Team:Jilin China/NOTEBOOK
From 2014.igem.org
(23 intermediate revisions not shown) | |||
Line 123: | Line 123: | ||
<div class="menu"> | <div class="menu"> | ||
- | <!--- | + | <!---比赛logo----> |
<div class="logo"> | <div class="logo"> | ||
- | <a href="https://2014.igem.org/ | + | <a href="https://2014.igem.org/Main_Page"><img style="height:80px;"src="https://static.igem.org/mediawiki/2014/a/a3/Uea_igem-logo.png"></a> |
</div> | </div> | ||
- | <!--- | + | <!---吉大logo----> |
<div style="float:left;"> | <div style="float:left;"> | ||
- | <a href="https://2014.igem.org/ | + | <a href="https://2014.igem.org/Team:Jilin_China"><img style="height:80px;"src="https://static.igem.org/mediawiki/2014/6/60/Jilin_China_igem_logo.gif"></a> |
</div> | </div> | ||
<table id="menu" cellspacing="0" height="135px"> | <table id="menu" cellspacing="0" height="135px"> | ||
Line 212: | Line 212: | ||
<center><img src="https://static.igem.org/mediawiki/2014/c/cb/Simonsong-notebook-1.png"> </center></p> | <center><img src="https://static.igem.org/mediawiki/2014/c/cb/Simonsong-notebook-1.png"> </center></p> | ||
<p align="center">Fig 1 Restriction map of the 5.8 kb of sequence data and localisation of genes involved in microcystin LR degradation.</p> | <p align="center">Fig 1 Restriction map of the 5.8 kb of sequence data and localisation of genes involved in microcystin LR degradation.</p> | ||
- | < | + | <h3>methods</h3> |
<h3>Synthetic sequence</h3> | <h3>Synthetic sequence</h3> | ||
<p> BamHI<br /> | <p> BamHI<br /> | ||
Line 271: | Line 271: | ||
<h4>Primer synthesis order o Comate Bioscience Co.,Ltd.</h4> | <h4>Primer synthesis order o Comate Bioscience Co.,Ltd.</h4> | ||
<div align="center"> | <div align="center"> | ||
- | <table border="1" cellspacing="0" cellpadding="0" width="950px"> | + | <table align="center" border="1" cellspacing="0" cellpadding="0" width="950px"> |
<tr> | <tr> | ||
<td width="50" nowrap="nowrap"><p align="center"><strong>Num</strong><strong> </strong></p></td> | <td width="50" nowrap="nowrap"><p align="center"><strong>Num</strong><strong> </strong></p></td> | ||
Line 281: | Line 281: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC101</p></td> |
<td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATGTCTACCTTCTGTTCTTTCATATTGTTCAACAAT</p></td> | <td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATGTCTACCTTCTGTTCTTTCATATTGTTCAACAAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">59</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC102</p></td> |
<td width="397" valign="top"><p align="left">GTTAGATATTACATCACATAATGAAGATTATACAATTGTTGAACAATATGAAAGAACAGA</p></td> | <td width="397" valign="top"><p align="left">GTTAGATATTACATCACATAATGAAGATTATACAATTGTTGAACAATATGAAAGAACAGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC103</p></td> |
<td width="397" valign="top"><p align="left">ATCTTCATTATGTGATGTAATATCTAACTTAGCATCTACATAATAATATCCTGGTAAT</p></td> | <td width="397" valign="top"><p align="left">ATCTTCATTATGTGATGTAATATCTAACTTAGCATCTACATAATAATATCCTGGTAAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">58</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC104</p></td> |
<td width="397" valign="top"><p align="left">TTAAATCAATTTATATGGCTAAAAAACCAGTTCAATTACCAGGATATTATTATGTAGATG</p></td> | <td width="397" valign="top"><p align="left">TTAAATCAATTTATATGGCTAAAAAACCAGTTCAATTACCAGGATATTATTATGTAGATG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC105</p></td> |
<td width="397" valign="top"><p align="left">GGTTTTTTAGCCATATAAATTGATTTAAATTCAACTAAATAATGTCCTCCGTCC</p></td> | <td width="397" valign="top"><p align="left">GGTTTTTTAGCCATATAAATTGATTTAAATTCAACTAAATAATGTCCTCCGTCC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC106</p></td> |
<td width="397" valign="top"><p align="left">GGGAGAAACACATAAAGCTCTAAAATTAAAGGACGGAGGACATTATTTAGTT</p></td> | <td width="397" valign="top"><p align="left">GGGAGAAACACATAAAGCTCTAAAATTAAAGGACGGAGGACATTATTTAGTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC107</p></td> |
<td width="397" valign="top"><p align="left">GAGCTTTATGTGTTTCTCCCTTTAAAACCCCGTCTCTTGGATATAATCTTTCTGTAC</p></td> | <td width="397" valign="top"><p align="left">GAGCTTTATGTGTTTCTCCCTTTAAAACCCCGTCTCTTGGATATAATCTTTCTGTAC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC108</p></td> |
<td width="397" valign="top"><p align="left">GCAAAAAAAAACAATGGGATGGGAAGCTAGTACAGAAAGATTATATCCAAGAGA</p></td> | <td width="397" valign="top"><p align="left">GCAAAAAAAAACAATGGGATGGGAAGCTAGTACAGAAAGATTATATCCAAGAGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC109</p></td> |
<td width="397" valign="top"><p align="left">CCATCCCATTGTTTTTTTTTGCATAACTGGTCCGTCTGATGGAAAATTAACCC</p></td> | <td width="397" valign="top"><p align="left">CCATCCCATTGTTTTTTTTTGCATAACTGGTCCGTCTGATGGAAAATTAACCC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC110</p></td> |
<td width="397" valign="top"><p align="left">TACAAGATGGTTGTTTTATTTATAAAGTTAAATTTATTGGGGTTAATTTTCCATCAGACG</p></td> | <td width="397" valign="top"><p align="left">TACAAGATGGTTGTTTTATTTATAAAGTTAAATTTATTGGGGTTAATTTTCCATCAGACG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC111</p></td> |
<td width="397" valign="top"><p align="left">ACTTTATAAATAAAACAACCATCTTGTAATGATGAATCTTGTGTAACTGTAGCA</p></td> | <td width="397" valign="top"><p align="left">ACTTTATAAATAAAACAACCATCTTGTAATGATGAATCTTGTGTAACTGTAGCA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC112</p></td> |
<td width="397" valign="top"><p align="left">GGGAAAGAGTTATGAATTTTGAAGATGGTGGAGTTGCTACAGTTACACAAGATTCA</p></td> | <td width="397" valign="top"><p align="left">GGGAAAGAGTTATGAATTTTGAAGATGGTGGAGTTGCTACAGTTACACAAGATTCA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">56</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC113</p></td> |
<td width="397" valign="top"><p align="left">CTTCAAAATTCATAACTCTTTCCCATTTAAATCCTTCTGGAAAAGATAATTTTTTATAAT</p></td> | <td width="397" valign="top"><p align="left">CTTCAAAATTCATAACTCTTTCCCATTTAAATCCTTCTGGAAAAGATAATTTTTTATAAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC114</p></td> |
<td width="397" valign="top"><p align="left">CGTTAAACATCCAGCTGATATTCCAGATTATAAAAAATTATCTTTTCCAGAAGG</p></td> | <td width="397" valign="top"><p align="left">CGTTAAACATCCAGCTGATATTCCAGATTATAAAAAATTATCTTTTCCAGAAGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC115</p></td> |
<td width="397" valign="top"><p align="left">AATATCAGCTGGATGTTTAACGTAAACCTTTGATCCATATTGAAATTGTGGTGATAAA</p></td> | <td width="397" valign="top"><p align="left">AATATCAGCTGGATGTTTAACGTAAACCTTTGATCCATATTGAAATTGTGGTGATAAA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">58</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC116</p></td> |
<td width="397" valign="top"><p align="left">GGACCATTACCATTTGCGTGGGATATTTTATCACCACAATTTCAATATGGAT</p></td> | <td width="397" valign="top"><p align="left">GGACCATTACCATTTGCGTGGGATATTTTATCACCACAATTTCAATATGGAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC117</p></td> |
<td width="397" valign="top"><p align="left">CACGCAAATGGTAATGGTCCTCCTTTTGTAACCTTTAATTTAACTGTATTATGTCCTTC</p></td> | <td width="397" valign="top"><p align="left">CACGCAAATGGTAATGGTCCTCCTTTTGTAACCTTTAATTTAACTGTATTATGTCCTTC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">59</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC118</p></td> |
<td width="397" valign="top"><p align="left">GGGAGAAGGAGAAGGTAGACCGTATGAAGGACATAATACAGTTAAATTAAAG</p></td> | <td width="397" valign="top"><p align="left">GGGAGAAGGAGAAGGTAGACCGTATGAAGGACATAATACAGTTAAATTAAAG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC119</p></td> |
<td width="397" valign="top"><p align="left">GTCTACCTTCTCCTTCTCCCTCAATTTCAAATTCATGTCCATTAACTGTACCTT</p></td> | <td width="397" valign="top"><p align="left">GTCTACCTTCTCCTTCTCCCTCAATTTCAAATTCATGTCCATTAACTGTACCTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC120</p></td> |
<td width="397" valign="top"><p align="left">TGTTATTACAGAATTTATGAGATTTAAAGTTAGAATGGAAGGTACAGTTAATGGACATGA</p></td> | <td width="397" valign="top"><p align="left">TGTTATTACAGAATTTATGAGATTTAAAGTTAGAATGGAAGGTACAGTTAATGGACATGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC121</p></td> |
<td width="397" valign="top"><p align="left">TTTAAATCTCATAAATTCTGTAATAACATTTTCTGATGAAGCCATAACACGA</p></td> | <td width="397" valign="top"><p align="left">TTTAAATCTCATAAATTCTGTAATAACATTTTCTGATGAAGCCATAACACGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC122</p></td> |
<td width="397" valign="top"><p align="left">GCAGCTGGTGCAAACAACAGCAAACCGAAGACTCGTGTTATGGCTTCATCAG</p></td> | <td width="397" valign="top"><p align="left">GCAGCTGGTGCAAACAACAGCAAACCGAAGACTCGTGTTATGGCTTCATCAG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC123</p></td> |
<td width="397" valign="top"><p align="left">CTGTTGTTTGCACCAGCTGCTGCATCTTCACCCCATAAATCAACCGAACGGA</p></td> | <td width="397" valign="top"><p align="left">CTGTTGTTTGCACCAGCTGCTGCATCTTCACCCCATAAATCAACCGAACGGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC124</p></td> |
<td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAACAAGAATTGACTGTCCGTTCGGTTGATTTATGG</p></td> | <td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAACAAGAATTGACTGTCCGTTCGGTTGATTTATGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC201</p></td> |
<td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATGTTCTGCTGACAGAACGGGAGAATTGAACCAT</p></td> | <td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATGTTCTGCTGACAGAACGGGAGAATTGAACCAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC202</p></td> |
<td width="397" valign="top"><p align="left">GACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATGGTTCAATTCTCCCGTTC</p></td> | <td width="397" valign="top"><p align="left">GACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATGGTTCAATTCTCCCGTTC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC203</p></td> |
<td width="397" valign="top"><p align="left">AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGG</p></td> | <td width="397" valign="top"><p align="left">AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
- | + | <tr> | |
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC204</p></td> |
<td width="397" valign="top"><p align="left">CCCTCTCCACTGACAGAAAATTTGTGCCCATTAACATCACCATCTAATTCAA</p></td> | <td width="397" valign="top"><p align="left">CCCTCTCCACTGACAGAAAATTTGTGCCCATTAACATCACCATCTAATTCAA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC205</p></td> |
<td width="397" valign="top"><p align="left">TTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTT</p></td> | <td width="397" valign="top"><p align="left">TTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC206</p></td> |
<td width="397" valign="top"><p align="left">AGGTAGTTTTCCAGTAGTGCAAATAAATTTAAGGGTAAGTTTTCCGTATGTT</p></td> | <td width="397" valign="top"><p align="left">AGGTAGTTTTCCAGTAGTGCAAATAAATTTAAGGGTAAGTTTTCCGTATGTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC207</p></td> |
<td width="397" valign="top"><p align="left">GCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG</p></td> | <td width="397" valign="top"><p align="left">GCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC208</p></td> |
<td width="397" valign="top"><p align="left">CTGGGTATCTCGCAAAGCATTGAACACCATAACCGAAAGTAGTGACAAGTGT</p></td> | <td width="397" valign="top"><p align="left">CTGGGTATCTCGCAAAGCATTGAACACCATAACCGAAAGTAGTGACAAGTGT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC209</p></td> |
<td width="397" valign="top"><p align="left">ATGCTTTGCGAGATACCCAGATCACATGAAACAGCATGACTTTTTCAAGAGTGC</p></td> | <td width="397" valign="top"><p align="left">ATGCTTTGCGAGATACCCAGATCACATGAAACAGCATGACTTTTTCAAGAGTGC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC210</p></td> |
<td width="397" valign="top"><p align="left">TAGTTCTTTCCTGTACATAACCTTCAGGCATGGCACTCTTGAAAAAGTCATGCT</p></td> | <td width="397" valign="top"><p align="left">TAGTTCTTTCCTGTACATAACCTTCAGGCATGGCACTCTTGAAAAAGTCATGCT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC211</p></td> |
<td width="397" valign="top"><p align="left">GGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGA</p></td> | <td width="397" valign="top"><p align="left">GGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC212</p></td> |
<td width="397" valign="top"><p align="left">GGTATCACCTTCAAACTTGACTTCAGCACGTGTCTTGTAGTTCCCGTCATCT</p></td> | <td width="397" valign="top"><p align="left">GGTATCACCTTCAAACTTGACTTCAGCACGTGTCTTGTAGTTCCCGTCATCT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC213</p></td> |
<td width="397" valign="top"><p align="left">GTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTT</p></td> | <td width="397" valign="top"><p align="left">GTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC214</p></td> |
<td width="397" valign="top"><p align="left">GTGTCCAAGAATGTTTCCATCTTCTTTAAAATCAATACCTTTTAACTCGATTC</p></td> | <td width="397" valign="top"><p align="left">GTGTCCAAGAATGTTTCCATCTTCTTTAAAATCAATACCTTTTAACTCGATTC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC215</p></td> |
<td width="397" valign="top"><p align="left">AGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATA</p></td> | <td width="397" valign="top"><p align="left">AGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC216</p></td> |
<td width="397" valign="top"><p align="left">CCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTA</p></td> | <td width="397" valign="top"><p align="left">CCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC217</p></td> |
<td width="397" valign="top"><p align="left">TGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTG</p></td> | <td width="397" valign="top"><p align="left">TGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC218</p></td> |
<td width="397" valign="top"><p align="left">TCTGCTAGTTGAACGCTTCCATCTTCAATGTTGTGTCTAATTTTGAAGTTA</p></td> | <td width="397" valign="top"><p align="left">TCTGCTAGTTGAACGCTTCCATCTTCAATGTTGTGTCTAATTTTGAAGTTA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC219</p></td> |
<td width="397" valign="top"><p align="left">GGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGG</p></td> | <td width="397" valign="top"><p align="left">GGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC220</p></td> |
<td width="397" valign="top"><p align="left">CAGGTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATTGGAGTATTTT</p></td> | <td width="397" valign="top"><p align="left">CAGGTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATTGGAGTATTTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC221</p></td> |
<td width="397" valign="top"><p align="left">TTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCC</p></td> | <td width="397" valign="top"><p align="left">TTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC222</p></td> |
<td width="397" valign="top"><p align="left">AAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGA</p></td> | <td width="397" valign="top"><p align="left">AAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC223</p></td> |
<td width="397" valign="top"><p align="left">GAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATG</p></td> | <td width="397" valign="top"><p align="left">GAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC224</p></td> |
<td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCT</p></td> | <td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC1 </p></td> |
<td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATG</p></td> | <td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATG</p></td> | ||
- | <td width="52 | + | <td width="52"><p align="center">26</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC2 </p></td> |
<td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAA</p></td> | <td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAA</p></td> | ||
- | <td width="52 | + | <td width="52"><p align="center">19</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC3 </p></td> |
<td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATG</p></td> | <td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATG</p></td> | ||
- | <td width="52 | + | <td width="52"><p align="center">21</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC4 </p></td> |
<td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCC</p></td> | <td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCC</p></td> | ||
- | <td width="52 | + | <td width="52"><p align="center">27</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
+ | </table> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | < | + | <h3 id="coop">The experimental procedure and analysis</h3> |
- | + | <h3 id="coop">1、Dissolving of primers</h3> | |
- | <h3>1、Dissolving of primers</h3> | + | <p id="coop">Sterile deionized water whose volume is determined by primer’s molecular weight is used to dilute the solution of the primer to 10um/L. And it is prepared for the following experiment.</p> |
- | <p>Sterile deionized water whose volume is determined by primer’s molecular weight is used to dilute the solution of the primer to 10um/L. And it is prepared for the following experiment.</p> | + | <h3 id="coop">2、Mixing of primers</h3> |
- | <h3>2、Mixing of primers</h3> | + | <p id="coop">Oligonucleotides synthesized in powder form need to be centrifuged for 1 min at 10000rpm to assemble powders to the bottom of the EP tube.And be careful to open the cap.<br /> |
- | <p>Oligonucleotides synthesized in powder form need to be centrifuged for 1 min at 10000rpm to assemble powders to the bottom of the EP tube.And be careful to open the cap.<br /> | + | |
Make sure that the synthesis report is consistent to the OD number on the primer label,and check the number of the dispensing tube before the dissolution of oligonucleotides.The volume of water added to make 10umol/L oligonucleotides’ solution is calculated according to the synthetic single report of each primer. Add sterile deionized water and keep it at room temperature for 2min.And reverse the tube to accelerate the progress of solubilization. Finally, collect substances at the bottom of the tube after centrifugation.<br /> | Make sure that the synthesis report is consistent to the OD number on the primer label,and check the number of the dispensing tube before the dissolution of oligonucleotides.The volume of water added to make 10umol/L oligonucleotides’ solution is calculated according to the synthetic single report of each primer. Add sterile deionized water and keep it at room temperature for 2min.And reverse the tube to accelerate the progress of solubilization. Finally, collect substances at the bottom of the tube after centrifugation.<br /> | ||
Every six primers are combined to one group.Add 4ulbeginning fiprimer, 1ulintermediate primer and 4ul end primerto a new EP tube, then add sterile deionized water to 20ul, mix them up as spare.</p> | Every six primers are combined to one group.Add 4ulbeginning fiprimer, 1ulintermediate primer and 4ul end primerto a new EP tube, then add sterile deionized water to 20ul, mix them up as spare.</p> | ||
- | |||
- | |||
<div align="center"> | <div align="center"> | ||
- | <table border="1" cellspacing="0" cellpadding="0" width="612"> | + | <table align="center" border="1" cellspacing="0" cellpadding="0" width="612"> |
<tr> | <tr> | ||
<td width="67"><p align="center"><strong>组别</strong><strong> </strong></p></td> | <td width="67"><p align="center"><strong>组别</strong><strong> </strong></p></td> | ||
Line 1,013: | Line 1,002: | ||
- | <h3>DA-PCR</h3> | + | <h3 id="coop">DA-PCR</h3> |
- | <p>Every six primers which are single-stranded oligonucleotidesare chemically synthesized were combined to one group. Then they were going to be made as longer double-stranded fragments of intermediate (Block) by DA-PCR.<br /> | + | <p id="coop">Every six primers which are single-stranded oligonucleotidesare chemically synthesized were combined to one group. Then they were going to be made as longer double-stranded fragments of intermediate (Block) by DA-PCR.<br /> |
Procedure of DA-PCR: <br /> | Procedure of DA-PCR: <br /> | ||
Mixed primer solutions 5μl<br /> | Mixed primer solutions 5μl<br /> | ||
Line 1,034: | Line 1,023: | ||
100bp Marker 5μl spotting directly<br /> | 100bp Marker 5μl spotting directly<br /> | ||
75V electrophoress for 1h。 </p> | 75V electrophoress for 1h。 </p> | ||
- | <h3>4、OE-PCR </h3> | + | <h3 id="coop">4、OE-PCR </h3> |
- | <p> Take the 5 double strand intermediate fragment (Block) spliced by DA-PCR as templates, blocks were further connected by OR-PCR, OE-PCR in a reaction system consisting of:<br /> | + | <p id="coop"> Take the 5 double strand intermediate fragment (Block) spliced by DA-PCR as templates, blocks were further connected by OR-PCR, OE-PCR in a reaction system consisting of:<br /> |
Block1 1μl<br /> | Block1 1μl<br /> | ||
Block2 1μl<br /> | Block2 1μl<br /> | ||
Line 1,049: | Line 1,038: | ||
dNTP 4μl<br /> | dNTP 4μl<br /> | ||
10×<em>Pfu</em> buffer(Mg2+) 5μl<br /> | 10×<em>Pfu</em> buffer(Mg2+) 5μl<br /> | ||
- | + | Sterilized ultrapure water to 50ul<br /> | |
Procedure of OE-PCR: <br /> | Procedure of OE-PCR: <br /> | ||
94℃ 2min<br /> | 94℃ 2min<br /> | ||
- | + | 94℃ 30S<br /> | |
50℃ 30S 20 cycles<br /> | 50℃ 30S 20 cycles<br /> | ||
72℃ 2min<br /> | 72℃ 2min<br /> | ||
72℃ 10min<br /> | 72℃ 10min<br /> | ||
- | + | 4℃ preservation<br /> | |
End<br /> | End<br /> | ||
The full-length gene spliced by OE-PCR was detected by a 1% agarose gel electrophoresis, specific programs are as follows<br /> | The full-length gene spliced by OE-PCR was detected by a 1% agarose gel electrophoresis, specific programs are as follows<br /> | ||
- | + | OE-PCR product 5μl <br /> | |
10×Loading Buffer 0.6μl spotted after mixing well<br /> | 10×Loading Buffer 0.6μl spotted after mixing well<br /> | ||
- | + | 100bp Marker 5μl spotted directly<br /> | |
80V electrophoresis for 1h。 </p> | 80V electrophoresis for 1h。 </p> | ||
- | <h3>5、Constructing and sequencing of subcloning vector </h3> | + | <h3 id="coop">5、Constructing and sequencing of subcloning vector </h3> |
- | <p>We design a primer AC-B with Blp I site and a primer AC-S with SgrA I site. Then we use RFP-promoter-GFP as template in PCR. Then we use Blp I and SgrA I enzyme to digest the target fragment and pET32a vector(37℃,3h) and link it overnight(16℃). After this step, transform the linked vector to competent cell(E.coli BL21) and select the desirable colony by using “Blue-White Selection” method.<br /> | + | <p id="coop">We design a primer AC-B with Blp I site and a primer AC-S with SgrA I site. Then we use RFP-promoter-GFP as template in PCR. Then we use Blp I and SgrA I enzyme to digest the target fragment and pET32a vector(37℃,3h) and link it overnight(16℃). After this step, transform the linked vector to competent cell(E.coli BL21) and select the desirable colony by using “Blue-White Selection” method.<br /> |
<strong>Constitute of </strong><em>Blp</em>Ⅰand <em>Sgr</em>AⅠdouble enzyme digestion reaction system:<strong> </strong><br /> | <strong>Constitute of </strong><em>Blp</em>Ⅰand <em>Sgr</em>AⅠdouble enzyme digestion reaction system:<strong> </strong><br /> | ||
Gene or plasmid 10μl<br /> | Gene or plasmid 10μl<br /> | ||
Line 1,093: | Line 1,082: | ||
On the pET32a vector(as shown in Fig 1), use the RFP-promoter-GFP gene (1535bp) to replace the fragment between <em>Blp</em>Ⅰ site and <em>Sgr</em>A I site (753bp) and then we get the reconstructed plasmid, pET-mlr promoter.</p> | On the pET32a vector(as shown in Fig 1), use the RFP-promoter-GFP gene (1535bp) to replace the fragment between <em>Blp</em>Ⅰ site and <em>Sgr</em>A I site (753bp) and then we get the reconstructed plasmid, pET-mlr promoter.</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2014/9/93/Simonsong-notebook-10.png" align="center"/></center> | ||
+ | <p align="center">Fig 3 Map of pET-mlr promoter <br>Select the white colony on culture and culture it. Then we extract the plasmid and use it as template in PCR to identify the colony. In theory, the reconstructed vector with RFP-promoter-GFP fragment is 1728bp and the empty vector without mlrA fragment is 946bp. So, the result shows that the white colony we select has reconstructed vector with mlrA fragment in it.</p> | ||
+ | <center><img src="https://static.igem.org/mediawiki/2014/2/28/Simonsong-notebook-4.png" /></center> | ||
- | + | <p align="center">Figure 3 PCR identification of recombinant vector pET-mlr promoter<br></p> | |
- | + | <p id="coop"> Illustration of the outcome: <br> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | <p align="center"> | + | |
- | + | ||
- | + | ||
- | <p | + | |
- | + | ||
1、L1, L2 could be amplified to 1700bp products, the recombinant vector contained a foreign gene RFP-promoter-GFP according to the result of the identification.<br> | 1、L1, L2 could be amplified to 1700bp products, the recombinant vector contained a foreign gene RFP-promoter-GFP according to the result of the identification.<br> | ||
2、M was 1000bp Ladder Marker<br> | 2、M was 1000bp Ladder Marker<br> | ||
The positive clones which were proved to contain the recombinant vectors pET-mlr promoter by PCR identification. were sent to 吉林库美生物科技限公司to be sequenced. The results showed (Figure 4), RFP-promoter-GFP sequence is consistent with the design sequence.</p> | The positive clones which were proved to contain the recombinant vectors pET-mlr promoter by PCR identification. were sent to 吉林库美生物科技限公司to be sequenced. The results showed (Figure 4), RFP-promoter-GFP sequence is consistent with the design sequence.</p> | ||
- | <div | + | <div style="text-align:center"><img src="https://static.igem.org/mediawiki/2014/d/d8/Simonsong-notebook-5.png" /> |
<img src="https://static.igem.org/mediawiki/2014/5/5a/Simonsong-notebook-6.png" /> | <img src="https://static.igem.org/mediawiki/2014/5/5a/Simonsong-notebook-6.png" /> | ||
<img src="https://static.igem.org/mediawiki/2014/5/53/Simonsong-notebook-7.png" /></div> | <img src="https://static.igem.org/mediawiki/2014/5/53/Simonsong-notebook-7.png" /></div> | ||
- | < | + | <center><p>Figure 4 Sequencing results with the design sequence alignment</p></center> |
- | <h3>The relationship detection between MLR promoter and microcystin LR </h3> | + | <h3 id="coop">The relationship detection between MLR promoter and microcystin LR </h3> |
- | <p>Single colony containingthe recombinant vector pET-mlr promoterwas picked ,vigorously shaken culture for 4-5h in LB liquid medium at 37 ℃,the culturing stopped until OD600 reached 0.3 - 0.4, 10-fold dilution to 10-5-10-7with sterilized water, taking 100ul to coat on the LB plate containing 10ug / L microcystin LR, 37 ℃ for overnight. <br> | + | <p id="coop">Single colony containingthe recombinant vector pET-mlr promoterwas picked ,vigorously shaken culture for 4-5h in LB liquid medium at 37 ℃,the culturing stopped until OD600 reached 0.3 - 0.4, 10-fold dilution to 10-5-10-7with sterilized water, taking 100ul to coat on the LB plate containing 10ug / L microcystin LR, 37 ℃ for overnight. <br> |
Single cultured colony was placed in the UV lamp darkroom, we observed colony color and found that it luminesced green light, indicating that when there is microcystin LR, mlr promoter can promote the expression of GFP, which makes the single colony of E.coli BL21 luminescing green fluorescence in the UV lamp.</p> | Single cultured colony was placed in the UV lamp darkroom, we observed colony color and found that it luminesced green light, indicating that when there is microcystin LR, mlr promoter can promote the expression of GFP, which makes the single colony of E.coli BL21 luminescing green fluorescence in the UV lamp.</p> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
+ | <div style="text-align:center"><img src="https://static.igem.org/mediawiki/2014/5/50/Simonsong-notebook-8.png" /></div> | ||
+ | <div> | ||
+ | <a height="20px" width="5%" align="center" onMouseOver="this.bgColor='#FFFFFF'" onMouseOut="this.bgColor='#A1DBB2'" href="#menu" style="text-decoration:none;color:#1C140D;float:right;background:#A1DBB2;"> Top </a> | ||
+ | </div> | ||
</table> | </table> | ||
</div> | </div> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
</body> | </body> | ||
</html> | </html> |
Latest revision as of 03:35, 18 October 2014
Welcome!
|
The experimental procedure and analysis1、Dissolving of primersSterile deionized water whose volume is determined by primer’s molecular weight is used to dilute the solution of the primer to 10um/L. And it is prepared for the following experiment. 2、Mixing of primersOligonucleotides synthesized in powder form need to be centrifuged for 1 min at 10000rpm to assemble powders to the bottom of the EP tube.And be careful to open the cap.
DA-PCREvery six primers which are single-stranded oligonucleotidesare chemically synthesized were combined to one group. Then they were going to be made as longer double-stranded fragments of intermediate (Block) by DA-PCR. 4、OE-PCR Take the 5 double strand intermediate fragment (Block) spliced by DA-PCR as templates, blocks were further connected by OR-PCR, OE-PCR in a reaction system consisting of: 5、Constructing and sequencing of subcloning vectorWe design a primer AC-B with Blp I site and a primer AC-S with SgrA I site. Then we use RFP-promoter-GFP as template in PCR. Then we use Blp I and SgrA I enzyme to digest the target fragment and pET32a vector(37℃,3h) and link it overnight(16℃). After this step, transform the linked vector to competent cell(E.coli BL21) and select the desirable colony by using “Blue-White Selection” method. Fig 3 Map of pET-mlr promoter Figure 3 PCR identification of recombinant vector pET-mlr promoter Illustration of the outcome: Figure 4 Sequencing results with the design sequence alignment The relationship detection between MLR promoter and microcystin LRSingle colony containingthe recombinant vector pET-mlr promoterwas picked ,vigorously shaken culture for 4-5h in LB liquid medium at 37 ℃,the culturing stopped until OD600 reached 0.3 - 0.4, 10-fold dilution to 10-5-10-7with sterilized water, taking 100ul to coat on the LB plate containing 10ug / L microcystin LR, 37 ℃ for overnight. |