricks
-
|-
+
</b>
-
| Elongate||05:00||72
+
      <br/><br/>
-
|-
+
      <!-- click for more information -->
-
| Store||forever||8
+
    </div>
-
|}
+
    <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a>
-
 
+
   </li>
-
# RFC25_F RFC25_R
+
-
# RFC25_F REACh1_R
+
-
# REACh1_F RFC25_R
+
-
# RFC25_F REACh2_R
+
-
# REACh2_F RFC25_R
+
-
 
+
-
== 23th ==
+
-
* 5&nbsp;µl of the PCR products were run on a 1,5% agarose gel
+
-
* DNA bands were purified from gel with the High Pure Product Purification Kit. Full length contaminated with REACh1
+
-
 
+
-
 
+
-
*'''SOE'''
+
-
* ca. 30&nbsp;ng/µL
+
-
 
+
-
{| class="wikitable"
+
-
!  !! 20x !! -> 20&nbsp;µL thereof: 30x
+
-
|-
+
-
| '''HF'''||10||10
+
-
|-
+
-
| '''dNTP'''||4||4
+
-
|-
+
-
| '''template'''||2x 1||10
+
-
|-
+
-
| '''Phusion'''||0.5||0.5
+
-
|-
+
-
| '''primer'''||-||2x 2.5
+
-
|-
+
-
| '''water'''||33.5||21.5
+
-
|}
+
-
 
+
-
'''Anneling''': 52&nbsp;°C
+
-
 
+
-
'''Elongation''': 20 sec
+
-
 
+
-
 
+
-
*'''PCR with Phusion polymerase'''
+
-
{| class="wikitable"
+
-
!  !!volume [µL]
+
-
|-
+
-
| '''HF'''||10
+
-
|-
+
-
| '''dNTP'''||4
+
-
|-
+
-
| '''template'''||1
+
-
|-
+
-
| '''Phusion'''||0.5
+
-
|-
+
-
| '''primer'''||2x 2.5
+
-
|-
+
-
| '''water'''||29.5
+
-
|-
+
-
| '''total'''||50
+
-
|}
+
-
 
+
-
*'''Digestion for restriction with NEB enzymes'''
+
-
{| class="wikitable"
+
-
!  !!volume
+
-
|-
+
-
| '''destination vector'''||500&nbsp;ng
+
-
|-
+
-
| '''EcoRI-HF'''||1&nbsp;µL
+
-
|-
+
-
| '''PstI'''||1&nbsp;µL
+
-
|-
+
-
| '''10x NEB Buffer 2.1'''||5&nbsp;µL
+
-
|-
+
-
| '''water'''||???&nbsp;µL
+
-
|-
+
-
| '''total'''||???&nbsp;µL
+
-
|}
+
-
* ligation with NEB Kit
+
-
 
+
-
== 28th ==
+
-
*[[User:aschechtel|Anna]] measured the DNA concentration of SOE2 after purification
+
-
*:# 57&nbsp;ng/µL
+
-
*:# 69.5&nbsp;ng/µL
+
-
 
+
-
== 29th ==
+
-
*'''PCR SOE1 and SOE2'''
+
-
 
+
-
== 30th ==
+
-
* PAGE of the SOE2 products were run on agarose gel for checking
+
-
*: &rarr; no positive results; only full length products were amplified
+
-
 
+
-
 
+
-
 
+
-
* SOE PCRs was run again
+
-
*: &rarr; more template
+
-
*: &rarr; hot start
+
-
*: &rarr; faster
+
-
*: &rarr; elongation: 15 min
+
-
*: &rarr; 20 cycles
+
-
 
+
-
* '''SOE1'''
+
-
template A+B &rarr; 20&nbsp;µL &rarr; <u>13.8 + 6.2</u> <u>5.3 + 14.7</u>
+
-
 
+
-
{| class="wikitable"
+
-
!  !!volume [µL]
+
-
|-
+
-
| '''HF'''||10
+
-
|-
+
-
| '''dNTP'''||4
+
-
|-
+
-
| '''template'''||20
+
-
|-
+
-
| '''Phusion'''||0.5
+
-
|-
+
-
| '''water'''||13.5
+
-
|}
+
-
 
+
-
* '''SOE2'''
+
-
 
+
-
= May =
+
-
== 1st ==
+
-
* gel with M - full -full - REACh1 SOE3.2 - REACH2 SOE3.2 - M
+
-
*: &rarr; 120&nbsp;V, 30 min
+
-
*: &rarr; cut out the bands
+
-
 
+
-
== 5th ==
+
-
 
+
-
* [[User:aschechtel|Anna]] made chemical competent DH5α and BL21 cells
+
-
 
+
-
== 8th ==
+
-
* efficiency of our competent cells was tested
+
-
*: &rarr; BL21: 6.6 x 10<sup>4</sup>
+
-
*: &rarr; DH5α: 2.59 x 10<sup>7</sup>
+
-
* SOE-PCR step 2 like on 30.04. with the template of SOE1 from 30.04. was re-done
+
-
* SOE2 product was run on a gel for checking (5&nbsp;µL)
+
-
*: &rarr; restriction, (dephosphorylation of vector)
+
-
*: &rarr; purification on a gel with high pure kit
+
-
 
+
-
== 14th ==
+
-
* [[User:fgohr|Florian]] made some LB agar plates with chloramphenicol and some with ampicillin
+
-
* REACh2 purification on 1.2&nbsp;% agarose gel
+
-
* subsequent purification of the 778 bp fragment with High Pure PCR Product Purification Kit
+
-
 
+
-
== 19th ==
+
-
* transformation of K131026 in DH5α and NEB
+
-
* transformation of K731520 in DH5α
+
-
 
+
-
== 20th ==
+
-
* [[User:StefanReinhold|Stefan]] made master plates on chloramphenicol (cam) &rarr; at least 6 clones on each plate
+
-
* [[User:StefanReinhold|Stefan]] prepared 2x 5&nbsp;mL LB + cam
+
-
* [[User:aschechtel|Anna]] made sterile 50&nbsp;% glycerol
+
-
 
+
-
== 21th ==
+
-
* Cryo stocks of clones 1 & 2 of each BioBrick/ host were prepared
+
-
* 15&nbsp;mL cultures in 250&nbsp;mL flasks, inoculated with 1.5&nbsp;mL preculture (3 cultures A B C from clones 1; 1 + 2; 2)
+
-
* 250&nbsp;µl Chloramphilicol from a 35&nbsp;mg/mL stock was added
+
-
* The cultures were grown until OD<sub>600</sub>= 0.6, then one was induced with IPTG
+
-
{| class="wikitable"
+
-
! time !! colspan="3" | info/ OD
+
-
|-
+
-
| '''11:10'''||A: inoculated ||B: inoculated ||C: inoculated
+
-
|-
+
-
| '''11:38'''||A: 0.482 ||B: 0.464 ||C: 0.466
+
-
|-
+
-
| '''12:28'''||A: 0.586; induced with 0.1&nbsp;mM IPTG ||B: 0.576 ||C: 0.568
+
-
|-
+
-
| '''14:11'''||A: 0.93 ||B: 0.91 ||C: 0.942
+
-
|}
+
-
&rarr; a negative control without plasmid was left out
+
-
 
+
-
== 23rd ==
+
-
* transformation of some BioBricks
+
-
* colony PCR (s. picture below)
+
-
*: &rarr; K131026: 1807&nbsp;bp
+
-
*: &rarr; K731520: 2123&nbsp;bp
+
-
*: &rarr; full length EYFP: 778&nbsp;bp
+
-
{{Team:Aachen/Figure|Aachen_14-05-23_COLONY-PCR.jpg|title=Colony PCR |subtitle=todo|width=300px}}
+
-
 
+
-
{{Team:Aachen/JumpUp}}
+
-
 
+
-
= June =
+
-
== 3rd ==
+
-
* transformation of 34 BioBricks
+
-
 
+
-
== 4th ==
+
-
 
+
-
* preperation of consumables:
+
-
** fresh 50&nbsp;% glycerol
+
-
** new LB plates with cam and with kanamycin (kan)
+
-
** 60 glas tubes
+
-
** 2&nbsp;L LB<sup>-</sup>
+
-
** 100&nbsp;mL steril glas beads for plating
+
-
 
+
-
* master plates (6 clones per BioBrick) were made
+
-
 
+
-
== 5th ==
+
-
* colony PCRs on all transformed BioBricks were conducted
+
-
*: &rarr; 2 clones from each master plate were picked
+
-
* overnight cultures in freshly prepared 5&nbsp;mL LB + cam were inoculated
+
-
*: &rarr; 1 culture per BioBrick
+
-
 
+
-
== 6th ==
+
-
* made 2 glycerol stocks of each BioBrick
+
-
 
+
-
== 14th ==
+
-
'''PCR of E0030 to K1319000'''
+
-
* Q5 and Phusion polymerase are used
+
-
{| class="wikitable"
+
-
! parameter !! duration !! temp [°C]
+
-
|-
+
-
| denature||5:00||98
+
-
|-
+
-
| '''denature'''||00:30||98
+
-
|-
+
-
| '''anneal'''||00:30||55
+
-
|-
+
-
| '''elongate'''||00:50||72
+
-
|-
+
-
| elongate||05:00||72
+
-
|}
+
-
&rarr; 30 cycles
+
-
 
+
-
== 17th ==
+
-
* colony PCR on following constructs:
+
-
{| class="wikitable"
+
-
|-
+
-
! ID !! Colonie !! Product Length
+
-
|-
+
-
| 1, 2 || K1319000 || 1041
+
-
|-
+
-
| 3, 4 || J23115.E0240 || 1233
+
-
|-
+
-
| 5, 6|| C0062 || 2937
+
-
|-
+
-
| 7, 8 || K516032 || 1219
+
-
|-
+
-
| 9, 10 || J23101.E0240 || 1233
+
-
|-
+
-
| 11 || negativ control || -
+
-
|}
+
-
&rarr; anneling: 50°C
+
-
 
+
-
&rarr; elongation: 02:57
+
-
 
+
-
== 20th ==
+
-
* [[User:VeraA|Vera]] did colony PCR of K325108, K325218, C0062
+
-
 
+
-
{| class="wikitable"
+
-
! parameter !! duration !! temp [°C]
+
-
|-
+
-
| denature||5:00||95
+
-
|-
+
-
| '''denature'''||00:30||95
+
-
|-
+
-
| '''anneal'''||00:30||49
+
-
|-
+
-
| '''elongate'''||03:15||72
+
-
|-
+
-
| elongate||05:00||72
+
-
|}
+
-
&rarr; 30 cycles
+
-
* PAGE: 30 min on 1.2&nbsp;% agarose gel at 110&nbsp;V
+
-
&rarr; weak bands for K325108 a & b at 4.5&nbsp;kb and 9&nbsp;kb respectively
+
-
 
+
-
== 23rd ==
+
-
* repetition of yesterdays colony PCR
+
-
* preculture for plasmid prep were inoculated
+
-
** K1319000 &rarr; sequencing
+
-
** K592100 &rarr; BFP
+
-
** S01022 &rarr; CFP
+
-
** J23101.E0240 &rarr; sequencing
+
-
** J23115.E0240 &rarr; sequencing
+
-
* K516132 and J23101.E0240 were plated on LB + cam plates
+
-
 
+
-
== 24th ==
+
-
* 8 plasmid preps were conducted
+
-
* overnight cultures of K516132 and J23101.E0240 were inoculated
+
-
 
+
-
== 25th ==
+
-
* preculture for competent NEB10β cells was set up
+
-
* samples for sequencing were submitted
+
-
* master plates of transformed BioBricks were made
+
-
* overnight expression cultures of J23101.E0240 and K516132 were centrifuged and frozen
+
-
* fresh 50% glycerol was prepared
+
-
 
+
-
== 26th ==
+
-
* Competent NEB10β cells were made, however, several things went wrong. (For future reference: pre-cool centrifuge, always check if it is indeed spinning, frequently check OD of the culture)
+
-
* Colony PCR on the transformed clones looked awful; there were too many cells in the 10&nbsp;µL reaction volume. Some tubes were not fully sealed during the PCR. Basically, ''only'' primers and smear, except for the positive control, which contained a plasmid template instead of cells.
+
-
* 2x 500&nbsp;mL of fresh LB and three sterile flasks were prepared and autoclaved.
+
-
 
+
-
== 27th ==
+
-
* plasmid preps
+
-
{| class="wikitable"
+
-
|-
+
-
! Plasmid !! DNA [ng/µl]
+
-
|-
+
-
| J23115.E0240 #1 || 99
+
-
|-
+
-
| J23115.E0240 #2 || 226
+
-
|-
+
-
| K1319000 #6 || 78
+
-
|-
+
-
| K1319000 #1 || 221
+
-
|-
+
-
| K592100 || 240.5
+
-
|-
+
-
| S01022 || 160
+
-
|-
+
-
| J23101.E0240 #5 || 347
+
-
|-
+
-
| J23101.E0240 #6 || 229.5
+
-
|}
+
-
* two cryos stocks of each were prepared
+
-
 
+
-
== 28th ==
+
-
* sequencing
+
-
* transformation of 17 BioBricks
+
-
 
+
-
== 30th ==
+
-
* master plates
+
-
 
+
-
= July =
+
-
== 1st ==
+
-
* transformation efficiency kit is broken
+
-
&rarr; run an agarose gel with the kit plasmids to check for nuclease activity/ bands
+
-
* inventory of the -80°C freezer was done
+
-
 
+
-
== 2nd ==
+
-
* overnight cultures (LB) of K731520 and K1319042 for chips were inoculated
+
-
 
+
-
== 3rd ==
+
-
* ODs of the overnight culture of
+
-
** K731520: 2.3
+
-
** K1319042: 2.5
+
-
* [[User:Aschechtel|Anna]] made chips with K1319042 and K731520 in NA and M9 medium. Images were taken every 30 min with the GelDoc
+
-
* print K1319042 Chip on LB plate
+
-
* overnight culture of E0030 for plasmid prep
+
-
 
+
-
== 4th ==
+
-
* plasmid prep of E0030: 159.5 ng/µl (concentration)
+
-
* print of K1319042 Chip on LB plate made 1 and 7 colonies
+
-
 
+
-
== 7th ==
+
-
* 13 Biobricks were transformed
+
-
* overnight culture of K103006 for a plasmid prep was inoculated
+
-
* colony PCR master mix was prepared
+
-
 
+
-
== 8th ==
+
-
* overnight culture of K1319042 for chips was inoculated
+
-
 
+
-
== 9th ==
+
-
* [[User:Aschechtel|Anna]] made chips with K1319042 in M9, M9 + casamino acids, Hartman medium (HM). Images were taken every 30 min with the Geldoc
+
-
* [[User:VeraA|Vera]] made OmpA-linker_iLOV 3A-Assambley
+
-
* colony PCR
+
-
* transformation for backbones
+
-
 
+
-
== 10th ==
+
-
* master plates of the strains for backbone isolation
+
-
 
+
-
== 14th ==
+
-
* [[User:Aschechtel|Anna]] built again J23115.E0240 for interlab study
+
-
 
+
-
== 15th ==
+
-
* [[User:Pdemling|Philipp]] made 500&nbsp;ml LB and LB plates
+
-
* [[User:fgohr|Florian]] and [[User:StefanReinhold|Stefan]] made the transformation of J23115.E0240
+
-
* overnight culture of K1319042 for chips
+
-
 
+
-
== 16th ==
+
-
* did plasmid preps
+
-
* transformation of different reporter strains
+
-
** NEB
+
-
***pSEVE641_BsFbFP
+
-
***pSEVA234_LasR
+
-
***pSEVE641_BsFbFP pSEVA234_LasR
+
-
***pSEVE641_BsFbFP pSB1C3_C0179
+
-
**BL21
+
-
***pSEVE641_BsFbFP pSEVA234_LasR
+
-
***pSEVE641_BsFbFP pSB1C3_C0179
+
-
* [[User:Aschechtel|Anna]] made chips with K1319042 in Hartman, Hartman + 20&nbsp;% glycerol, M9 medium images were taken every 30 min with the Geldoc
+
-
 
+
-
== 22nd ==
+
-
* [[User:Pdemling|Philipp]] and [[User:mosthege|Michael]] made 100x stocks for Hartmans minimal medium.
+
-
* [[User:mosthege|Michael]] and [[User:VeraA|Vera]] made about 25 HM+C plates without glucose.
+
-
* K1319042 was plated on a HM+C plate
+
-
 
+
-
== 23rd ==
+
-
* [[User:mosthege|Michael]] made 25 new HM+C plates with 1&nbsp;% agar and 4&nbsp;g/L glucose
+
-
* He also added 170&nbsp;µL of the glucose stock (500&nbsp;g/L) to the glucose-free HM+C-plates
+
-
* 1&nbsp;L of sterile HM+glucose was prepared
+
-
* K1319042 was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5&nbsp;mL HM+C+Glucose precultures were inoculated (17:00)
+
-
 
+
-
== 24th ==
+
-
* K1319042 did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E.&nbsp;coli'' is missing some vitamins
+
-
* Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20&nbsp;mL supplement stock solution that can be added to 1x HM media
+
-
 
+
-
{| class="wikitable"
+
-
|-
+
-
! Component !! supplement for 1x HM [g/L] !! final 1x concentration
+
-
|-
+
-
| Casamino acids || 2 || 2 g/L
+
-
|-
+
-
| Thiamine hydrochloride || 0.3 || 300 mg/L
+
-
|-
+
-
| MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L
+
-
|-
+
-
| CaCl{{sub|2}} || 0.011 || 0.1 mmol/L
+
-
|}
+
-
The powders for 1&nbsp;L of 1x HM were dissolved in 20&nbsp;mL of a 10&nbsp;%&nbsp;w/v Casamino acid stock solution and filter-sterilized (.22&nbsp;µm PES). To make agar chips, we can add 1&nbsp;mL to the hot agar mixture, together with the three 500&nbsp;µL 100x stocks for the HM.
+
-
 
+
-
We made 250&nbsp;mL of HM+C+Glucose+Supplements plates with 1.5&nbsp;% agar.
+
-
 
+
-
Then we plated the following combinations:
+
-
 
+
-
{| class="wikitable"
+
-
|-
+
-
! Construct !! HM+C+Glucose+Supplements !! LB+C
+
-
|-
+
-
| K1319042 || - || +
+
-
|-
+
-
| J23101.E0240 || + || +
+
-
|}
+
-
 
+
-
We also prepared a 150&nbsp;mL HM+C+Glucose+Supplements culture with K1319042 to hopefully make agar chips on Friday, July 25th.
+
-
 
+
-
Six of last weeks J23115.E0240 clones were plated on LB+C, and 5&nbsp;mL LB+C precultures were inoculated for plasmid preparation.
+
-
 
+
-
== 25th ==
+
-
The K1319042 strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, [[User:mosthege|Michael]] set up a colony PCR:
+
-
 
+
-
{| class="wikitable"
+
-
|-
+
-
! ID !! Template !! Product Length !! Result
+
-
|-
+
-
| 1 || J23101.E0240 #5 || 1233 ||
+
-
|-
+
-
| 2 || J23101.E0240 #6 || 1233 ||
+
-
|-
+
-
| 3 || J23101.E0240 #5 plasmid || 1233 ||
+
-
|-
+
-
| 4 || K1319042 LB colony || 2053  ||
+
-
|-
+
-
| 5 || K1319042 plasmid || 2053 ||
+
-
|-
+
-
| 6 || K731520 GFP plasmid || 2437 ||
+
-
|-
+
-
| 7 || water || none ||
+
-
|}
+
-
 
+
-
Reaction volume per tube was 15&nbsp;µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:
+
-
 
+
-
{| class="wikitable"
+
-
! parameter !! duration !! temp [°C]
+
-
|-
+
-
| denature||10:00||95
+
-
|-
+
-
| '''denature'''||00:30||95
+
-
|-
+
-
| '''anneal'''||00:30||49
+
-
|-
+
-
| '''elongate'''||02:36||72
+
-
|-
+
-
| elongate||05:00||72
+
-
|-
+
-
| store||forever||8
+
-
|}
+
-
 
+
-
[[User:Fgohr|Florian]] mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3&nbsp;mL instead of 1.5&nbsp;mL culture medium and eluted twice with 25&nbsp;µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].
+
-
 
+
-
The resulting DNA concentrations are listed in this table:
+
-
 
+
-
{| class="wikitable"
+
-
! clone # !! concentration [ng/µl]
+
-
|-
+
-
| 1 || 73.5
+
-
|-
+
-
| 2 || 94.5
+
-
|-
+
-
| 3 || 100.5
+
-
|-
+
-
| 4 || 53
+
-
|-
+
-
| 5 || 82
+
-
|-
+
-
| 6 || 138
+
-
|}
+
-
 
+
-
In the evening, we plated some strains on the different media to investigate why the K3139042 did not grow on the HM+suppl. plate. (Note: In the morning, [[User:mosthege|Michael]] re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)
+
-
 
+
-
{| class="wikitable"
+
-
! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements
+
-
|-
+
-
| J23101.E0240 || NEB10β || ++ || - || ++
+
-
|-
+
-
| K1319042 || DH5alpha || ++ || - || (+)
+
-
|-
+
-
| K131026 || NEB10β || ++ || - || -
+
-
|-
+
-
| K131026 || DH5alpha || ++ || - || +
+
-
|}
+
-
 
+
-
[[User:Pdemling|Philipp]] inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.
+
-
 
+
-
<!-- == 28th ==
+
-
IMPORTANT: Look for customs documents and write ZHV lady!!!! -->
+
-
 
+
-
== 29th ==
+
-
* inoculate 2x 150&nbsp;ml cultures HM+Glucose+C
+
-
* prepared 200&nbsp;ml 1.5&nbsp;% agar
+
-
* pre-cool centrifuge
+
-
* centrifuge 1x 50, 1x 100 and 1x 150&nbsp;ml
+
-
* make 3 kinds of chips - OOx1, ODx2, ODx3
+
-
* pre cultures of K1319042 and K131026 in LB
+
-
 
+
-
== 30th ==
+
-
* [[User:Aschechtel|Anna]] made chips with K1319042 and K131026 in HM medium images were taken every 30 min with the Geldoc
+
-
* print chips on LB and LB + Cam , count 10-30 colonies
+
-
 
+
-
== 31th ==
+
-
* [[User:Aschechtel|Anna]] transformed K1319042 and K131026 in DH5α, BL21 and NEB
+
-
 
+
-
= August =
+
-
== 1st ==
+
-
* [[User:StefanReinhold|Stefan]] and [[User:VeraA|Vera]] made electrocompetent ''E.coli'' rosetta cells.
+
-
* [[User:AZimmermann|Arne]] prepared cultures of K1319042 and K131026 for Saturday, August 2nd.
+
-
 
+
-
== 2nd ==
+
-
* tested the OD measurement device and compared it to the spectrophotometer and the plate reader.
+
-
* tested K131026 and K1319042 for fluorescence in the plate reader
+
-
* did a heat shock transformation of I746909 into NEB TOP 10 cells
+
-
* did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta
+
-
 
+
-
== 3rd ==
+
-
* OD measurements of the iGEM device in comparison to the spectrophotometer were taken.
+
-
* cryo cultures of K131026 and K1319042 were prepared
+
-
* master plates of Gal3 #1-#10 and I746909 #1-#4 and overnight cultures
+
-
 
+
-
== 4th ==
+
-
* [[User:AZimmermann|Arne]] and [[User:mosthege|Michael]] made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E.&nbsp;coli'' rosetta (DE3), respectively.
+
-
* [[User:mosthege|Michael]] did a plasmid prep, most of them using 1.5&nbsp;mL culture medium, and eluted with 1x 50&nbsp;µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.
+
-
 
+
-
{| class="wikitable"
+
-
! combination !! concentration [ng/µl]
+
-
|-
+
-
| I746909 BL21 #1 || 73.5
+
-
|-
+
-
| I746909 BL21 #2 || 45
+
-
|-
+
-
| I746909 BL21 #3 || 49
+
-
|-
+
-
| K1319042 DH5alpha || 60
+
-
|-
+
-
| K131026 DH5alpha || 150
+
-
|-
+
-
| pET17-Gal3 #1 || 30.5
+
-
|-
+
-
| pET17-Gal3 #2 || 6.4
+
-
|-
+
-
| pET17-Gal3 #3 || 6.3
+
-
|-
+
-
| pET17-Gal3 #4 || 9.4
+
-
|-
+
-
| pET17-Gal3 #5 || 10.1
+
-
|-
+
-
| pET17-Gal3 #6 || 8.2
+
-
|-
+
-
| pET17-Gal3 #7 || 13.8
+
-
|-
+
-
| pET17-Gal3 #8 || 6.9
+
-
|-
+
-
| pET17-Gal3 #9 || 10.2
+
-
|}
+
-
 
+
-
To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.
+
-
 
+
-
{{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=200px}}
+
-
 
+
-
{| class="wikitable"
+
-
! combination !! cut products[bp]
+
-
|-
+
-
| I746909 BL21 #1 || 2029, 947
+
-
|-
+
-
| K1319042 DH5alpha || 2029, 1780
+
-
|-
+
-
| K131026 DH5alpha || 2029, 1848
+
-
|-
+
-
| pET17-Gal3 #1 || 3086, 923, 1262
+
-
|}
+
-
 
+
-
All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.
+
-
* [[User:AZimmermann|Arne]] prepared an over night cultur of K1319042 for chips
+
-
 
+
-
== 5th ==
+
-
* [[User:StefanReinhold|Stefan]], [[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] assembled a V{{sub|R}}=2.5&nbsp;L bioreactor for cultivation of a 1&nbsp;L expression culture.
+
-
* Two precultures of 20&nbsp;mL LB+A were inoculated at 19:00
+
-
* [[User:Aschechtel|Anna]] transformed K746909 into BL21 cells and K1319000 into NEB10β cells.
+
-
* [[User:Aschechtel|Anna]] made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc
+
-
* [[User:Aschechtel|Anna]] made alliquots of HM, 1&nbsp;L HM + glucose + supplements and 500&nbsp;ml LB
+
-
 
+
-
== 6th ==
+
-
* [[User:Eshani.sood|Eshani]] and [[User:AZimmermann|Arne]] transformed J04450 in pSB1K3 and pSB1A3 in NEB10β cells.
+
-
* They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.
+
-
* [[User:AZimmermann|Arne]] made precultures of NEB10βand DH5 alpha cells
+
-
* [[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] inoculated the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24&nbsp;h.
+
-
 
+
-
== 7th ==
+
-
* [[User:Pdemling|Philipp]] made media for ''Pseudomonas flourescens''
+
-
** Nutrient Broth
+
-
** Pseudomonas-F
+
-
** Pseudomonas-P
+
-
* [[User:aschechtel|Anna]] made 2&nbsp;L LB
+
-
 
+
-
== 8th ==
+
-
* [[User:aschechtel|Anna]] prepared 2x 60&nbsp;ml (LB + cam + IPTG) with K1319042
+
-
* [[User:fgohr|Florian]] prepared 5&nbsp;ml K131026 and C0179
+
-
* [[User:VeraA|Vera]] and [[User:Mosthege|Michael]] made SDS page
+
-
 
+
-
== 9th ==
+
-
* [[User:aschechtel|Anna]] and [[User:fgohr|Florian]] made a plate reader experiment with K131026 in LB and LB + HM
+
-
 
+
-
== 11th ==
+
-
* [[User:aschechtel|Anna]] plated on LB + antibiotics
+
-
** K131026
+
-
** I746909
+
-
** K13190042
+
-
** I04450 in pSB1C3
+
-
** I04450 in pSB1A3
+
-
** I04450 in pSB1K3
+
-
** [[User:fgohr|Florian's]] construct (pSEVA 641_FP pSEVA 234-LasR)
+
-
 
+
-
== 13th ==
+
-
* [[User:Aschechtel|Anna]] made chips with
+
-
** K131026 and I746909 in LB and HM
+
-
** K1319042 and [[User:fgohr|Florians]] two plasmid construct in HM
+
-
* Images were taken every 30 min with the Geldoc
+
-
 
+
-
== 18th ==
+
-
* [[User:Aschechtel|Anna]] made over night cultures of I746909 and K131026 in LB, TB, 2x HM+
+
-
* plated 3x J23101.E0240
+
-
 
+
-
== 19th ==
+
-
* [[User:Aschechtel|Anna]] made Chips with K131026 and I746909 in HM. Images were taken every 30 min with the Geldoc
+
-
* made PCR of J23101.E0240, K1319000, K1319001, K1319002 and run a 1,2&nbsp;% agarose gel
+
-
 
+
-
== 20th ==
+
-
* repeat PCR for REACh1 and J23101.E0240 and run a gel
+
-
* plasmid prep of pSEVA BfsB, pSEVA lasR and I746909
+
-
 
+
-
== 24th ==
+
-
* [[User:Aschechtel|Anna]] made 2.5&nbsp;L LB
+
-
* [[User:Aschechtel|Anna]] made chips of K131026 in NEB , DH5α and BL21 in LB and additionally K131026 in DH5α in HM+. Images were taken every 30 min with our own device
+
-
 
+
-
== 25th ==
+
-
* did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)
+
-
* [[User:Nbailly|Nina]] tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300&nbsp;µL Fe3+ in 500&nbsp;mL flasks with a filling volume of 30&nbsp;mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30&nbsp;°C at 250&nbsp;rpm.
+
-
* [[User:aschechtel|Anna]] prepared over night cultures of K131026 in DH5α and NEB for chips
+
-
* [[User:aschechtel|Anna]] prepared 2x 5&nbsp;ml of pSB1C3, psB3K3 and pSB1A2 for plasmid prep
+
-
 
+
-
== 26th ==
+
-
* ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.
+
-
* plasmid prep of I20260, K516032 and B0034
+
-
* restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI
+
-
* gel with restricted the I20260, K516032 and B0034 was run
+
-
* purification of vector backbones pSB1A2, pSB3K3 and pSB1C3
+
-
* restriciton of synthesized TEV protease with EcoRI and PstI
+
-
* [[User:Nbailly|Nina]] qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300&nbsp;µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.
+
-
* [[User:aschechtel|Anna]] made chips with K131026 in DH5α and NEB, in LB and LB + 10&nbsp;% glycerol. Images were taken with our own device every 30 min.
+
-
 
+
-
== 26th ==
+
-
* plasmid prep of the back bones, restriction and gel purification
+
-
 
+
-
== 27th ==
+
-
* transformation of some BioBricks
+
-
* ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3
+
-
* transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively
+
-
 
+
-
= September =
+
-
== 3rd ==
+
-
[[User:Mosthege|Michael]], [[User:VeraA|Vera]] and [[User:Eshani.sood|Eshani]] prepared 50&nbsp;mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.
+
-
 
+
-
== 4th ==
+
-
* In the morning, at 10:15, [[User:Aschechtel|Anna]] inoculated the precultures for the interlab study experiment.
+
-
* [[User:Mosthege|Michael]] prepared cryo stocks of the pSBX-carrying ''E.&nbsp;coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30&nbsp;µL water, and resulting in the following DNA concentrations:
+
-
 
+
-
{| class="wikitable"
+
-
! vector !! concentration [ng/µL]
+
-
|-
+
-
| pSBX1A3 || 111
+
-
|-
+
-
| pSBX4A5 || 14.1
+
-
|-
+
-
| pSBX1C3 || 31
+
-
|-
+
-
| pSB4C5 || 98.5
+
-
|-
+
-
| pSBX1K3 || 18
+
-
|-
+
-
| pSBX4K5 || 30
+
-
|-
+
-
| pSBX1T3 || 39
+
-
|-
+
-
| constitutive expression plasmid || 73
+
-
|}
+
-
 
+
-
 
+
-
* [[User:Aschechtel|Anna]] did PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25&nbsp;µL reaction volume (12.5&nbsp;µL Q5 2x Master Mix, 1.25&nbsp;µL per primer, 2&nbsp;µL template)
+
-
 
+
-
{| class="wikitable"
+
-
! PCR tube # !! components
+
-
|-
+
-
| 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R
+
-
|-
+
-
| 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R
+
-
|-
+
-
|}
+
-
 
+
-
The PCR conditions:
+
-
 
+
-
{| class="wikitable"
+
-
! step !! temperature [°C] !! duration
+
-
|-
+
-
| denature || 98 || 30", 98 °C for 10", 55 °C for 30", 72 °C for 2'15"
+
-
|-
+
-
| denature || 98 || 10"
+
-
|-
+
-
| anneal || 50 (insert) 55 (backbone) || 30"
+
-
|-
+
-
| elongate || 72 || 0'30" (insert) 2'15" (backbone)
+
-
|-
+
-
| elongate || 72 || 2"
+
-
|-
+
-
| store || 8 || indefinite
+
-
|}
+
-
 
+
-
* Finally, [[User:Fgohr|Florian]] did the Gibson assembly and a heat shock transformation into NEB10β cells.
+
-
 
+
-
* At 10:15, [[User:AZimmermann|Arne]] inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.
+
-
 
+
-
== 5th ==
+
-
* [[User:Aschechtel|Anna]] made master plates of yesterday's transformed cells.
+
-
 
+
-
== 6th ==
+
-
* [[User:Aschechtel|Anna]] made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.
+
-
 
+
-
== 7th ==
+
-
* [[User:Aschechtel|Anna]] made cryos stocks of the precultures.
+
-
* [[User:Mosthege|Michael]] and [[User:AZimmermann|Arne]] purified the following plasmids:
+
-
 
+
-
{| class="wikitable"
+
-
! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]
+
-
|-
+
-
|K1319000 in I20260 || NEB10ß || K  || pSB3K3 || 1 ||
+
-
|-
+
-
|K1319000 in I20260 || NEB10ß || K  || pSB3K3 || 3 ||
+
-
|-
+
-
|K1319000 in I20260 || NEB10ß || K  || pSB3K3 || 5 ||
+
-
|-
+
-
|K1319001 in I20260 || NEB10ß || K  || pSB3K3 || 1 ||
+
-
|-
+
-
|K1319001 in I20260 || NEB10ß || K  || pSB3K3 || 5 ||
+
-
|-
+
-
|K1319001 in I20260 || NEB10ß || K  || pSB3K3 || 6 ||
+
-
|-
+
-
|K1319002 in I20260 || NEB10ß || K  || pSB3K3 || 1 ||
+
-
|-
+
-
|K1319002 in I20260 || NEB10ß || K  || pSB3K3 || 5 ||
+
-
|-
+
-
|K1319002 in I20260 || NEB10ß || K  || pSB3K3 || 6 ||
+
-
|-
+
-
|K1319001_GFP Fusion in I20260 || NEB10ß || K  || pSB3K3 || 4 ||
+
-
|-
+
-
|K1319001_GFP Fusion in I20260 || NEB10ß || K  || pSB3K3 || 5 ||
+
-
|-
+
-
|K1319001_GFP Fusion in I20260 || NEB10ß || K  || pSB3K3 || 6 ||
+
-
|-
+
-
|K1319002_GFP Fusion in I20260 || NEB10ß || K  || pSB3K3 || 3 ||
+
-
|-
+
-
|K1319002_GFP Fusion in I20260 || NEB10ß || K  || pSB3K3 || 4 ||
+
-
|-
+
-
|K1319002_GFP Fusion in I20260 || NEB10ß || K  || pSB3K3 || 5 ||
+
-
|-
+
-
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||
+
-
|-
+
-
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||
+
-
|-
+
-
|His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||
+
-
|}
+
-
Elution was performed twice with 15&nbsp;µL of nuclease free water each time.
+
-
 
+
-
== 15th ==
+
-
[[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] were able to analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008.
+
-
 
+
-
GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.
+
-
GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations.
+
-
 
+
-
For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.
+
-
 
+
-
Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct.
+
-
 
+
-
The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.
+
-
 
+
-
== 16th ==
+
-
 
+
-
* [[User:VeraA|Vera]] made master plates of the transformation from the day before.
+
-
+
-
* Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.
+
-
 
+
-
== 17th ==
+
-
 
+
-
* [[User:Nbailly|Nina]] prepped and autoclaved 33 500&nbsp;mL shake flasks.
+
-
 
+
-
== 18th ==
+
-
 
+
-
* [[User:Nbailly|Nina]] tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500&nbsp;mL flasks with 30&nbsp;mL LB Pseudomonas-F medium, and inoculated each one with 1&nbsp;mL culture medium of the overnight preculture. Flasks were inoculated at 30&nbsp;°C at 250&nbsp;rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30&nbsp;mL of TB medium in a 500&nbsp;mL flask were inoculated with ''E. coli'' DH5alpha cells and incubated at 37&nbsp;°C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5alpha, are adequate for the kind of school experiment we are planning with the NEAnderLab.
+
-
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}
+
-
 
+
-
== 19th ==
+
-
* [[User:R.hanke|René]], [[User:AZimmermann|Arne]] and [[User:Pdemling|Philipp]] made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37&nbsp;°C and 300&nbsp;rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.
+
-
 
+
-
* [[User:VeraA|Vera]] did a plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test.  Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).
+
-
 
+
-
* [[User:Fgohr|Florian]] made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).
+
-
 
+
-
* [[User:AZimmermann|Arne]] also inoculated 4 cultures for the further testing of the OD/F device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015.
+
-
 
+
-
* Furthermore, [[User:Nbailly|Nina]] did a growth experiment with DH5alpha for the NEAnderLab school experiment. 3 500&nbsp;mL shake flasks were filled with 50&nbsp;mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. [[User:Nbailly|Nina]] concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th.
+
-
{{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}
+
-
 
+
-
* [[User:Aschechtel|Anna]] also made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. These will be inocubated for an hour at 37&nbsp;°C. Then they will be induced with iPTG/HSL and fotos will be made every 30 minutes to check for fluorescence (GFP).
+
-
 
+
-
* [[User:Fgohr|Florian]] tested our OD/F device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F device (fluorescence) and platereader (fluorescence).
+
-
 
+
-
* [[User:Aschechtel|Anna]] made SDS gels.
+
-
 
+
-
* [[User:User:StefanReinhold|Stefan]] inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)
+
-
 
+
-
== 20th ==
+
-
 
+
-
 
+
-
== 22nd ==
+
-
 
+
-
* [[User:Nbailly|Nina]] poured several Pseudomonas-F agar plates with 0, 150 and 300&nbsp;µg/L for the NEAnderLab school experiment. She also autoclaved 12 500&nbsp;mL shake flasks, partly to be used for the school collaboration on Wednesday.
+
-
 
+
-
== 26th ==
+
-
* [[User:Mosthege|Michael]] did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300&nbsp;bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900&nbsp;bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.
+
-
 
+
-
=== Gradient PCR to test new primers ===
+
-
[[User:Fgohr|Florian]] and [[User:Mosthege|Michael]] did gradient PCR with these new primers:
+
-
 
+
-
{| class="wikitable"
+
-
! name !! sequence
+
-
|-
+
-
| G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC
+
-
|-
+
-
| G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG
+
-
|-
+
-
| K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG
+
-
|-
+
-
| I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG
+
-
|}
+
-
 
+
-
Three PCRs with different primer combinations were run. In all of them the templates were K1319004&nbsp;in pSB1C3, K1319008&nbsp;in&nbsp;pSB1C3 and I746909&nbsp;in&nbsp;pSB1C3.
+
-
 
+
-
The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:
+
-
{| class="wikitable"
+
-
! primer_F !! primer_R !! template !! expected length !! best annealing temperature
+
-
|-
+
-
| G00100_Alternative || G00101_Alternative || K1319004&nbsp;in pSB1C3 || 1057 || ???
+
-
|-
+
-
| G00100_Alternative || G00101_Alternative || K1319008&nbsp;in&nbsp;pSB1C3 || 1245 || ???
+
-
|-
+
-
| G00100_Alternative || G00101_Alternative || I746909&nbsp;in&nbsp;pSB1C3 || 1221 || ???
+
-
|-
+
-
| G00100_Alternative  || G00101_Alternative || water || --- || ???
+
-
|}
+
-
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65&nbsp;°C.|width=800px}}
+
-
 
+
-
The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:
+
-
{| class="wikitable"
+
-
! primer_F !! primer_R !! template !! expected length !! best annealing temperature
+
-
|-
+
-
| G00100_Alternative || I746916_check_R || K1319004&nbsp;in pSB1C3 || none || ???
+
-
|-
+
-
| G00100_Alternative || I746916_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || none || ???
+
-
|-
+
-
| G00100_Alternative || I746916_check_R || I746909&nbsp;in&nbsp;pSB1C3 || 820 || ???
+
-
|-
+
-
| G00100_Alternative  || I746916_check_R || water || --- || ???
+
-
|}
+
-
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65&nbsp;°C. Apparently the K1319008 template contained I746916.|width=800px}}
+
-
 
+
-
The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:
+
-
{| class="wikitable"
+
-
! primer_F !! primer_R !! template !! expected length !! best annealing temperature
+
-
|-
+
-
| G00100_Alternative || K1319004_check_R || K1319004&nbsp;in pSB1C3 || 541 || ???
+
-
|-
+
-
| G00100_Alternative || K1319004_check_R || K1319008&nbsp;in&nbsp;pSB1C3 || 502 || ???
+
-
|-
+
-
| G00100_Alternative || K1319004_check_R || I746909&nbsp;in&nbsp;pSB1C3 || none || ???
+
-
|-
+
-
| G00100_Alternative  || K1319004_check_R || water || --- || ???
+
-
|}
+
-
{{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68.1&nbsp;°C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}
+
-
 
+
-
The results of these three PCRs are:
+
-
# KAPA2G Fast ReadyMix worked well
+
-
# all three primers work well at >65&nbsp;°C annealing temperature
+
-
# K1319008 template contained I746916 instead of the intended K1319004 ORF
+
-
 
+
-
It was concluded that a similar check PCR with 65&nbsp;°C annealing temperature will be done on all plasmids and cryos of K1319008.
+
-
 
+
-
== 27th ==
+
-
* First [[User:Mosthege|Michael]] transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50&nbsp;µL cells with the plasmid into 2x 25&nbsp;µL. All 100&nbsp;µL were plated for all construct/machine combinations.
+
-
 
+
-
* [[User:VeraA|Vera]] transformed several constructs into chemically competent BL21(DE3) cells.
+
-
 
+
-
* [[User:Pdemling|Philipp]] and [[User:Mosthege|Michael]] did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.
+
-
 
+
-
* [[User:VeraA|Vera]] also made check a PCR on galectin-constructs:
+
-
 
+
-
{| class="wikitable"
+
-
! label !! primer_F !! primer_R !! expected length !! result
+
-
|-
+
-
| Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???
+
-
|-
+
-
| Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???
+
-
|-
+
-
| Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???
+
-
|-
+
-
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???
+
-
|-
+
-
| Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???
+
-
|-
+
-
| Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???
+
-
|-
+
-
| pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???
+
-
|-
+
-
| K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???
+
-
|}
+
-
 
+
-
== 28th ==
+
-
* [[User:Mosthege|Michael]] made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then [[User:VerA|Vera]] ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.
+
-
 
+
-
== 29th ==
+
-
 
+
-
* [[User:Eshani.sood|Eshani]] made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. [[User:VeraA|Vera]] determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.
+
-
 
+
-
* [[User:Nbailly|Nina]] prepared 3 500&nbsp;mL flasks with 30&nbsp;mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28&nbsp;°C and ~300&nbsp;rpm. The cultures are supposed to be used to test our OD device.
+
-
 
+
-
== 30th ==
+
-
 
+
-
* Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3).
+
-
 
+
-
* A plasmid prep of K1319013 and K1319014 was run.
+
-
 
+
-
* A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells.
+
-
 
+
-
* The pSB1C3 plasmid backbones were amplified via PCR and purified.
+
-
 
+
-
* Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated.
+
-
 
+
-
* A transformation of K1319010 and K1319010 in pSB1C3 was conducted.
+
-
 
+
-
* Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.
+
-
 
+
-
* The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.
+
-
 
+
-
= October =
+
-
== 1st ==
+
-
* Prepartations for sensor-chip production the following day (2014-10-02) was done accoringly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols#Agar_Chips| sensor chip manufacturing] protocol:
+
-
** At 18:30 [[User:PatrickO|Patrick]] prepared over-night cultures from K1319042, B0015 and K131026 by inoculating 250&nbsp;ml Erlenmeyer flasks each containing 50&nbsp;ml LB medium . The flasks were incubated for ~12 hours at 37&nbsp;°C on a shaker.
+
-
 
+
-
== 2nd ==
+
-
 
+
-
* At 8:30, [[User:NBailly|Nina]] and [[User:AZimmermann|Arne]] did a plasmid prep of dublicate samples of K1319011 clone #1 and #6. [[User:Fgohr|Florian]] measured the DNA yield, and the higher concentrated sample of clone #1 and #6, respectively, were sent in for sequencing.
+
-
* [[User:NBailly|Nina]] made precultures and a master plate of 6 colonies of K3139008 in psB1C3 in NEB10β cells that had been plated at 5:30 this morning.
+
-
 
+
-
* Production of sensor-chips was done accordingly to [https://2014.igem.org/Team:Aachen/Notebook/Protocols#Agar_Chips| sensor chip manufacturing] protocol. Briefly:
+
-
** At 10:00 [[User:PatrickO|Patrick]] prepared 150&nbsp;ml 1.5&nbsp;%&nbsp;(w/v) LB+agarose solution. The LB+agarose solution was autoclaved and subsequently tempered to 45&nbsp;°C. Precultures (50&nbsp;ml each) of K1319042, B0015 and K131026 were spun down at 3000&nbsp;g for 10&nbsp;min at 21&nbsp;°C and re-suspended in 1&nbsp;ml pretempered (21&nbsp;°C) LB medium. The re-suspended cultures were mixed with 50&nbsp;ml LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37&nbsp;°C for 1&nbsp;h.
+
-
** K1319042 and B0015 were induced with 0.2&nbsp;µl IPTG (100&nbsp;mM) subsequently to incubation and K131026 was induced with 0.2&nbsp;µl homoserinlacton stock solution (50&nbsp;µM) 30 minutes after induction of the K1319042 and B0015. The induced sensor-chips were read out every 30 minutes for 180 minutes in total. An additional readout was conducted 285 minutes post induction. The readout was done at 450&nbsp;nm and 480&nbsp;nm wavelength.
+
-
 
+
-
* Gibson assembly of K1319008
+
-
** template Backbone: I746909, Insert: K1319004
+
-
** transformation in ''E.coli'' NEB10β and BL21
+
-
 
+
-
* PCRs for Gibson assembly of K1319010 and K1319015
+
-
** template Backbone: I20260 for K1319010 and K1319015
+
-
** template Insert: K1319000 for K1319010 and K1319015 (but different primer)
+
-
 
+
-
* made precultures of K1319013 and K1319014 in pSB3K3
+
-
 
+
-
* K1319011 in pSB1C3 prepped for sequencing
+
-
 
+
-
* Gibson assembly of K1319017 (PCRs, Gibson assembly, restriction with DnpI, transformation into NEB10β)
+
-
** template Backbone: B0015
+
-
** template Insert 1: LasI synthesized gene
+
-
** template Insert 2: K660004
+
-
 
+
-
==3rd==
+
-
 
+
-
* made master plates of K1319008 in NEB10β and BL21 and precultures
+
-
 
+
-
* check PCR for K1319008 to validate the Gibson assembly check for potential I746909 residues
+
-
 
+
-
{{Team:Aachen/Figure|Aachen_14-10-03_K1319008_insert_colonyPCR.png|title=Check PCR K1319008|subtitle=K1319008 was checked with the Primers K1319008_Check_R and I746909_Check_R (both with G00100 Alternative as froward primer) for presence of K1319008 or I746909. All tested clones were positive for K1319008 and negative for I746909.|width=800px}}
+
-
 
+
-
* [[User:fgohr|Florian]] and [[User:StefanReinhold|Stefan]] did a plasmid prep and made cryo stocks of K1319008 in NEB (clones #1, #2, #3) and BL21 (clones #1, #2)
+
-
 
+
-
* plasmid prep of K1319013 and K1319014 in pSB3K3
+
-
 
+
-
* Gibson assembly for K1319010 and transformation into NEB10β
+
-
 
+
-
* made cryo stocks of K1319011 clone #6
+
-
 
+
-
* restriction of K1319012, k1319013 and K1319014 with EcoRI and PstI. Restriction of linearized plasmid backbone pSB1C3 with EcoRI and PstI. Ligation of K1319012, K1319013 and K1319014 into pSB1C3. Transformation into NEB10β.
+
-
 
+
-
* Gibson assembly of K1319015 and transformation into NEB10β
+
-
 
+
-
* colony PCR of K1319017
+
-
 
+
-
{{Team:Aachen/Figure|Aachen_14-10-03_colony_PCR_K1319017.png|title=colony PCR K1319017|subtitle=K1319017 was checked with a colony PCR for the right insert length. Clones #2 and #4 were correct and used forthwith.|width=800px}}
+
-
 
+
-
* did plasmid prep and cryo of clones #2 and #4 of K1319017
+
-
 
+
-
* new plasmid backbone of pSB1C3 was made using the [http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones|standard protocol].
+
-
 
+
-
* transformation of K1319008 clone #1 (from BL21) and K1319013 into BL21 (two plasmids in one cell).
+
-
 
+
-
* transformation of K1319008 clone #1 (from BL21) and k1319014 into BL21 (two plasmids in one cell).
+
-
 
+
-
* OD measurements of three biological triplicates from ''E. coli'' BW21 113, ''P. putida'' and ''S. cerevisiae''. Measurement as an analytic triplicate in the spectrophotometer (absorbance and transmission) and our own OD/F device.
+
-
 
+
-
* Gibson assembly of K1319021
+
-
** template Backbone: K1319008
+
-
** template Insert: LasI gene synthesis
+
-
 
+
-
* At 19:00 [[User:PatrickO|Patrick]] and [[User:fgohr|Florian]] measured OD (our OD-device), absorption (spectrophotometer) and transmission (spectrophotometer) for 19 diltuions in the range of 2.5-100&nbsp;% from yeast (''Saccharomyces cerevisiae'') and ''P. putida'' liquid cultures. Measurements were conducted in biological as well as technical triplicates. Aim of this experiment was the comparison of our OD-device to commonly used devices in terms of OD determination.
+
-
 
+
-
* Prepartations for sensor-chip production the following day (2014-10-04) were done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols#Agar_Chips| sensor chip manufacturing] protocol:
+
-
** At 22:00 [[User:PatrickO|Patrick]] prepared over-night cultures from B0015, K1319017 and K131026 by inoculating 250&nbsp;mL Erlenmeyer flasks each containing 50&nbsp;mL LB medium for sensor-chip manufacturing the next day. The flasks were incubated for ~12 hours at 37&nbsp;°C on a shaker.
+
-
 
+
-
* Our BioBrick K1319021 enables expression of the TEV protease inducible by the autoinducers of ''Pseumomonas aeruginosa''. In order to construct this BioBrick, a Gibson assembly of K1319008 (IPTG-inducible expression of TEV protease) and the synthezised composite HSL-promotor J23101.B0032.C0079.B0015.J64010.B0034 activated by the respective autoinducers (HomoSerineLactones) was perfomed by [[User:R.hanke|René]]. Prior to this, [[User:R.hanke|René]] used two PCRs to linearize pSB1C3-K1319008, serving as backbone for Gibson assembly, and cutting out J23101.B0032.C0079.B0015.J64010.B0034 as well as adding adequate overlapping sequences.
+
-
 
+
-
{| class="wikitable"
+
-
| <center>'''PCRs'''</center> || colspan="" | <center>'''K1319008'''</center|| colspan="2"| <center>'''HSL-Promotor'''</center> ||
+
-
|-
+
-
! step !! time [mm:ss] !! temperature [°C] !! time [mm:ss] !! temperature [°C] !!
+
-
|-
+
-
| Initial denaturation || 05:00 || 98 || 05:00 || 98 ||
+
-
|-
+
-
| Denaturation || 00:30 || 98 || 00:30 || 98 || rowspan="3" | '''30 cycles'''
+
-
|-
+
-
| Annealing || 00:30 || 55 || 00:30 || 51
+
-
|-
+
-
| Elongation || 01:35 || 72 || 00:37 || 72
+
-
|-
+
-
| Final elongation || 05:00 || 72 || 05:00 || 72 ||
+
-
|}
+
-
 
+
-
==4th ==
+
-
 
+
-
* colony PCR of K1319015 and Check PCR of K1319010
+
-
** K1319010: clone #1 was positive
+
-
** K1319015: in all clones the inserts were too short.
+
-
 
+
-
* new digestion of Gibson master mix of K1319015 with DnpI
+
-
 
+
-
* transformation of new Gibson master mix into NEB 10β
+
-
 
+
-
* restriction of K1319010, K1319012, K1319013 and K1319014 (all in pSB3K3) with EcoRI and PstI, cutting of pSB1C3 with EcoRI and PstI, and then ligation.
+
-
 
+
-
* made master plates and precultures of the transformations of K1319008 in BL21, K1319013 + K1319008 in BL21 and K1319014 + K1319008 in BL21
+
-
 
+
-
* colony PCR of the master plates with the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008
+
-
 
+
-
* sent the first BioBricks to the iGEM headquarters:
+
-
** K1319000
+
-
** K1319001
+
-
** K1319002
+
-
** K1319003
+
-
** K1319004
+
-
** K1319008
+
-
** K1319011
+
-
** K1319017
+
-
** K1319020
+
-
** K1319042
+
-
 
+
-
* shake flask experiments with K1319008 (clone #1), K1319013 + K1319008 (clone #2) and K1319014 + K1319008 (clone #2) in LB (2 flasks each); inoculation with 50&nbsp;µL preculture and inducing with iPTG at OD of 1.5.
+
-
 
+
-
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols#Agar_Chips| sensor chip manufacturing] protocol:
+
-
** At 13:30 [[User:PatrickO|Patrick]] prepared sensor chips from pre-cultures of B0015, K1319017 and K131026.
+
-
** Subsequently to 1&nbsp;h icubation at 37&nbsp;°C B0015, K1319017and K131026 were induced with 0.2&nbsp;µL homoserinlacton stock solution (50&nbsp;µM). The induced sensor-chips were read out every 30 minutes for 240 minutes in total. Readout was conducted at 450&nbsp;nm and 480&nbsp;nm wavelength. An additional readout was conducted after 12 hours.
+
-
 
+
-
* At 17:00 [[User:PatrickO|Patrick]] prepared 4 liquid cultures from the K1319010_pSB3K3 master plate (clone#1) in 5&nbsp;mL LB-medium, each. The liquid cultures were prepared in order to create cryo stocks from K1319010-pSB3K3. Kanamycin was added to the liquid cultures as antibiotic at an concentration of 1&nbsp;µL/mL.
+
-
 
+
-
* At 18:00 [[User:PatrickO|Patrick]] prepared a master plate (LB+C) and corresonding liquid cultures from 6 clones of ''E.coli'' NEB10B k1319021-psB1C3. Liquid cultures and master plate were incubated at 37&nbsp;°C.
+
-
 
+
-
* At 23:30 [[User:PatrickO|Patrick]] prepared liquid cultures from K1319015-pSB3K3 clones #7, #8 and #9 in 5&nbsp;mL LB-medium. Kanamycin was used as antibiotic and the cultures were incubated at 37&nbsp;°C. Purpose of the cultures was cryo stock preparation and plasmid prep.
+
-
 
+
-
==5th ==
+
-
 
+
-
* At 11:45 [[User:PatrickO|Patrick]] and [[User:aschechtel|Anna]] prepared cryo stocks from NEB K1319010-pSB3k3 #1, K1319015-pSB3K3 #7, K1319015-pSB3K3 #8 and K1319015-pSB3K3 #9 by mixing 750&nbsp;µl lquid culture with 750&nbsp;µl 50%&nbsp;(v/v) Glycerol-solution in 2&nbsp;ml eppis.
+
-
**Plasmid prep was also done for the cultures mentioned above.
+
-
 
+
-
* At 12:00 [[User:PatrickO|Patrick]] prepared liquid cultures from K139010-pSB3K3, K139011-pSB3K3, K139012-pSB3K3, K139013-pSB3K3, K139014-pSB3K3, K139015-pSB3K3 in 5&nbsp;ml LB-medium each. Kanamycin was used as antibiotic. Purpose for the cultures was the characterization of constituitive expression and an additional plasmid prep of K139013-pSB3K3 and K139014-pSB3K3.
+
-
 
+
-
* Production of sensor-chips was done accordingly to the [https://2014.igem.org/Team:Aachen/Notebook/Protocols#Agar_Chips| sensor chip manufacturing] protocol:
+
-
** At 13:00 [[User:PatrickO|Patrick]] and [[User:aschechtel|Anna]] prepared sensor chips from shake flask pre-cultures of BL21 pSB1C3-K1319008+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015.
+
-
**Subsequently to 1&nbsp;h incubation at 37&nbsp;°C, BL21 pSB1C3-K131900+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015 were induced with 0.2&nbsp;µL IPTG. The induced sensor-chips were read out every 30&nbsp;minutes for 360&nbsp;minutes in total. K1319013 was induced earlier and thus measurements were taken for 450&nbsp;min in total. Readout was conducted at  480&nbsp;nm wavelength. An additional readout was conducted next day at 11:00.
+
-
 
+
-
* At 15:30 [[User:PatrickO|Patrick]] prepared liquid cultures for the characterization of ITPG inducible expression:
+
-
** I746909 in pSB1C3
+
-
** I20260 in pSB3K3
+
-
** K731520 in pSB1C3
+
-
** K1319008 in pSB1C3
+
-
** K1319013 in pSB3K3
+
-
** K1319014 in pSB3K3
+
-
** B0015 in pSB1C3
+
-
** K1319013 in pSB3K3 + K1319008 in pSB1C3
+
-
** B0015 in pSB1C3
+
-
** K1319014 in pSB3K3 + K1319008 in pSB1C3
+
-
 
+
-
* [[User:fgohr|Florian]] and [[User:PatrickO|Patrick]] prepared a colony PCR from K1319014-pSB1C3 clones #3, #4, #5 and#6. H20 and K1319014-pSB3K3 were used as controls.
+
-
 
+
-
* At 22:20 [[User:Mosthege|Michael]] and [[User:VeraA|Vera]] prepared 1&nbsp;L LB+C plates (2.5&nbsp;g NaCl, 10&nbsp;g Agar, 2.5&nbsp;g yeast extract and 5&nbsp;g Trypton). N-Z-amine (peptone from casein) was used instead of tryptone, because the tryptone stock was depleted.
+
-
+
-
* [[User:Pdemling|Philipp]] and [[User:R.hanke|René]] prepped multiple cultures K1319013 in pSB3K3 and K1319014 in pSB3K3. Now we have sufficient amount of both plasmids.
+
-
 
+
-
* Plates were made by [[User:pdemling|Philipp]] and [[User:Mosthege|Michael]] for the following constructs:
+
-
 
+
-
{| class="wikitable"
+
-
! part in vector !! strain !! resistance
+
-
|-
+
-
| K1319008 in pSB1C3 || BL21(DE3) || C
+
-
|-
+
-
| K1319010 in pSB3K3 || NEB10β || K
+
-
|-
+
-
| K1319011 in pSB3K3 || NEB10β || K
+
-
|-
+
-
| K1319012 in pSB3K3 || NEB10β || K
+
-
|-
+
-
| K1319013 in pSB3K3 || NEB10β || K
+
-
|-
+
-
| K1319014 in pSB3K3 || NEB10β || K
+
-
|-
+
-
| K1319015 in pSB3K3 || NEB10β || K
+
-
|-
+
-
| K1319017 in pSB1C3 || NEB10β || C
+
-
|-
+
-
| K1319042 in pSB1C3 || BL21(DE3) || C
+
-
|-
+
-
| K1319008 in pSB1C3 + K1319013 in pSB3K3 || BL21(DE3) || C+K
+
-
|-
+
-
| K1319008 in pSB1C3 + K1319014 in pSB3K3 || BL21(DE3) || C+K
+
-
|-
+
-
| I746909 in pSB1C3 || BL21(DE3) || C
+
-
|-
+
-
| K731520 in pSB1C3 || DH5α || C
+
-
|-
+
-
| I20260 in pSB3K3 || NEB10β || K
+
-
|-
+
-
| B0015 in pSB1C3 || NEB10β || C
+
-
|}
+
-
 
+
-
 
+
-
* To determine whether the conducted Gibson assembly of K1319021 and subsequent transformation into ''E. coli'' NEB 10β were successful, a colony PCR on these cells was performed by [[User:R.hanke|René]]. Primers binding to each of the templates used for Gibson assembly were used: LasI_Insert_F binding in J23101.B0032.C0079.B0015.J64010.B0034 and K1319004_Check_R binding in pSB1C3-K1319008. Bands at 1341&nbsp;bp would indicate the successful construction and transformation of K1319021.
+
-
 
+
-
{{Team:Aachen/Figure|Aachen_14-10-05_Check_PCR_on_K1319021.png|title=Check PCR on K1319021|subtitle=(Homoserinlactone-inducible expression of the TEV protease)|width=800px}}
+
-
 
+
-
Since Bands >2000&nbsp;bp were observed, another PCR was performed by [[User:R.hanke|René]] using primers binding upstream and downstream of the insert in pSB1C3: G00100_alternative and G00101_alternative. Here, bands with a length of 2210&nbsp;bp would verify the correct length of K1319021.
+
-
 
+
-
==6th ==
+
-
 
+
-
* [[User:aschechtel|Anna]] made a SDS page of K1319010-15 and B0015
+
-
 
+
-
* [[User:Nbailly|Nina]] made a master plate at 15:30 containing two clones of [[User:VeraA|Vera's]] K1319015 plate from yesterday.
+
-
 
+
-
* At 22:00 [[User:PatrickO|Patrick]] inocculated two 500&nbsp;ml flasks containing 50 ml&nbsp;LB-medium with 1&nbsp;ml pre-culture of K1319017, which hab been prepared by [[User:VeraA|Vera]] earlier this day. Chloramphinicol was used as antibiotic. The Flasks were incubated at 37&nbsp;°C. The cultures were meant to be used for fluorescence characterization after an OD of 1.0-1.5 was reached.
+
-
 
+
-
== 7th ==
+
-
 
+
-
* Two conducted colony PCRs confirmed that our double plasmid systems of K1319008 and K13190013/14 contain nothing but the desired BioBricks, which were used as positive controls.
+
-
 
+
-
{{Team:Aachen/Figure|Aachen_14-10-07_colonyPCR_on_characterization_constructs.png|title=colony PCR cells harboring the double plasmid system pSB3K3-K1319008 pSB1C3-K1319013/14|subtitle=(IPTG-inducible expression of the TEV protease and constitutive expression of our GFP-Quencher-Constructs)|width=800px}}
+
 +
<li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;">
 +
<a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black">
 +
    <div class="team-item team-info" style="width:214px;height:214px;" >
 +
      <br/><br/>
 +
<b>
 +
working 24/7
 +
<br/><br/>
 +
finalizing our project
 +
<br/><br/>
 +
Wiki
 +
</b>
 +
      <br/><br/>
 +
      <!-- click for more information -->
 +
    </div>
 +
    <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a>
 +
  </li>
 +
</ul></html>
 +
</center>
{{Team:Aachen/Footer}}
{{Team:Aachen/Footer}}

Latest revision as of 21:23, 17 October 2014

Our Work in the Lab