Team:Jilin China/NOTEBOOK
From 2014.igem.org
(88 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
{{CSS/Main}} | {{CSS/Main}} | ||
- | < | + | <html> |
- | + | ||
<head> | <head> | ||
+ | <style type="text/css"> | ||
+ | .observation{} | ||
+ | .observe1{width:600px;margin:0 auto} | ||
+ | #coop{font-size:18px;padding:0px 20px;} | ||
+ | .clear{clear:both} | ||
+ | </style> | ||
+ | |||
+ | <style type="text/css"> | ||
+ | .home_second_block_div{width:265px; | ||
+ | float:left; | ||
+ | border:2px solid #ccc; | ||
+ | background-color:#fff; | ||
+ | padding:5px 10px; | ||
+ | margin:10px; | ||
+ | |||
+ | } | ||
+ | #bodyContent{ | ||
+ | width:965px; | ||
+ | margin:0 aotu; | ||
+ | } | ||
+ | .home_second_block_div h2{ | ||
+ | font-weight:bold; | ||
+ | } | ||
+ | .home_second_block_div p a{ | ||
+ | text-decoration:none; | ||
+ | color:blue;} | ||
+ | .logo{ | ||
+ | float:right; | ||
+ | } | ||
+ | .menu { | ||
+ | margin-top: 14px; | ||
+ | font-family: arial,sans-serif; | ||
+ | height: 50px; | ||
+ | margin: 0 auto 30px; | ||
+ | width: 980px; | ||
+ | } | ||
+ | .menu ul { | ||
+ | padding:0; | ||
+ | margin:0; | ||
+ | list-style: none; | ||
+ | } | ||
+ | .menu ul li { | ||
+ | float:left; | ||
+ | position:relative; | ||
+ | |||
+ | } | ||
+ | .menu ul li a, .menu ul li a:visited { | ||
+ | display:block; | ||
+ | text-align:center; | ||
+ | text-decoration:none; | ||
+ | padding-left:25px; | ||
+ | padding-right:25px; | ||
+ | height:30px; | ||
+ | color:#000; | ||
+ | border:1px solid #fff; | ||
+ | border-width:1px 1px 0 0; | ||
+ | line-height:40px; | ||
+ | font-size:15px; | ||
+ | } | ||
+ | .menu ul li ul { | ||
+ | display: none; | ||
+ | z-index:10; | ||
+ | } | ||
+ | .menu ul li:hover a { | ||
+ | color:#000; | ||
+ | height:50px; | ||
+ | display:block; | ||
+ | background:#ecffeb; | ||
+ | } | ||
+ | .menu ul li:hover ul { | ||
+ | display:block; | ||
+ | position:absolute; | ||
+ | top:50px; | ||
+ | left:0; | ||
+ | width:105px; | ||
+ | height:50px; | ||
+ | } | ||
+ | .menu ul li:hover ul li a { | ||
+ | display:block; | ||
+ | color:#000; | ||
+ | height:30px; | ||
+ | width:100px; | ||
+ | background:#fff; | ||
+ | margin-top:-2px; | ||
+ | line-height:30px; | ||
+ | } | ||
+ | .menu ul li:hover ul li a:hover { | ||
+ | background:#dfc184; | ||
+ | color:#000; | ||
+ | } | ||
+ | .caret { | ||
+ | border-left: 4px solid transparent; | ||
+ | border-right: 4px solid transparent; | ||
+ | border-top: 4px solid; | ||
+ | display: inline-block; | ||
+ | height: 0; | ||
+ | margin-left: 2px; | ||
+ | width: 0; | ||
+ | vertical-align:middle !important; | ||
+ | } | ||
+ | </style> | ||
+ | </head> | ||
+ | <style> | ||
+ | #contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading,.visualClear {display: none;} /*-- hides default wiki settings --*/ | ||
+ | </style> | ||
+ | |||
+ | <!-- here ends the section that changes the default wiki template to a white full width background --> | ||
+ | |||
+ | |||
+ | <!-- beginning of your page --> | ||
+ | |||
+ | <link href="http://maxcdn.bootstrapcdn.com/bootstrap/2.3.2/css/bootstrap.css" rel="stylesheet" /> | ||
+ | |||
+ | </head> | ||
+ | <body style="width: 965px;display:block;word-break: break-all; | ||
+ | word-wrap: break-word;margin:0 auto;background:url(https://static.igem.org/mediawiki/2014/d/d7/Uea_body-bg.png);"> | ||
+ | |||
+ | |||
+ | <!-- menu --> | ||
+ | <div class="menu"> | ||
+ | |||
+ | <!---比赛logo----> | ||
+ | <div class="logo"> | ||
+ | <a href="https://2014.igem.org/Main_Page"><img style="height:80px;"src="https://static.igem.org/mediawiki/2014/a/a3/Uea_igem-logo.png"></a> | ||
+ | </div> | ||
+ | <!---吉大logo----> | ||
+ | <div style="float:left;"> | ||
+ | <a href="https://2014.igem.org/Team:Jilin_China"><img style="height:80px;"src="https://static.igem.org/mediawiki/2014/6/60/Jilin_China_igem_logo.gif"></a> | ||
+ | </div> | ||
+ | <table id="menu" cellspacing="0" height="135px"> | ||
+ | <ul> | ||
+ | <li><a style="margin-top:20px;" class="hide" href="https://2014.igem.org/Team:Jilin_China">HOME</a></li> | ||
+ | <li><a style="margin-top:20px;" class="hide">TEAM<span class="caret"></span></a> | ||
+ | <ul> | ||
+ | <li><a style="margin-top:20px;" href="https://2014.igem.org/Team:Jilin_China/Team Members" title="Cross browser fixed layout">OUR TEAM</a></li> | ||
+ | <li><a href="https://2014.igem.org/Team:Jilin_China/ATTRIBUTION" title="Cross browser fixed layout">ATTRIBUTION</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | |||
+ | <li><a style="margin-top:20px;" class="hide" >PROJECT<span class="caret"></span></a> | ||
+ | <ul> | ||
+ | <li><a style="margin-top:20px;" href="https://2014.igem.org/Team:Jilin_China/Outline" title="a coded list of spies">OUTLINE</a></li> | ||
+ | <li><a href="https://2014.igem.org/Team:Jilin_China/RESULT" title="a horizontal vertical menu">CONTRUST</a></li> | ||
+ | <li><a href="https://2014.igem.org/Team:Jilin_China/NOTEBOOK" title="a horizontal vertical menu">TEST</a></li> | ||
+ | <li><a href="https://2014.igem.org/Team:Jilin_China/Blueprint" title="a horizontal vertical menu">BLUEPRINT</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | |||
+ | <li><a style="margin-top:20px;" class="hide">IDEA<span class="caret"></span></a> | ||
+ | <ul> | ||
+ | <li><a style="margin-top:20px;" href="https://2014.igem.org/Team:Jilin_China/BACKGROUND" title="A drop down menu">BACKGROUND</a></li> | ||
+ | <li><a href="https://2014.igem.org/Team:Jilin_China/DESIGN" title="A cascading menu">DESIGN</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | |||
+ | <li><a style="margin-top:20px;" class="hide">PRACTICE<span class="caret"></span></a> | ||
+ | <ul> | ||
+ | <li><a style="margin-top:20px;" href="https://2014.igem.org/Team:Jilin_China/Coorperation" title="colour wheel">COORPERATION</a></li> | ||
+ | <li><a href="https://2014.igem.org/Team:Jilin_China/observation" title="a menu using opacity">OBSERVATION</a></li> | ||
+ | <li><a href="https://2014.igem.org/Team:Jilin_China/Propagate" title="partial opacity">PROPAGATE</a></li> | ||
+ | <li><a href="https://2014.igem.org/Team:Jilin_China/Survey" title="partial opacity II">SURVEY</a></li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | |||
+ | <li><a style="margin-top:20px;" class="hide" href="https://2014.igem.org/Team:Jilin_China/Acknowledgement">ACKNOWLEDGEMENT</a></li> | ||
+ | </ul> | ||
+ | </table> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!--First block of content --> | ||
+ | <table id="firstblock" width="100%" cellspacing="0"> | ||
+ | <tr> | ||
+ | <td background="https://static.igem.org/mediawiki/2014/d/d7/Uea_body-bg.png"></td> | ||
+ | <td align="center" background="https://static.igem.org/mediawiki/2014/d/d7/Uea_body-bg.png" > | ||
+ | |||
+ | <!-- You can replace this image with your team's logo! --> | ||
+ | |||
+ | <h3>Welcome! <br>Team Jilin China</h3> | ||
+ | |||
+ | |||
+ | </td> | ||
+ | <td background="https://static.igem.org/mediawiki/2014/d/d7/Uea_body-bg.png"></td> | ||
+ | </tr> | ||
+ | </table> | ||
+ | |||
+ | <!-- end of first block --> | ||
+ | |||
+ | <!-- Block of content 1 --> | ||
+ | <table width="100%" cellspacing="0" height="0px"> | ||
+ | <tr><td bgColor="#FEE5AD"></td> | ||
+ | <td width="975px" align="left" bgColor="#FEE5AD" > | ||
+ | <table width="975px" cellspacing="0" height="0px"> | ||
+ | <tr> | ||
+ | |||
+ | <td width="100%" rowspan="3" align="left"> | ||
+ | <td bgColor=#FEE5AD> </td> | ||
+ | <!-- clear the floats if required --> | ||
+ | <div class="clear"> </div> | ||
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /> | <meta http-equiv="Content-Type" content="text/html; charset=gb2312" /> | ||
<title>NOTEBOOK</title> | <title>NOTEBOOK</title> | ||
</head> | </head> | ||
- | + | <div id="coop"> | |
- | < | + | <h3 align="center">Synthesis and Characterisation of the Mlr Promoter</h3> |
- | < | + | <h3>Research background</h3> |
- | + | ||
- | < | + | |
<p>A novel pathway for degradation of the cyanobacterial heptapeptide hepatotoxin microcystin LR was identified in a newly isolated <em>Sphingomonas sp.</em> (Bourne et al. 1996 Appl. Environ. Microbiol. 62: 4086–4094). And the gene cluster involved in bacterial degradation of the cyanobacterial<br /> | <p>A novel pathway for degradation of the cyanobacterial heptapeptide hepatotoxin microcystin LR was identified in a newly isolated <em>Sphingomonas sp.</em> (Bourne et al. 1996 Appl. Environ. Microbiol. 62: 4086–4094). And the gene cluster involved in bacterial degradation of the cyanobacterial<br /> | ||
toxin microcystin LR were be reported by David G. Bourne in 2001. The cloning and molecular characterisation of four genes from this <em>Sphingomonas sp. </em>that exist on a 5.8-kb genomic fragment and encode the three hydrolytic enzymes involved in this pathway together with a putative oligopeptide transporter. Situated immediately downstream of <em>mlrA </em>with the same direction of transcription is a gene <em>mlrD</em>, whose conceptual translation (MlrD, 442residues) shows significant sequence identity and similar potential transmembrane spanning regions to the PTR2family of oligopeptide transporters. A gene <em>mlrB </em>is situated downstream of the <em>mlrA </em>and <em>mlrD </em>genes, but transcribed in the opposite direction. The gene encodes the enzyme MlrB (402residues) which cleaves linear microcystin LR to a tetrapeptide degradation product. This enzyme belongs to the “penicillin-binding enzyme” family of active site serine hydrolases. The final gene in the cluster <em>mlrC</em>, is located upstream of the <em>mlrA </em>gene and is transcribed in the opposite direction. It codes for MlrC (507 residues) which mediates further peptidolytic degradation of the tetrapeptide. This protein shows significant sequence identity to a hypothetical protein from <em>Streptomyces coelicolor</em>. It is suspected to be a metallopeptidase based on inhibition by metal chelators. It is postulated on the basis of comparison with other microorganisms that the genes in this cluster may all be involved in cell wall peptidoglycan cycling and subsequently act fortuitously in hydrolysis of microcystin LR.<br /> | toxin microcystin LR were be reported by David G. Bourne in 2001. The cloning and molecular characterisation of four genes from this <em>Sphingomonas sp. </em>that exist on a 5.8-kb genomic fragment and encode the three hydrolytic enzymes involved in this pathway together with a putative oligopeptide transporter. Situated immediately downstream of <em>mlrA </em>with the same direction of transcription is a gene <em>mlrD</em>, whose conceptual translation (MlrD, 442residues) shows significant sequence identity and similar potential transmembrane spanning regions to the PTR2family of oligopeptide transporters. A gene <em>mlrB </em>is situated downstream of the <em>mlrA </em>and <em>mlrD </em>genes, but transcribed in the opposite direction. The gene encodes the enzyme MlrB (402residues) which cleaves linear microcystin LR to a tetrapeptide degradation product. This enzyme belongs to the “penicillin-binding enzyme” family of active site serine hydrolases. The final gene in the cluster <em>mlrC</em>, is located upstream of the <em>mlrA </em>gene and is transcribed in the opposite direction. It codes for MlrC (507 residues) which mediates further peptidolytic degradation of the tetrapeptide. This protein shows significant sequence identity to a hypothetical protein from <em>Streptomyces coelicolor</em>. It is suspected to be a metallopeptidase based on inhibition by metal chelators. It is postulated on the basis of comparison with other microorganisms that the genes in this cluster may all be involved in cell wall peptidoglycan cycling and subsequently act fortuitously in hydrolysis of microcystin LR.<br /> | ||
- | In this study, we synthesized a RFP-promoter-GFP sequence to detect the relationship between MLR promoter and microcystin LR. This synthesized sequence using the promoter sequence between mlrA and mlrC, adding the red fluorescent protein sequence in the upstream to instead mlrC gene, and adding green fluorescent protein sequence in the downstream to instead mlrA gene. <img src=" | + | In this study, we synthesized a RFP-promoter-GFP sequence to detect the relationship between MLR promoter and microcystin LR. This synthesized sequence using the promoter sequence between mlrA and mlrC, adding the red fluorescent protein sequence in the upstream to instead mlrC gene, and adding green fluorescent protein sequence in the downstream to instead mlrA gene.</br> |
- | + | <center><img src="https://static.igem.org/mediawiki/2014/c/cb/Simonsong-notebook-1.png"> </center></p> | |
<p align="center">Fig 1 Restriction map of the 5.8 kb of sequence data and localisation of genes involved in microcystin LR degradation.</p> | <p align="center">Fig 1 Restriction map of the 5.8 kb of sequence data and localisation of genes involved in microcystin LR degradation.</p> | ||
- | < | + | <h3>methods</h3> |
<h3>Synthetic sequence</h3> | <h3>Synthetic sequence</h3> | ||
<p> BamHI<br /> | <p> BamHI<br /> | ||
Line 72: | Line 268: | ||
CTTGCCCTCTTAACTTGGTACTCATTTCCTCTTCTTGAAAAGTGACCTCAACAG AACTTAATCTACCACTACAATTACCCGTGTTTAAAAGACAGTCACCTCTCCC TTGTATGCCTTTTGAATGGGAATTTAAATAAACGTGATGACCTTTTGATGGA TGTGAACAGTGATGAAAGCCAATACCACAAGTTACGAAACGCTCTATGGGTC TCGTACTGAAAAAGTTCTCACGGTACGGACTTCCAATACATGTCCTTTCTTGAT TCTACTGCCCTTGATGTTCTGTGCACGACTTCAGTTCAAACTTCCACTATGG CTTAGCTCAATTTTCCATAACTAAAATTTCTTCTACCTTTGTAAGAACCTGTG ATGTTGATATTGAGTGTGTTACATATGTAGTACCGTCTGTTTGTTTTCTTACC ATTGAAGTTTTAATCTGTGTTGTAACTTCTACCTTCGCAAGTTGATCGTCT TTTTATGAGGTTAACCGCTACCGGGACAGGAAAATGGTCTGTTGGTAATGGAC AGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAAGAA TCGACGACCCTAATGTGTACCGTACCTACTTGATATGTTTATTCTTAAGGC<br /> | CTTGCCCTCTTAACTTGGTACTCATTTCCTCTTCTTGAAAAGTGACCTCAACAG AACTTAATCTACCACTACAATTACCCGTGTTTAAAAGACAGTCACCTCTCCC TTGTATGCCTTTTGAATGGGAATTTAAATAAACGTGATGACCTTTTGATGGA TGTGAACAGTGATGAAAGCCAATACCACAAGTTACGAAACGCTCTATGGGTC TCGTACTGAAAAAGTTCTCACGGTACGGACTTCCAATACATGTCCTTTCTTGAT TCTACTGCCCTTGATGTTCTGTGCACGACTTCAGTTCAAACTTCCACTATGG CTTAGCTCAATTTTCCATAACTAAAATTTCTTCTACCTTTGTAAGAACCTGTG ATGTTGATATTGAGTGTGTTACATATGTAGTACCGTCTGTTTGTTTTCTTACC ATTGAAGTTTTAATCTGTGTTGTAACTTCTACCTTCGCAAGTTGATCGTCT TTTTATGAGGTTAACCGCTACCGGGACAGGAAAATGGTCTGTTGGTAATGGAC AGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAAGAA TCGACGACCCTAATGTGTACCGTACCTACTTGATATGTTTATTCTTAAGGC<br /> | ||
TAGGACCCGGATAGACTTTACAAGACGACTGTCTTGCCCTCTTAACTTGGTACTCATTTCCTCTTCTTGAAAAGTGACCTCAACAGGGTTAAGAACAACTTAATCTACCACTACAATTACCCGTGTTTAAAAGACAGTCACCTCTCCCACTTCCACTACGTTGTATGCCTTTTGAATGGGAATTTAAATAAACGTGATGACCTTTTGATGGACAAGGTACCGGTTGTGAACAGTGATGAAAGCCAATACCACAAGTTACGAAACGCTCTATGGGTCTAGTGTACTTTGTCGTACTGAAAAAGTTCTCACGGTACGGACTTCCAATACATGTCCTTTCTTGATATAAAAAGTTTCTACTGCCCTTGATGTTCTGTGCACGACTTCAGTTCAAACTTCCACTATGGGAACAATTATCTTAGCTCAATTTTCCATAACTAAAATTTCTTCTACCTTTGTAAGAACCTGTGTTTAACCTTATGTTGATATTGAGTGTGTTACATATGTAGTACCGTCTGTTTGTTTTCTTACCTTAGTTTCAATTGAAGTTTTAATCTGTGTTGTAACTTCTACCTTCGCAAGTTGATCGTCTGGTAATAGTTGTTTTATGAGGTTAACCGCTACCGGGACAGGAAAATGGTCTGTTGGTAATGGACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAAGAACTCAAACATTGTCGACGACCCTAATGTGTACCGTACCTACTTGATATGTTTATTCTTAAGGC </p> | TAGGACCCGGATAGACTTTACAAGACGACTGTCTTGCCCTCTTAACTTGGTACTCATTTCCTCTTCTTGAAAAGTGACCTCAACAGGGTTAAGAACAACTTAATCTACCACTACAATTACCCGTGTTTAAAAGACAGTCACCTCTCCCACTTCCACTACGTTGTATGCCTTTTGAATGGGAATTTAAATAAACGTGATGACCTTTTGATGGACAAGGTACCGGTTGTGAACAGTGATGAAAGCCAATACCACAAGTTACGAAACGCTCTATGGGTCTAGTGTACTTTGTCGTACTGAAAAAGTTCTCACGGTACGGACTTCCAATACATGTCCTTTCTTGATATAAAAAGTTTCTACTGCCCTTGATGTTCTGTGCACGACTTCAGTTCAAACTTCCACTATGGGAACAATTATCTTAGCTCAATTTTCCATAACTAAAATTTCTTCTACCTTTGTAAGAACCTGTGTTTAACCTTATGTTGATATTGAGTGTGTTACATATGTAGTACCGTCTGTTTGTTTTCTTACCTTAGTTTCAATTGAAGTTTTAATCTGTGTTGTAACTTCTACCTTCGCAAGTTGATCGTCTGGTAATAGTTGTTTTATGAGGTTAACCGCTACCGGGACAGGAAAATGGTCTGTTGGTAATGGACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAAGAACTCAAACATTGTCGACGACCCTAATGTGTACCGTACCTACTTGATATGTTTATTCTTAAGGC </p> | ||
- | <h3>Primer | + | <h3>Primer synthesis</h3> |
- | < | + | <h4>Primer synthesis order o Comate Bioscience Co.,Ltd.</h4> |
- | + | <div align="center"> | |
- | + | <table align="center" border="1" cellspacing="0" cellpadding="0" width="950px"> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | <table border="1" cellspacing="0" cellpadding="0" width=" | + | |
<tr> | <tr> | ||
- | <td width="50" nowrap="nowrap"><p align="center"><strong> | + | <td width="50" nowrap="nowrap"><p align="center"><strong>Num</strong><strong> </strong></p></td> |
- | <td width="397" nowrap="nowrap"><p align="center"><strong> | + | <td width="397" nowrap="nowrap"><p align="center"><strong>Sequence</strong><strong>(5' to 3')</strong></p></td> |
- | <td width="52" nowrap="nowrap"><p align="center"><strong> | + | <td width="52" nowrap="nowrap"><p align="center"><strong>Base Count(</strong><strong>bp</strong><strong>)</strong><strong> </strong></p></td> |
- | <td width="62" nowrap="nowrap"><p align="center"><strong> | + | <td width="62" nowrap="nowrap"><p align="center"><strong>Total Synthesis</strong><strong>(OD)</strong></p></td> |
- | <td width="48" nowrap="nowrap"><p align="center"><strong> | + | <td width="48" nowrap="nowrap"><p align="center"><strong>Subpackage Pipe Counts</strong><strong> </strong></p></td> |
- | <td width="56" nowrap="nowrap"><p align="center"><strong> | + | <td width="56" nowrap="nowrap"><p align="center"><strong>Purification Mode</strong><strong> </strong></p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC101</p></td> |
<td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATGTCTACCTTCTGTTCTTTCATATTGTTCAACAAT</p></td> | <td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATGTCTACCTTCTGTTCTTTCATATTGTTCAACAAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">59</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC102</p></td> |
<td width="397" valign="top"><p align="left">GTTAGATATTACATCACATAATGAAGATTATACAATTGTTGAACAATATGAAAGAACAGA</p></td> | <td width="397" valign="top"><p align="left">GTTAGATATTACATCACATAATGAAGATTATACAATTGTTGAACAATATGAAAGAACAGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC103</p></td> |
<td width="397" valign="top"><p align="left">ATCTTCATTATGTGATGTAATATCTAACTTAGCATCTACATAATAATATCCTGGTAAT</p></td> | <td width="397" valign="top"><p align="left">ATCTTCATTATGTGATGTAATATCTAACTTAGCATCTACATAATAATATCCTGGTAAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">58</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC104</p></td> |
<td width="397" valign="top"><p align="left">TTAAATCAATTTATATGGCTAAAAAACCAGTTCAATTACCAGGATATTATTATGTAGATG</p></td> | <td width="397" valign="top"><p align="left">TTAAATCAATTTATATGGCTAAAAAACCAGTTCAATTACCAGGATATTATTATGTAGATG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC105</p></td> |
<td width="397" valign="top"><p align="left">GGTTTTTTAGCCATATAAATTGATTTAAATTCAACTAAATAATGTCCTCCGTCC</p></td> | <td width="397" valign="top"><p align="left">GGTTTTTTAGCCATATAAATTGATTTAAATTCAACTAAATAATGTCCTCCGTCC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC106</p></td> |
<td width="397" valign="top"><p align="left">GGGAGAAACACATAAAGCTCTAAAATTAAAGGACGGAGGACATTATTTAGTT</p></td> | <td width="397" valign="top"><p align="left">GGGAGAAACACATAAAGCTCTAAAATTAAAGGACGGAGGACATTATTTAGTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC107</p></td> |
<td width="397" valign="top"><p align="left">GAGCTTTATGTGTTTCTCCCTTTAAAACCCCGTCTCTTGGATATAATCTTTCTGTAC</p></td> | <td width="397" valign="top"><p align="left">GAGCTTTATGTGTTTCTCCCTTTAAAACCCCGTCTCTTGGATATAATCTTTCTGTAC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC108</p></td> |
<td width="397" valign="top"><p align="left">GCAAAAAAAAACAATGGGATGGGAAGCTAGTACAGAAAGATTATATCCAAGAGA</p></td> | <td width="397" valign="top"><p align="left">GCAAAAAAAAACAATGGGATGGGAAGCTAGTACAGAAAGATTATATCCAAGAGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC109</p></td> |
<td width="397" valign="top"><p align="left">CCATCCCATTGTTTTTTTTTGCATAACTGGTCCGTCTGATGGAAAATTAACCC</p></td> | <td width="397" valign="top"><p align="left">CCATCCCATTGTTTTTTTTTGCATAACTGGTCCGTCTGATGGAAAATTAACCC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC110</p></td> |
<td width="397" valign="top"><p align="left">TACAAGATGGTTGTTTTATTTATAAAGTTAAATTTATTGGGGTTAATTTTCCATCAGACG</p></td> | <td width="397" valign="top"><p align="left">TACAAGATGGTTGTTTTATTTATAAAGTTAAATTTATTGGGGTTAATTTTCCATCAGACG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC111</p></td> |
<td width="397" valign="top"><p align="left">ACTTTATAAATAAAACAACCATCTTGTAATGATGAATCTTGTGTAACTGTAGCA</p></td> | <td width="397" valign="top"><p align="left">ACTTTATAAATAAAACAACCATCTTGTAATGATGAATCTTGTGTAACTGTAGCA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC112</p></td> |
<td width="397" valign="top"><p align="left">GGGAAAGAGTTATGAATTTTGAAGATGGTGGAGTTGCTACAGTTACACAAGATTCA</p></td> | <td width="397" valign="top"><p align="left">GGGAAAGAGTTATGAATTTTGAAGATGGTGGAGTTGCTACAGTTACACAAGATTCA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">56</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC113</p></td> |
<td width="397" valign="top"><p align="left">CTTCAAAATTCATAACTCTTTCCCATTTAAATCCTTCTGGAAAAGATAATTTTTTATAAT</p></td> | <td width="397" valign="top"><p align="left">CTTCAAAATTCATAACTCTTTCCCATTTAAATCCTTCTGGAAAAGATAATTTTTTATAAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC114</p></td> |
<td width="397" valign="top"><p align="left">CGTTAAACATCCAGCTGATATTCCAGATTATAAAAAATTATCTTTTCCAGAAGG</p></td> | <td width="397" valign="top"><p align="left">CGTTAAACATCCAGCTGATATTCCAGATTATAAAAAATTATCTTTTCCAGAAGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC115</p></td> |
<td width="397" valign="top"><p align="left">AATATCAGCTGGATGTTTAACGTAAACCTTTGATCCATATTGAAATTGTGGTGATAAA</p></td> | <td width="397" valign="top"><p align="left">AATATCAGCTGGATGTTTAACGTAAACCTTTGATCCATATTGAAATTGTGGTGATAAA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">58</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC116</p></td> |
<td width="397" valign="top"><p align="left">GGACCATTACCATTTGCGTGGGATATTTTATCACCACAATTTCAATATGGAT</p></td> | <td width="397" valign="top"><p align="left">GGACCATTACCATTTGCGTGGGATATTTTATCACCACAATTTCAATATGGAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC117</p></td> |
<td width="397" valign="top"><p align="left">CACGCAAATGGTAATGGTCCTCCTTTTGTAACCTTTAATTTAACTGTATTATGTCCTTC</p></td> | <td width="397" valign="top"><p align="left">CACGCAAATGGTAATGGTCCTCCTTTTGTAACCTTTAATTTAACTGTATTATGTCCTTC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">59</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC118</p></td> |
<td width="397" valign="top"><p align="left">GGGAGAAGGAGAAGGTAGACCGTATGAAGGACATAATACAGTTAAATTAAAG</p></td> | <td width="397" valign="top"><p align="left">GGGAGAAGGAGAAGGTAGACCGTATGAAGGACATAATACAGTTAAATTAAAG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC119</p></td> |
<td width="397" valign="top"><p align="left">GTCTACCTTCTCCTTCTCCCTCAATTTCAAATTCATGTCCATTAACTGTACCTT</p></td> | <td width="397" valign="top"><p align="left">GTCTACCTTCTCCTTCTCCCTCAATTTCAAATTCATGTCCATTAACTGTACCTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC120</p></td> |
<td width="397" valign="top"><p align="left">TGTTATTACAGAATTTATGAGATTTAAAGTTAGAATGGAAGGTACAGTTAATGGACATGA</p></td> | <td width="397" valign="top"><p align="left">TGTTATTACAGAATTTATGAGATTTAAAGTTAGAATGGAAGGTACAGTTAATGGACATGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">60</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC121</p></td> |
<td width="397" valign="top"><p align="left">TTTAAATCTCATAAATTCTGTAATAACATTTTCTGATGAAGCCATAACACGA</p></td> | <td width="397" valign="top"><p align="left">TTTAAATCTCATAAATTCTGTAATAACATTTTCTGATGAAGCCATAACACGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC122</p></td> |
<td width="397" valign="top"><p align="left">GCAGCTGGTGCAAACAACAGCAAACCGAAGACTCGTGTTATGGCTTCATCAG</p></td> | <td width="397" valign="top"><p align="left">GCAGCTGGTGCAAACAACAGCAAACCGAAGACTCGTGTTATGGCTTCATCAG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC123</p></td> |
<td width="397" valign="top"><p align="left">CTGTTGTTTGCACCAGCTGCTGCATCTTCACCCCATAAATCAACCGAACGGA</p></td> | <td width="397" valign="top"><p align="left">CTGTTGTTTGCACCAGCTGCTGCATCTTCACCCCATAAATCAACCGAACGGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC124</p></td> |
<td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAACAAGAATTGACTGTCCGTTCGGTTGATTTATGG</p></td> | <td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAACAAGAATTGACTGTCCGTTCGGTTGATTTATGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC201</p></td> |
<td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATGTTCTGCTGACAGAACGGGAGAATTGAACCAT</p></td> | <td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATGTTCTGCTGACAGAACGGGAGAATTGAACCAT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC202</p></td> |
<td width="397" valign="top"><p align="left">GACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATGGTTCAATTCTCCCGTTC</p></td> | <td width="397" valign="top"><p align="left">GACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATGGTTCAATTCTCCCGTTC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC203</p></td> |
<td width="397" valign="top"><p align="left">AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGG</p></td> | <td width="397" valign="top"><p align="left">AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
- | + | <tr> | |
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC204</p></td> |
<td width="397" valign="top"><p align="left">CCCTCTCCACTGACAGAAAATTTGTGCCCATTAACATCACCATCTAATTCAA</p></td> | <td width="397" valign="top"><p align="left">CCCTCTCCACTGACAGAAAATTTGTGCCCATTAACATCACCATCTAATTCAA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC205</p></td> |
<td width="397" valign="top"><p align="left">TTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTT</p></td> | <td width="397" valign="top"><p align="left">TTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC206</p></td> |
<td width="397" valign="top"><p align="left">AGGTAGTTTTCCAGTAGTGCAAATAAATTTAAGGGTAAGTTTTCCGTATGTT</p></td> | <td width="397" valign="top"><p align="left">AGGTAGTTTTCCAGTAGTGCAAATAAATTTAAGGGTAAGTTTTCCGTATGTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC207</p></td> |
<td width="397" valign="top"><p align="left">GCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG</p></td> | <td width="397" valign="top"><p align="left">GCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC208</p></td> |
<td width="397" valign="top"><p align="left">CTGGGTATCTCGCAAAGCATTGAACACCATAACCGAAAGTAGTGACAAGTGT</p></td> | <td width="397" valign="top"><p align="left">CTGGGTATCTCGCAAAGCATTGAACACCATAACCGAAAGTAGTGACAAGTGT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC209</p></td> |
<td width="397" valign="top"><p align="left">ATGCTTTGCGAGATACCCAGATCACATGAAACAGCATGACTTTTTCAAGAGTGC</p></td> | <td width="397" valign="top"><p align="left">ATGCTTTGCGAGATACCCAGATCACATGAAACAGCATGACTTTTTCAAGAGTGC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC210</p></td> |
<td width="397" valign="top"><p align="left">TAGTTCTTTCCTGTACATAACCTTCAGGCATGGCACTCTTGAAAAAGTCATGCT</p></td> | <td width="397" valign="top"><p align="left">TAGTTCTTTCCTGTACATAACCTTCAGGCATGGCACTCTTGAAAAAGTCATGCT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">54</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC211</p></td> |
<td width="397" valign="top"><p align="left">GGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGA</p></td> | <td width="397" valign="top"><p align="left">GGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC212</p></td> |
<td width="397" valign="top"><p align="left">GGTATCACCTTCAAACTTGACTTCAGCACGTGTCTTGTAGTTCCCGTCATCT</p></td> | <td width="397" valign="top"><p align="left">GGTATCACCTTCAAACTTGACTTCAGCACGTGTCTTGTAGTTCCCGTCATCT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">52</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC213</p></td> |
<td width="397" valign="top"><p align="left">GTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTT</p></td> | <td width="397" valign="top"><p align="left">GTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC214</p></td> |
<td width="397" valign="top"><p align="left">GTGTCCAAGAATGTTTCCATCTTCTTTAAAATCAATACCTTTTAACTCGATTC</p></td> | <td width="397" valign="top"><p align="left">GTGTCCAAGAATGTTTCCATCTTCTTTAAAATCAATACCTTTTAACTCGATTC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC215</p></td> |
<td width="397" valign="top"><p align="left">AGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATA</p></td> | <td width="397" valign="top"><p align="left">AGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC216</p></td> |
<td width="397" valign="top"><p align="left">CCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTA</p></td> | <td width="397" valign="top"><p align="left">CCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC217</p></td> |
<td width="397" valign="top"><p align="left">TGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTG</p></td> | <td width="397" valign="top"><p align="left">TGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">57</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC218</p></td> |
<td width="397" valign="top"><p align="left">TCTGCTAGTTGAACGCTTCCATCTTCAATGTTGTGTCTAATTTTGAAGTTA</p></td> | <td width="397" valign="top"><p align="left">TCTGCTAGTTGAACGCTTCCATCTTCAATGTTGTGTCTAATTTTGAAGTTA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC219</p></td> |
<td width="397" valign="top"><p align="left">GGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGG</p></td> | <td width="397" valign="top"><p align="left">GGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC220</p></td> |
<td width="397" valign="top"><p align="left">CAGGTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATTGGAGTATTTT</p></td> | <td width="397" valign="top"><p align="left">CAGGTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATTGGAGTATTTT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">53</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC221</p></td> |
<td width="397" valign="top"><p align="left">TTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCC</p></td> | <td width="397" valign="top"><p align="left">TTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCC</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC222</p></td> |
<td width="397" valign="top"><p align="left">AAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGA</p></td> | <td width="397" valign="top"><p align="left">AAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGA</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC223</p></td> |
<td width="397" valign="top"><p align="left">GAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATG</p></td> | <td width="397" valign="top"><p align="left">GAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATG</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC224</p></td> |
<td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCT</p></td> | <td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCT</p></td> | ||
- | <td width="52 | + | <td width="52" valign="top"><p align="center">51</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC1 </p></td> |
<td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATG</p></td> | <td width="397" valign="top"><p align="left">GCCCTAGGCTATAAAAATAAATGATG</p></td> | ||
- | <td width="52 | + | <td width="52"><p align="center">26</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC2 </p></td> |
<td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAA</p></td> | <td width="397" valign="top"><p align="left">ATAGGCCCAGGATGGTCAA</p></td> | ||
- | <td width="52 | + | <td width="52"><p align="center">19</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC3 </p></td> |
<td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATG</p></td> | <td width="397" valign="top"><p align="left">ATCCTGGGCCTATCTGAAATG</p></td> | ||
- | <td width="52 | + | <td width="52"><p align="center">21</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="50 | + | <td width="50" valign="top"><p align="left">AC4 </p></td> |
<td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCC</p></td> | <td width="397" valign="top"><p align="left">CGGAATTCTTATTTGTATAGTTCATCC</p></td> | ||
- | <td width="52 | + | <td width="52"><p align="center">27</p></td> |
- | <td width="62 | + | <td width="62"><p align="center">1</p></td> |
- | <td width="48 | + | <td width="48"><p align="center">1</p></td> |
- | <td width="56 | + | <td width="56"><p align="center">PAGE</p></td> |
</tr> | </tr> | ||
</table> | </table> | ||
- | + | ||
- | < | + | |
- | <h3> | + | |
- | <p> | + | |
- | <h3> | + | |
- | <p> | + | |
- | + | ||
- | + | ||
+ | |||
+ | |||
+ | <h3 id="coop">The experimental procedure and analysis</h3> | ||
+ | <h3 id="coop">1、Dissolving of primers</h3> | ||
+ | <p id="coop">Sterile deionized water whose volume is determined by primer’s molecular weight is used to dilute the solution of the primer to 10um/L. And it is prepared for the following experiment.</p> | ||
+ | <h3 id="coop">2、Mixing of primers</h3> | ||
+ | <p id="coop">Oligonucleotides synthesized in powder form need to be centrifuged for 1 min at 10000rpm to assemble powders to the bottom of the EP tube.And be careful to open the cap.<br /> | ||
+ | Make sure that the synthesis report is consistent to the OD number on the primer label,and check the number of the dispensing tube before the dissolution of oligonucleotides.The volume of water added to make 10umol/L oligonucleotides’ solution is calculated according to the synthetic single report of each primer. Add sterile deionized water and keep it at room temperature for 2min.And reverse the tube to accelerate the progress of solubilization. Finally, collect substances at the bottom of the tube after centrifugation.<br /> | ||
+ | Every six primers are combined to one group.Add 4ulbeginning fiprimer, 1ulintermediate primer and 4ul end primerto a new EP tube, then add sterile deionized water to 20ul, mix them up as spare.</p> | ||
<div align="center"> | <div align="center"> | ||
- | <table border="1" cellspacing="0" cellpadding="0" width="612"> | + | <table align="center" border="1" cellspacing="0" cellpadding="0" width="612"> |
<tr> | <tr> | ||
- | <td width="67">< | + | <td width="67"><p align="center"><strong>组别</strong><strong> </strong></p></td> |
- | + | <td width="103"><p align="center"><strong>引物编号</strong><strong> </strong></p></td> | |
- | <td width="103 | + | <td width="65"><p align="center"><strong>吸取量</strong><strong> </strong></p></td> |
- | <td width="65 | + | <td width="85"><p align="center"><strong>灭菌去离子水添加量</strong><strong> </strong></p></td> |
- | <td width="85 | + | <td width="75"><p align="center"><strong>总体积</strong><strong> </strong></p></td> |
- | <td width="75 | + | |
<td width="108" valign="top"><p align="center"><strong>每</strong><strong>PCR</strong><strong>(</strong><strong>50ul</strong><strong>体系)吸取量</strong><strong> </strong></p></td> | <td width="108" valign="top"><p align="center"><strong>每</strong><strong>PCR</strong><strong>(</strong><strong>50ul</strong><strong>体系)吸取量</strong><strong> </strong></p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center"><strong>终浓度</strong><strong> </strong></p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td width="67" rowspan="6"><p align="center">A1</p></td> | <td width="67" rowspan="6"><p align="center">A1</p></td> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC101</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="85 | + | <td width="85" rowspan="6"><p align="center">8</p></td> |
- | <td width="75 | + | <td width="75" rowspan="6"><p align="center">20</p></td> |
<td width="108" rowspan="6"><p align="center">5ul</p></td> | <td width="108" rowspan="6"><p align="center">5ul</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC102</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC103</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC104</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC105</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC106</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td width="67" rowspan="6"><p align="center">A2</p></td> | <td width="67" rowspan="6"><p align="center">A2</p></td> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC107</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="85 | + | <td width="85" rowspan="6"><p align="center">8</p></td> |
- | <td width="75 | + | <td width="75" rowspan="6"><p align="center">20</p></td> |
<td width="108" rowspan="6"><p align="center">5ul </p></td> | <td width="108" rowspan="6"><p align="center">5ul </p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC108</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC109</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC110</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC111</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC112</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td width="67" rowspan="6"><p align="center">A3</p></td> | <td width="67" rowspan="6"><p align="center">A3</p></td> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC113</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="85 | + | <td width="85" rowspan="6"><p align="center">8</p></td> |
- | <td width="75 | + | <td width="75" rowspan="6"><p align="center">20</p></td> |
<td width="108" rowspan="6"><p align="center">5ul </p></td> | <td width="108" rowspan="6"><p align="center">5ul </p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC114</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC115</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC116</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC117</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC118</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td width="67" rowspan="6"><p align="center">A4</p></td> | <td width="67" rowspan="6"><p align="center">A4</p></td> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC119</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="85 | + | <td width="85" rowspan="6"><p align="center">8</p></td> |
- | <td width="75 | + | <td width="75" rowspan="6"><p align="center">20</p></td> |
<td width="108" rowspan="6"><p align="center">5ul </p></td> | <td width="108" rowspan="6"><p align="center">5ul </p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC120</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC121</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC122</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC123</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC124</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td width="67" rowspan="6"><p align="center">A5</p></td> | <td width="67" rowspan="6"><p align="center">A5</p></td> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC201</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="85 | + | <td width="85" rowspan="6"><p align="center">8</p></td> |
- | <td width="75 | + | <td width="75" rowspan="6"><p align="center">20</p></td> |
<td width="108" rowspan="6"><p align="center">5ul </p></td> | <td width="108" rowspan="6"><p align="center">5ul </p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC202</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC203</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC204</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC205</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC206</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td width="67" rowspan="6"><p align="center">A6</p></td> | <td width="67" rowspan="6"><p align="center">A6</p></td> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC207</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="85 | + | <td width="85" rowspan="6"><p align="center">8</p></td> |
- | <td width="75 | + | <td width="75" rowspan="6"><p align="center">20</p></td> |
<td width="108" rowspan="6"><p align="center">5ul </p></td> | <td width="108" rowspan="6"><p align="center">5ul </p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC208</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC209</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC210</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC211</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC212</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td width="67" rowspan="6"><p align="center">A7</p></td> | <td width="67" rowspan="6"><p align="center">A7</p></td> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC213</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="85 | + | <td width="85" rowspan="6"><p align="center">8</p></td> |
- | <td width="75 | + | <td width="75" rowspan="6"><p align="center">20</p></td> |
<td width="108" rowspan="6"><p align="center">5ul </p></td> | <td width="108" rowspan="6"><p align="center">5ul </p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC214</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC215</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC216</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC217</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC218</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td width="67" rowspan="6"><p align="center">A8</p></td> | <td width="67" rowspan="6"><p align="center">A8</p></td> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC219</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="85 | + | <td width="85" rowspan="6"><p align="center">8</p></td> |
- | <td width="75 | + | <td width="75" rowspan="6"><p align="center">20</p></td> |
<td width="108" rowspan="6"><p align="center">5ul </p></td> | <td width="108" rowspan="6"><p align="center">5ul </p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC220</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC221</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM </p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC222</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC223</p></td> |
<td width="65"><p align="center">1</p></td> | <td width="65"><p align="center">1</p></td> | ||
- | <td width="108 | + | <td width="108" valign="top"><p align="center">50nM</p></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td width="103 | + | <td width="103" valign="top"><p align="center">AC224</p></td> |
<td width="65"><p align="center">4</p></td> | <td width="65"><p align="center">4</p></td> | ||
- | <td width="108 | + | <td width="108"><p align="center">200nM</p></td> |
</tr> | </tr> | ||
</table> | </table> | ||
</div> | </div> | ||
- | <h3> | + | |
- | <p> | + | |
+ | |||
+ | <h3 id="coop">DA-PCR</h3> | ||
+ | <p id="coop">Every six primers which are single-stranded oligonucleotidesare chemically synthesized were combined to one group. Then they were going to be made as longer double-stranded fragments of intermediate (Block) by DA-PCR.<br /> | ||
+ | Procedure of DA-PCR: <br /> | ||
Mixed primer solutions 5μl<br /> | Mixed primer solutions 5μl<br /> | ||
- | Pfu DNA Polymerase 2.5U | + | Pfu DNA Polymerase 2.5U 0.5μl <br /> |
- | dNTP | + | dNTP 4μl<br /> |
10×Pfu buffer(Mg2+) 5μl<br /> | 10×Pfu buffer(Mg2+) 5μl<br /> | ||
- | + | ddH20add to 50μl<br /> | |
- | DA- | + | Procedure of DA-PCR: <br /> |
94℃ 2min<br /> | 94℃ 2min<br /> | ||
94℃ 30S<br /> | 94℃ 30S<br /> | ||
- | 50℃ 30S | + | 50℃ 30S 25 cycles<br /> |
72℃ 1min<br /> | 72℃ 1min<br /> | ||
- | 72℃ 10min<br /> | + | 72℃ 10min<br /> |
- | + | 4℃preservation<br /> | |
End<br /> | End<br /> | ||
- | DA- | + | DA-PCR splicing reaction product was detected in 2% agarose gel electrophoresis,<br /> |
- | DA- | + | DA-PCR product 5μl <br /> |
- | 10×Loading Buffer 0.6μl | + | 10×Loading Buffer 0.6μl spotting after mixed<br /> |
- | 100bp Marker | + | 100bp Marker 5μl spotting directly<br /> |
- | + | 75V electrophoress for 1h。 </p> | |
- | </p> | + | <h3 id="coop">4、OE-PCR </h3> |
- | <h3>4、OE-PCR</h3> | + | <p id="coop"> Take the 5 double strand intermediate fragment (Block) spliced by DA-PCR as templates, blocks were further connected by OR-PCR, OE-PCR in a reaction system consisting of:<br /> |
- | <p> | + | |
Block1 1μl<br /> | Block1 1μl<br /> | ||
Block2 1μl<br /> | Block2 1μl<br /> | ||
Line 850: | Line 1,033: | ||
Block7 1μl<br /> | Block7 1μl<br /> | ||
Block8 1μl <br /> | Block8 1μl <br /> | ||
- | + | AC1 1μl<br /> | |
- | + | AC4 1μl<br /> | |
<em>Pfu</em> DNA Polymerase 2.5U 0.5μl <br /> | <em>Pfu</em> DNA Polymerase 2.5U 0.5μl <br /> | ||
dNTP 4μl<br /> | dNTP 4μl<br /> | ||
- | 10×<em>Pfu</em> buffer(Mg2+ | + | 10×<em>Pfu</em> buffer(Mg2+) 5μl<br /> |
- | + | Sterilized ultrapure water to 50ul<br /> | |
- | OE- | + | Procedure of OE-PCR: <br /> |
94℃ 2min<br /> | 94℃ 2min<br /> | ||
- | + | 94℃ 30S<br /> | |
- | 50℃ | + | 50℃ 30S 20 cycles<br /> |
72℃ 2min<br /> | 72℃ 2min<br /> | ||
72℃ 10min<br /> | 72℃ 10min<br /> | ||
- | + | 4℃ preservation<br /> | |
End<br /> | End<br /> | ||
- | OE- | + | The full-length gene spliced by OE-PCR was detected by a 1% agarose gel electrophoresis, specific programs are as follows<br /> |
- | + | OE-PCR product 5μl <br /> | |
- | 10×Loading Buffer 0.6μl | + | 10×Loading Buffer 0.6μl spotted after mixing well<br /> |
- | < | + | 100bp Marker 5μl spotted directly<br /> |
- | + | 80V electrophoresis for 1h。 </p> | |
- | < | + | <h3 id="coop">5、Constructing and sequencing of subcloning vector </h3> |
- | < | + | <p id="coop">We design a primer AC-B with Blp I site and a primer AC-S with SgrA I site. Then we use RFP-promoter-GFP as template in PCR. Then we use Blp I and SgrA I enzyme to digest the target fragment and pET32a vector(37℃,3h) and link it overnight(16℃). After this step, transform the linked vector to competent cell(E.coli BL21) and select the desirable colony by using “Blue-White Selection” method.<br /> |
- | + | <strong>Constitute of </strong><em>Blp</em>Ⅰand <em>Sgr</em>AⅠdouble enzyme digestion reaction system:<strong> </strong><br /> | |
- | + | Gene or plasmid 10μl<br /> | |
- | < | + | <em>Blp</em>Ⅰ 0.3μl<br /> |
- | < | + | <em>Sgr</em>AⅠ0.3μl<br /> |
- | + | 10×NEBuffer 2.12μl<br /> | |
- | + | Sterilizing ultrapure watertop up to20μl<br /> | |
- | < | + | <strong>Constitute of linking reaction system</strong><strong>:</strong><strong> </strong><br /> |
+ | RFP-promoter-GFP 10μl<br /> | ||
+ | pET32a 3μl<br /> | ||
+ | T4 ligase 0.5μl<br /> | ||
+ | 10×T4 ligase Buffer 2μl<br /> | ||
+ | Sterilizing ultrapure water top up to 20μl <br /> | ||
+ | Preparation process of competent cell <strong><em>E.coli</em>BL21</strong><strong>:</strong><strong> </strong><br /> | ||
+ | (1) Culturing strain <em>E.coli</em>BL21(37℃)overnight to recovery culture, Adding overnight bacteria culture fluid 600uLto 30 mL LB culture medium, and 37℃,200 r/min shake culturing 1-2 h, until OD600 is around 0.3-0.4.<br /> | ||
+ | (2) In the aseptic condition, transfer 30mLbacteria fluid to the centrifugal tube in the ice 10 min to cooling the culture to 0℃.<br /> | ||
+ | (3) Centrifuging 10 min in precooling centrifugal machine over 4000r/min, throw supernate, and then add30mLprecooling 0.1mol/L CaCl2 solution to resuspension precipitation in the ice 10 min.<br /> | ||
+ | (4) Centrifuging 4000r/min in 4℃10min, throw supernate, each 30mL initial culture resuspension cell precipitation with 1.0mL precooling 0.1mol/LCaCl2 solution, and then 200μL each one.<br /> | ||
+ | <strong>Heal shock transformation process</strong><strong>:</strong><strong> </strong><br /> | ||
+ | (1) Thawing freshly prepared or -80℃ competentcellBL21suspension.<br /> | ||
+ | (2) Add constructed recombinant cloning vector plasmidspSB1C3-A(no more than 50ng, 10μl), shake gently, and then in the ice 30min.<br /> | ||
+ | (3) Put EP tube in 42℃ water bath90s,and then transfer it to ice water bath to cool cells1-2 min.<br /> | ||
+ | (4) add 800μL LB medium to EP tube,transfer it to 37℃ table,150r/min,to recovery strain 45 min.<br /> | ||
+ | Spread plate and Culture<br /> | ||
+ | (1)After culture in 37℃, centrifuge the cell solution(5000rpm,5min) and concentrate it to 200μl. Then coat it to LB culture with chloramphenicol and set a positive control.<br /> | ||
+ | (2) Wait until the solution in culture is full absorbed by cell, then invert the plate and culture it in 37℃ overnight.<br /> | ||
+ | Sequence test<br /> | ||
+ | On the pET32a vector(as shown in Fig 1), use the RFP-promoter-GFP gene (1535bp) to replace the fragment between <em>Blp</em>Ⅰ site and <em>Sgr</em>A I site (753bp) and then we get the reconstructed plasmid, pET-mlr promoter.</p> | ||
- | + | <center><img src="https://static.igem.org/mediawiki/2014/9/93/Simonsong-notebook-10.png" align="center"/></center> | |
- | + | <p align="center">Fig 3 Map of pET-mlr promoter <br>Select the white colony on culture and culture it. Then we extract the plasmid and use it as template in PCR to identify the colony. In theory, the reconstructed vector with RFP-promoter-GFP fragment is 1728bp and the empty vector without mlrA fragment is 946bp. So, the result shows that the white colony we select has reconstructed vector with mlrA fragment in it.</p> | |
- | + | <center><img src="https://static.igem.org/mediawiki/2014/2/28/Simonsong-notebook-4.png" /></center> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
+ | <p align="center">Figure 3 PCR identification of recombinant vector pET-mlr promoter<br></p> | ||
+ | <p id="coop"> Illustration of the outcome: <br> | ||
+ | 1、L1, L2 could be amplified to 1700bp products, the recombinant vector contained a foreign gene RFP-promoter-GFP according to the result of the identification.<br> | ||
+ | 2、M was 1000bp Ladder Marker<br> | ||
+ | The positive clones which were proved to contain the recombinant vectors pET-mlr promoter by PCR identification. were sent to 吉林库美生物科技限公司to be sequenced. The results showed (Figure 4), RFP-promoter-GFP sequence is consistent with the design sequence.</p> | ||
+ | <div style="text-align:center"><img src="https://static.igem.org/mediawiki/2014/d/d8/Simonsong-notebook-5.png" /> | ||
+ | <img src="https://static.igem.org/mediawiki/2014/5/5a/Simonsong-notebook-6.png" /> | ||
+ | <img src="https://static.igem.org/mediawiki/2014/5/53/Simonsong-notebook-7.png" /></div> | ||
+ | <center><p>Figure 4 Sequencing results with the design sequence alignment</p></center> | ||
+ | <h3 id="coop">The relationship detection between MLR promoter and microcystin LR </h3> | ||
+ | <p id="coop">Single colony containingthe recombinant vector pET-mlr promoterwas picked ,vigorously shaken culture for 4-5h in LB liquid medium at 37 ℃,the culturing stopped until OD600 reached 0.3 - 0.4, 10-fold dilution to 10-5-10-7with sterilized water, taking 100ul to coat on the LB plate containing 10ug / L microcystin LR, 37 ℃ for overnight. <br> | ||
+ | Single cultured colony was placed in the UV lamp darkroom, we observed colony color and found that it luminesced green light, indicating that when there is microcystin LR, mlr promoter can promote the expression of GFP, which makes the single colony of E.coli BL21 luminescing green fluorescence in the UV lamp.</p> | ||
+ | <div style="text-align:center"><img src="https://static.igem.org/mediawiki/2014/5/50/Simonsong-notebook-8.png" /></div> | ||
+ | <div> | ||
+ | <a height="20px" width="5%" align="center" onMouseOver="this.bgColor='#FFFFFF'" onMouseOut="this.bgColor='#A1DBB2'" href="#menu" style="text-decoration:none;color:#1C140D;float:right;background:#A1DBB2;"> Top </a> | ||
+ | </div> | ||
- | + | </table> | |
- | + | </div> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</body> | </body> | ||
</html> | </html> |
Latest revision as of 03:35, 18 October 2014
Welcome!
|
The experimental procedure and analysis1、Dissolving of primersSterile deionized water whose volume is determined by primer’s molecular weight is used to dilute the solution of the primer to 10um/L. And it is prepared for the following experiment. 2、Mixing of primersOligonucleotides synthesized in powder form need to be centrifuged for 1 min at 10000rpm to assemble powders to the bottom of the EP tube.And be careful to open the cap.
DA-PCREvery six primers which are single-stranded oligonucleotidesare chemically synthesized were combined to one group. Then they were going to be made as longer double-stranded fragments of intermediate (Block) by DA-PCR. 4、OE-PCR Take the 5 double strand intermediate fragment (Block) spliced by DA-PCR as templates, blocks were further connected by OR-PCR, OE-PCR in a reaction system consisting of: 5、Constructing and sequencing of subcloning vectorWe design a primer AC-B with Blp I site and a primer AC-S with SgrA I site. Then we use RFP-promoter-GFP as template in PCR. Then we use Blp I and SgrA I enzyme to digest the target fragment and pET32a vector(37℃,3h) and link it overnight(16℃). After this step, transform the linked vector to competent cell(E.coli BL21) and select the desirable colony by using “Blue-White Selection” method. Fig 3 Map of pET-mlr promoter Figure 3 PCR identification of recombinant vector pET-mlr promoter Illustration of the outcome: Figure 4 Sequencing results with the design sequence alignment The relationship detection between MLR promoter and microcystin LRSingle colony containingthe recombinant vector pET-mlr promoterwas picked ,vigorously shaken culture for 4-5h in LB liquid medium at 37 ℃,the culturing stopped until OD600 reached 0.3 - 0.4, 10-fold dilution to 10-5-10-7with sterilized water, taking 100ul to coat on the LB plate containing 10ug / L microcystin LR, 37 ℃ for overnight. |