|
|
(12 intermediate revisions not shown) |
Line 123: |
Line 123: |
| <div class="menu"> | | <div class="menu"> |
| | | |
- | <!---吉大logo----> | + | <!---比赛logo----> |
| <div class="logo"> | | <div class="logo"> |
- | <a href="https://2014.igem.org/Team:Jilin_China"><img style="height:80px;"src="https://static.igem.org/mediawiki/2014/a/a3/Uea_igem-logo.png"></a> | + | <a href="https://2014.igem.org/Main_Page"><img style="height:80px;"src="https://static.igem.org/mediawiki/2014/a/a3/Uea_igem-logo.png"></a> |
| </div> | | </div> |
- | <!---比赛logo----> | + | <!---吉大logo----> |
| <div style="float:left;"> | | <div style="float:left;"> |
- | <a href="https://2014.igem.org/Main_Page"><img style="height:80px;"src="https://static.igem.org/mediawiki/2014/6/60/Jilin_China_igem_logo.gif"></a> | + | <a href="https://2014.igem.org/Team:Jilin_China"><img style="height:80px;"src="https://static.igem.org/mediawiki/2014/6/60/Jilin_China_igem_logo.gif"></a> |
| </div> | | </div> |
| <table id="menu" cellspacing="0" height="135px"> | | <table id="menu" cellspacing="0" height="135px"> |
Line 212: |
Line 212: |
| <center><img src="https://static.igem.org/mediawiki/2014/c/cb/Simonsong-notebook-1.png"> </center></p> | | <center><img src="https://static.igem.org/mediawiki/2014/c/cb/Simonsong-notebook-1.png"> </center></p> |
| <p align="center">Fig 1 Restriction map of the 5.8 kb of sequence data and localisation of genes involved in microcystin LR degradation.</p> | | <p align="center">Fig 1 Restriction map of the 5.8 kb of sequence data and localisation of genes involved in microcystin LR degradation.</p> |
- | <h2>methods</h2> | + | <h3>methods</h3> |
| <h3>Synthetic sequence</h3> | | <h3>Synthetic sequence</h3> |
| <p> BamHI<br /> | | <p> BamHI<br /> |
Line 704: |
Line 704: |
| | | |
| | | |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC101</p></td>
| |
- | <td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATGTCTACCTTCTGTTCTTTCATATTGTTCAACAAT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">59</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC102</p></td>
| |
- | <td width="397" valign="top"><p align="left">GTTAGATATTACATCACATAATGAAGATTATACAATTGTTGAACAATATGAAAGAACAGA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">60</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC103</p></td>
| |
- | <td width="397" valign="top"><p align="left">ATCTTCATTATGTGATGTAATATCTAACTTAGCATCTACATAATAATATCCTGGTAAT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">58</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC104</p></td>
| |
- | <td width="397" valign="top"><p align="left">TTAAATCAATTTATATGGCTAAAAAACCAGTTCAATTACCAGGATATTATTATGTAGATG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">60</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC105</p></td>
| |
- | <td width="397" valign="top"><p align="left">GGTTTTTTAGCCATATAAATTGATTTAAATTCAACTAAATAATGTCCTCCGTCC</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC106</p></td>
| |
- | <td width="397" valign="top"><p align="left">GGGAGAAACACATAAAGCTCTAAAATTAAAGGACGGAGGACATTATTTAGTT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC107</p></td>
| |
- | <td width="397" valign="top"><p align="left">GAGCTTTATGTGTTTCTCCCTTTAAAACCCCGTCTCTTGGATATAATCTTTCTGTAC</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">57</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC108</p></td>
| |
- | <td width="397" valign="top"><p align="left">GCAAAAAAAAACAATGGGATGGGAAGCTAGTACAGAAAGATTATATCCAAGAGA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC109</p></td>
| |
- | <td width="397" valign="top"><p align="left">CCATCCCATTGTTTTTTTTTGCATAACTGGTCCGTCTGATGGAAAATTAACCC</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">53</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC110</p></td>
| |
- | <td width="397" valign="top"><p align="left">TACAAGATGGTTGTTTTATTTATAAAGTTAAATTTATTGGGGTTAATTTTCCATCAGACG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">60</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC111</p></td>
| |
- | <td width="397" valign="top"><p align="left">ACTTTATAAATAAAACAACCATCTTGTAATGATGAATCTTGTGTAACTGTAGCA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC112</p></td>
| |
- | <td width="397" valign="top"><p align="left">GGGAAAGAGTTATGAATTTTGAAGATGGTGGAGTTGCTACAGTTACACAAGATTCA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">56</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC113</p></td>
| |
- | <td width="397" valign="top"><p align="left">CTTCAAAATTCATAACTCTTTCCCATTTAAATCCTTCTGGAAAAGATAATTTTTTATAAT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">60</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC114</p></td>
| |
- | <td width="397" valign="top"><p align="left">CGTTAAACATCCAGCTGATATTCCAGATTATAAAAAATTATCTTTTCCAGAAGG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC115</p></td>
| |
- | <td width="397" valign="top"><p align="left">AATATCAGCTGGATGTTTAACGTAAACCTTTGATCCATATTGAAATTGTGGTGATAAA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">58</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC116</p></td>
| |
- | <td width="397" valign="top"><p align="left">GGACCATTACCATTTGCGTGGGATATTTTATCACCACAATTTCAATATGGAT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC117</p></td>
| |
- | <td width="397" valign="top"><p align="left">CACGCAAATGGTAATGGTCCTCCTTTTGTAACCTTTAATTTAACTGTATTATGTCCTTC</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">59</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC118</p></td>
| |
- | <td width="397" valign="top"><p align="left">GGGAGAAGGAGAAGGTAGACCGTATGAAGGACATAATACAGTTAAATTAAAG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC119</p></td>
| |
- | <td width="397" valign="top"><p align="left">GTCTACCTTCTCCTTCTCCCTCAATTTCAAATTCATGTCCATTAACTGTACCTT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC120</p></td>
| |
- | <td width="397" valign="top"><p align="left">TGTTATTACAGAATTTATGAGATTTAAAGTTAGAATGGAAGGTACAGTTAATGGACATGA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">60</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC121</p></td>
| |
- | <td width="397" valign="top"><p align="left">TTTAAATCTCATAAATTCTGTAATAACATTTTCTGATGAAGCCATAACACGA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC122</p></td>
| |
- | <td width="397" valign="top"><p align="left">GCAGCTGGTGCAAACAACAGCAAACCGAAGACTCGTGTTATGGCTTCATCAG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC123</p></td>
| |
- | <td width="397" valign="top"><p align="left">CTGTTGTTTGCACCAGCTGCTGCATCTTCACCCCATAAATCAACCGAACGGA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC124</p></td>
| |
- | <td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAACAAGAATTGACTGTCCGTTCGGTTGATTTATGG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC201</p></td>
| |
- | <td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATGTTCTGCTGACAGAACGGGAGAATTGAACCAT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC202</p></td>
| |
- | <td width="397" valign="top"><p align="left">GACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATGGTTCAATTCTCCCGTTC</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC203</p></td>
| |
- | <td width="397" valign="top"><p align="left">AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">57</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC204</p></td>
| |
- | <td width="397" valign="top"><p align="left">CCCTCTCCACTGACAGAAAATTTGTGCCCATTAACATCACCATCTAATTCAA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC205</p></td>
| |
- | <td width="397" valign="top"><p align="left">TTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC206</p></td>
| |
- | <td width="397" valign="top"><p align="left">AGGTAGTTTTCCAGTAGTGCAAATAAATTTAAGGGTAAGTTTTCCGTATGTT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC207</p></td>
| |
- | <td width="397" valign="top"><p align="left">GCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC208</p></td>
| |
- | <td width="397" valign="top"><p align="left">CTGGGTATCTCGCAAAGCATTGAACACCATAACCGAAAGTAGTGACAAGTGT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC209</p></td>
| |
- | <td width="397" valign="top"><p align="left">ATGCTTTGCGAGATACCCAGATCACATGAAACAGCATGACTTTTTCAAGAGTGC</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC210</p></td>
| |
- | <td width="397" valign="top"><p align="left">TAGTTCTTTCCTGTACATAACCTTCAGGCATGGCACTCTTGAAAAAGTCATGCT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">54</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC211</p></td>
| |
- | <td width="397" valign="top"><p align="left">GGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC212</p></td>
| |
- | <td width="397" valign="top"><p align="left">GGTATCACCTTCAAACTTGACTTCAGCACGTGTCTTGTAGTTCCCGTCATCT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">52</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC213</p></td>
| |
- | <td width="397" valign="top"><p align="left">GTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">57</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC214</p></td>
| |
- | <td width="397" valign="top"><p align="left">GTGTCCAAGAATGTTTCCATCTTCTTTAAAATCAATACCTTTTAACTCGATTC</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">53</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC215</p></td>
| |
- | <td width="397" valign="top"><p align="left">AGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">57</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | </table>
| |
| | | |
- | <table align="center" border="1" cellspacing="0" cellpadding="0" width="664">
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC215</p></td>
| |
- | <td width="397" valign="top"><p align="left">AGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">57</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC216</p></td>
| |
- | <td width="397" valign="top"><p align="left">CCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">53</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC217</p></td>
| |
- | <td width="397" valign="top"><p align="left">TGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">57</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC218</p></td>
| |
- | <td width="397" valign="top"><p align="left">TCTGCTAGTTGAACGCTTCCATCTTCAATGTTGTGTCTAATTTTGAAGTTA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">51</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC219</p></td>
| |
- | <td width="397" valign="top"><p align="left">GGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">53</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC220</p></td>
| |
- | <td width="397" valign="top"><p align="left">CAGGTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATTGGAGTATTTT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">53</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC221</p></td>
| |
- | <td width="397" valign="top"><p align="left">TTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCC</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">51</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC222</p></td>
| |
- | <td width="397" valign="top"><p align="left">AAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGA</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">51</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC223</p></td>
| |
- | <td width="397" valign="top"><p align="left">GAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATG</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">51</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC224</p></td>
| |
- | <td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCT</p></td>
| |
- | <td width="52" nowrap="nowrap" valign="top"><p align="center">51</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC1</p></td>
| |
- | <td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATG</p></td>
| |
- | <td width="52" nowrap="nowrap"><p align="center">26</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC2</p></td>
| |
- | <td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAA</p></td>
| |
- | <td width="52" nowrap="nowrap"><p align="center">19</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC3</p></td>
| |
- | <td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATG</p></td>
| |
- | <td width="52" nowrap="nowrap"><p align="center">21</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
- | <tr>
| |
- | <td width="50" nowrap="nowrap" valign="top"><p align="left">AC4</p></td>
| |
- | <td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCC</p></td>
| |
- | <td width="52" nowrap="nowrap"><p align="center">27</p></td>
| |
- | <td width="62" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="48" nowrap="nowrap"><p align="center">1</p></td>
| |
- | <td width="56" nowrap="nowrap"><p align="center">PAGE</p></td>
| |
- | </tr>
| |
| | | |
| | | |
Line 1,464: |
Line 1,038: |
| dNTP 4μl<br /> | | dNTP 4μl<br /> |
| 10×<em>Pfu</em> buffer(Mg2+) 5μl<br /> | | 10×<em>Pfu</em> buffer(Mg2+) 5μl<br /> |
- | <img width="350" height="2" src="file:///C|/Users/Administrator/AppData/Roaming/Macromedia/Dreamweaver 8/OfficeImageTemp/clip_image001_0000.gif" />Sterilized ultrapure water to 50ul<br /> | + | Sterilized ultrapure water to 50ul<br /> |
| Procedure of OE-PCR: <br /> | | Procedure of OE-PCR: <br /> |
| 94℃ 2min<br /> | | 94℃ 2min<br /> |
- | <img width="14" height="65" src="file:///C|/Users/Administrator/AppData/Roaming/Macromedia/Dreamweaver 8/OfficeImageTemp/clip_image002.gif" /> 94℃ 30S<br /> | + | 94℃ 30S<br /> |
| 50℃ 30S 20 cycles<br /> | | 50℃ 30S 20 cycles<br /> |
| 72℃ 2min<br /> | | 72℃ 2min<br /> |
| 72℃ 10min<br /> | | 72℃ 10min<br /> |
- | <img width="350" height="2" src="file:///C|/Users/Administrator/AppData/Roaming/Macromedia/Dreamweaver 8/OfficeImageTemp/clip_image003.gif" /> 4℃preservation<br /> | + | 4℃ preservation<br /> |
| End<br /> | | End<br /> |
| The full-length gene spliced by OE-PCR was detected by a 1% agarose gel electrophoresis, specific programs are as follows<br /> | | The full-length gene spliced by OE-PCR was detected by a 1% agarose gel electrophoresis, specific programs are as follows<br /> |
- | <img width="14" height="35" src="file:///C|/Users/Administrator/AppData/Roaming/Macromedia/Dreamweaver 8/OfficeImageTemp/clip_image004.gif" />OE-PCR product 5μl <br /> | + | OE-PCR product 5μl <br /> |
| 10×Loading Buffer 0.6μl spotted after mixing well<br /> | | 10×Loading Buffer 0.6μl spotted after mixing well<br /> |
- | <img width="350" height="2" src="file:///C|/Users/Administrator/AppData/Roaming/Macromedia/Dreamweaver 8/OfficeImageTemp/clip_image003_0000.gif" />100bp Marker 5μl spotted directly<br /> | + | 100bp Marker 5μl spotted directly<br /> |
| 80V electrophoresis for 1h。 </p> | | 80V electrophoresis for 1h。 </p> |
- | <h3>5、Constructing and sequencing of subcloning vector </h3> | + | <h3 id="coop">5、Constructing and sequencing of subcloning vector </h3> |
- | <p>We design a primer AC-B with Blp I site and a primer AC-S with SgrA I site. Then we use RFP-promoter-GFP as template in PCR. Then we use Blp I and SgrA I enzyme to digest the target fragment and pET32a vector(37℃,3h) and link it overnight(16℃). After this step, transform the linked vector to competent cell(E.coli BL21) and select the desirable colony by using “Blue-White Selection” method.<br /> | + | <p id="coop">We design a primer AC-B with Blp I site and a primer AC-S with SgrA I site. Then we use RFP-promoter-GFP as template in PCR. Then we use Blp I and SgrA I enzyme to digest the target fragment and pET32a vector(37℃,3h) and link it overnight(16℃). After this step, transform the linked vector to competent cell(E.coli BL21) and select the desirable colony by using “Blue-White Selection” method.<br /> |
| <strong>Constitute of </strong><em>Blp</em>Ⅰand <em>Sgr</em>AⅠdouble enzyme digestion reaction system:<strong> </strong><br /> | | <strong>Constitute of </strong><em>Blp</em>Ⅰand <em>Sgr</em>AⅠdouble enzyme digestion reaction system:<strong> </strong><br /> |
| Gene or plasmid 10μl<br /> | | Gene or plasmid 10μl<br /> |
Line 1,508: |
Line 1,082: |
| On the pET32a vector(as shown in Fig 1), use the RFP-promoter-GFP gene (1535bp) to replace the fragment between <em>Blp</em>Ⅰ site and <em>Sgr</em>A I site (753bp) and then we get the reconstructed plasmid, pET-mlr promoter.</p> | | On the pET32a vector(as shown in Fig 1), use the RFP-promoter-GFP gene (1535bp) to replace the fragment between <em>Blp</em>Ⅰ site and <em>Sgr</em>A I site (753bp) and then we get the reconstructed plasmid, pET-mlr promoter.</p> |
| | | |
| + | <center><img src="https://static.igem.org/mediawiki/2014/9/93/Simonsong-notebook-10.png" align="center"/></center> |
| + | <p align="center">Fig 3 Map of pET-mlr promoter <br>Select the white colony on culture and culture it. Then we extract the plasmid and use it as template in PCR to identify the colony. In theory, the reconstructed vector with RFP-promoter-GFP fragment is 1728bp and the empty vector without mlrA fragment is 946bp. So, the result shows that the white colony we select has reconstructed vector with mlrA fragment in it.</p> |
| + | <center><img src="https://static.igem.org/mediawiki/2014/2/28/Simonsong-notebook-4.png" /></center> |
| | | |
- | | + | <p align="center">Figure 3 PCR identification of recombinant vector pET-mlr promoter<br></p> |
- | | + | <p id="coop"> Illustration of the outcome: <br> |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | <img src="https://static.igem.org/mediawiki/2014/9/93/Simonsong-notebook-10.png"/>
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | <p align="center">图3 Map of pET-mlr promoter <br>Select the white colony on culture and culture it. Then we extract the plasmid and use it as template in PCR to identify the colony. In theory, the reconstructed vector with RFP-promoter-GFP fragment is 1728bp and the empty vector without mlrA fragment is 946bp. So, the result shows that the white colony we select has reconstructed vector with mlrA fragment in it.</p> | + | |
- | <img src="https://static.igem.org/mediawiki/2014/2/28/Simonsong-notebook-4.png" />
| + | |
- | | + | |
- | <p>Figure <a name="_GoBack"></a>3 PCR identification of recombinant vector pET-mlr promoter<br> | + | |
- | Illustration of the outcome: <br>
| + | |
| 1、L1, L2 could be amplified to 1700bp products, the recombinant vector contained a foreign gene RFP-promoter-GFP according to the result of the identification.<br> | | 1、L1, L2 could be amplified to 1700bp products, the recombinant vector contained a foreign gene RFP-promoter-GFP according to the result of the identification.<br> |
| 2、M was 1000bp Ladder Marker<br> | | 2、M was 1000bp Ladder Marker<br> |
| The positive clones which were proved to contain the recombinant vectors pET-mlr promoter by PCR identification. were sent to 吉林库美生物科技限公司to be sequenced. The results showed (Figure 4), RFP-promoter-GFP sequence is consistent with the design sequence.</p> | | The positive clones which were proved to contain the recombinant vectors pET-mlr promoter by PCR identification. were sent to 吉林库美生物科技限公司to be sequenced. The results showed (Figure 4), RFP-promoter-GFP sequence is consistent with the design sequence.</p> |
- | <div class="notebook"><img src="https://static.igem.org/mediawiki/2014/d/d8/Simonsong-notebook-5.png" /> | + | <div style="text-align:center"><img src="https://static.igem.org/mediawiki/2014/d/d8/Simonsong-notebook-5.png" /> |
| | | |
| <img src="https://static.igem.org/mediawiki/2014/5/5a/Simonsong-notebook-6.png" /> | | <img src="https://static.igem.org/mediawiki/2014/5/5a/Simonsong-notebook-6.png" /> |
| <img src="https://static.igem.org/mediawiki/2014/5/53/Simonsong-notebook-7.png" /></div> | | <img src="https://static.igem.org/mediawiki/2014/5/53/Simonsong-notebook-7.png" /></div> |
- | <h3>Figure 4 Sequencing results with the design sequence alignment</h3> | + | <center><p>Figure 4 Sequencing results with the design sequence alignment</p></center> |
- | <h3>The relationship detection between MLR promoter and microcystin LR </h3> | + | <h3 id="coop">The relationship detection between MLR promoter and microcystin LR </h3> |
- | <p>Single colony containingthe recombinant vector pET-mlr promoterwas picked ,vigorously shaken culture for 4-5h in LB liquid medium at 37 ℃,the culturing stopped until OD600 reached 0.3 - 0.4, 10-fold dilution to 10-5-10-7with sterilized water, taking 100ul to coat on the LB plate containing 10ug / L microcystin LR, 37 ℃ for overnight. <br> | + | <p id="coop">Single colony containingthe recombinant vector pET-mlr promoterwas picked ,vigorously shaken culture for 4-5h in LB liquid medium at 37 ℃,the culturing stopped until OD600 reached 0.3 - 0.4, 10-fold dilution to 10-5-10-7with sterilized water, taking 100ul to coat on the LB plate containing 10ug / L microcystin LR, 37 ℃ for overnight. <br> |
| Single cultured colony was placed in the UV lamp darkroom, we observed colony color and found that it luminesced green light, indicating that when there is microcystin LR, mlr promoter can promote the expression of GFP, which makes the single colony of E.coli BL21 luminescing green fluorescence in the UV lamp.</p> | | Single cultured colony was placed in the UV lamp darkroom, we observed colony color and found that it luminesced green light, indicating that when there is microcystin LR, mlr promoter can promote the expression of GFP, which makes the single colony of E.coli BL21 luminescing green fluorescence in the UV lamp.</p> |
- | <p> </p>
| |
- |
| |
- |
| |
- |
| |
- |
| |
- | <img src="https://static.igem.org/mediawiki/2014/5/50/Simonsong-notebook-8.png" />
| |
| | | |
| + | <div style="text-align:center"><img src="https://static.igem.org/mediawiki/2014/5/50/Simonsong-notebook-8.png" /></div> |
| + | <div> |
| + | <a height="20px" width="5%" align="center" onMouseOver="this.bgColor='#FFFFFF'" onMouseOut="this.bgColor='#A1DBB2'" href="#menu" style="text-decoration:none;color:#1C140D;float:right;background:#A1DBB2;"> Top </a> |
| + | </div> |
| | | |
| </table> | | </table> |
| </div> | | </div> |
| | | |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- | <div>
| |
- | <a height="20px" width="5%" align="center" onMouseOver="this.bgColor='#FFFFFF'" onMouseOut="this.bgColor='#A1DBB2'" href="#menu" style="text-decoration:none;color:#1C140D;float:right;background:#A1DBB2;"> Top </a>
| |
- | </div>
| |
| </body> | | </body> |
| </html> | | </html> |