|
|
(2 intermediate revisions not shown) |
Line 23: |
Line 23: |
| We co-transformed pRSFDuet-1 and two plasmids, pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion, respectively. So the plate has two antibiotic resistance, Kan and Amp. We cultured two different strains on the plate and got the result picture.</p> | | We co-transformed pRSFDuet-1 and two plasmids, pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion, respectively. So the plate has two antibiotic resistance, Kan and Amp. We cultured two different strains on the plate and got the result picture.</p> |
| | | |
- | <center><img src="https://static.igem.org/mediawiki/2014/5/5f/123123123.jpg" width=55%></img></center> | + | <center><img src="https://static.igem.org/mediawiki/2014/5/5f/123123123.jpg" width=55% style='max-width=600px'></img></center> |
| | | |
| <center><small><strong>Figure 2.1.1 Two plates of Co-transfected bacteria (pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion)</small></strong></center> | | <center><small><strong>Figure 2.1.1 Two plates of Co-transfected bacteria (pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion)</small></strong></center> |
Line 29: |
Line 29: |
| <p>Moreover, we verified our pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy part through lacl & blue-white spot screening.</p> | | <p>Moreover, we verified our pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy part through lacl & blue-white spot screening.</p> |
| | | |
- | <center><img src="https://static.igem.org/mediawiki/2014/c/c6/212121.jpg" width=600px></img></center> | + | <center><img src="https://static.igem.org/mediawiki/2014/c/c6/212121.jpg" width=55% style='max-width=600px'></img></center> |
| | | |
| <center><small><strong>Figure 2.1.2 Two plates of lacl & blue-white spot screening</strong></small></center> | | <center><small><strong>Figure 2.1.2 Two plates of lacl & blue-white spot screening</strong></small></center> |
Line 38: |
Line 38: |
| <p>The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000. | | <p>The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000. |
| In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.</p> | | In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.</p> |
- | <center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width=600px></img></center> | + | <center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width=55% style='max-width=600px'></img></center> |
| <center><small><strong>Figure 2.1.3 The structure of TAL USB</strong></small></center> | | <center><small><strong>Figure 2.1.3 The structure of TAL USB</strong></small></center> |
| <p> | | <p> |
Line 76: |
Line 76: |
| CACCACCACCACCACCACTAACTCGAGCGG | | CACCACCACCACCACCACTAACTCGAGCGG |
| </center></pre> | | </center></pre> |
| + | <br> |
| + | <br><br><br> |
| | | |
- | <p>Furthermore, we found some mismatch cases in our sequencing result. Here are a typical mismatch result.</p> | + | <p><big><b>Furthermore</b></big>, we found some mismatch cases in our sequencing result. Here are a typical mismatch result.</p> |
| <p>There is the partial sequencing result.</p> | | <p>There is the partial sequencing result.</p> |
- | <center><img src="https://static.igem.org/mediawiki/2014/f/f5/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%881.26.07.png" width=700px></img><center> | + | <center><img src="https://static.igem.org/mediawiki/2014/f/f5/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%881.26.07.png" width=62% style='max-width=700px'></img><center> |
| | | |
| <center><strong><small>Figure 2.1.4 Partial sequencing result of mismatch</strong></small></center> | | <center><strong><small>Figure 2.1.4 Partial sequencing result of mismatch</strong></small></center> |
Line 85: |
Line 87: |
| <p>We tried to understand why we got this wrong sequence. We checked our part and 2012 Freiburg's project. And we found that the the mismatch sticky ends appearing in original sequence are <b>GCTC</b> and <b>ACTC</b>. What similar sticky ends! Here are the two components in the mismatch sequence. </p> | | <p>We tried to understand why we got this wrong sequence. We checked our part and 2012 Freiburg's project. And we found that the the mismatch sticky ends appearing in original sequence are <b>GCTC</b> and <b>ACTC</b>. What similar sticky ends! Here are the two components in the mismatch sequence. </p> |
| | | |
- | <center><img src="https://static.igem.org/mediawiki/2014/d/dd/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%882.40.42.png" width=800px></img></center> | + | <center><img src="https://static.igem.org/mediawiki/2014/d/dd/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%882.40.42.png" width=72% style='max-width=800px'></img></center> |
| | | |
| <center><strong><small>Figure 2.1.5 The process of generating mismatch</small></strong></center> | | <center><strong><small>Figure 2.1.5 The process of generating mismatch</small></strong></center> |
Line 95: |
Line 97: |
| <p><center>TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC</center></p> | | <p><center>TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC</center></p> |
| <p>Inpired by BLAST algorithm, we calculated the similarity of each other sticky ends. </p> | | <p>Inpired by BLAST algorithm, we calculated the similarity of each other sticky ends. </p> |
- | <center><img src="https://static.igem.org/mediawiki/2014/8/8e/TAL%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF%E8%A1%A8%E6%A0%BC.png" width=400px></img></center> | + | <center><img src="https://static.igem.org/mediawiki/2014/8/8e/TAL%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF%E8%A1%A8%E6%A0%BC.png" width=37% style='max-width=400px'></img></center> |
| <center><strong><small>Figure 2.1.6 Strict rules score table</small></strong></center> | | <center><strong><small>Figure 2.1.6 Strict rules score table</small></strong></center> |
| <p id="dianweidian5">The higher score, the higher similarity, and the higher possibility of mismatch. | | <p id="dianweidian5">The higher score, the higher similarity, and the higher possibility of mismatch. |
Line 101: |
Line 103: |
| | | |
| Even if we employed the relatively loose rule to calculate the similarity, we still found that error rates cannot be neglected.</p> | | Even if we employed the relatively loose rule to calculate the similarity, we still found that error rates cannot be neglected.</p> |
- | <center><img src="https://static.igem.org/mediawiki/2014/9/9b/Tal_%E8%A1%A8%E6%A0%BC%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF2.png" width=400px></img></center> | + | <center><img src="https://static.igem.org/mediawiki/2014/9/9b/Tal_%E8%A1%A8%E6%A0%BC%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF2.png" width=37% style='max-width=400px'></img></center> |
| | | |
| <center><strong><small>Figure 2.1.7 Loose rules score table</small></strong></center> | | <center><strong><small>Figure 2.1.7 Loose rules score table</small></strong></center> |
Wet Lab Results
Reformed Plasmid Result
We designed four reformed plasmids, pBluescript II KS(+) ScaI deletion, pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy.
And we tested their co-transformation ability and got the result picture. All of these plasmids have Amp antibiotic resistance.
We co-transformed pRSFDuet-1 and two plasmids, pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion, respectively. So the plate has two antibiotic resistance, Kan and Amp. We cultured two different strains on the plate and got the result picture.
Figure 2.1.1 Two plates of Co-transfected bacteria (pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion)
Moreover, we verified our pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy part through lacl & blue-white spot screening.
Figure 2.1.2 Two plates of lacl & blue-white spot screening
So we have experimentally validated that our reformed plasmids perform as expected.
Function Identification of TAL USB
The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000.
In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.
Figure 2.1.3 The structure of TAL USB
When digested with BsmBI, this part produces two sticky-ends that can bind TAL-Protein (BBa_K747000 to BBa_K747095)
After doing ligation with T4 ligase, we experimentally validated this part's function.
Sequencing result is followed:
GGAATTCCATATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCGATGGCTTCC
TCCGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGTTCCGTTAACGGTCACGAGTTCGAAA
TCGAAGGTGAAGGTGAAGGTCGTCCGTACGAAGGTACCCAGACCGCTAAACTGAAAGTTACCAAAGGTGGTCCGCT
GCCGTTCGCTTGGGACATCCTGTCCCCGCAGTTCCAGTACGGTTCCAAAGCTTACGTTAAACACCCGGCTGACATC
CCGGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGTGTTATGAACTTCGAAGACGGTGGTGTTG
TTACCGTTACCCAGGACTCCTCCCTGCAAGACGGTGAGTTCATCTACAAAGTTAAACTGCGTGGTACCAACTTCCC
GTCCGACGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCTTCCACCGAACGTATGTACCCGGAAGACGGT
GCTCTGAAAGGTGAAATCAAAATGCGTCTGAAACTGAAAGACGGTGGTCACTACGACGCTGAAGTTAAAACCACCT
ACATGGCTAAAAAACCGGTTCAGCTGCCGGGTGCTTACAAAACCGACATCAAACTGGACATCACCTCCCACAACGA
AGACTACACCATCGTTGAACAGTACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTGCTGAGGCCGCCGCAAAA
GAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGACCAGTAGCTATCTGCATTTTCCGGAGTTTGATCCGGTCATTT
TCTCAATAGGACCCGTGGCGCTTCACTGGTACGGCCTGATGTATCTGGTGGGTTTCATTTTTGCAATGTGGCTGGC
AACACGACGGGCGAATCGTCCGGGCAGCGGCTGGACCAAAAATGAAGTTGAAAACTTACTCTATGCGGGCTTCCTC
GGCGTCTTCCTCGGGGGACGTATTGGTTATGTTCTGTTCTACAATTTCCCGCAGTTTATGGCCGATCCGCTGTATC
TGTTCCGTGTCTGGGACGGCGGCATGTCTTTCCACGGCGGCCTGATTGGCGTTATCGTGGTGATGATTATCTTCGC
CCGCCGTACTAAACGTTCCTTCTTCCAGGTCTCTGATTTTATCGCACCACTCATTCCGTTTGGTCTTGGTGCCGGG
CGTCTGGGCAACTTTATTAACGGTGAATTGTGGGGCCGCGTTGACCCGAACTTCCCGTTTGCCATGCTGTTCCCTG
GCTCCCGTACAGAAGATATTTTGCTGCTGCAAACCAACCCGCAGTGGCAATCCATTTTCGACACTTACGGTGTGCT
GCCGCGCCACCCATCACAGCTTTACGAGCTGCTGCTGGAAGGTGTGGTGCTGTTTATTATCCTCAACCTGTATATT
CGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCTGATTGGTTACGGCGCGTTTCGCATCATTGTTGAGT
TTTTCCGCCAGCCCGACGCGCAGTTTACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCC
GATGATTGTCGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTTAGGAGGT
GGAGGTAGTGGTGGAGGTGGAAGTGGTGGAGGTGGTAGTGCTGCAGCTCTGGACACGGGCCAGTTGCTGAAGATCG
CGAAGCGGGGAGGAGTCACGGCGGTCGAGGCGGTGCACGCGTGGCGCAATGCGCTCACGGGAGCACCCCTCAACCT
GACCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTT
CCGGTTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCACGATGGCGGTAAACAAG
CCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAGGCCCACGGGCTCACGCCTGAGCAGGTAGTGGCTAT
TGCATCCAACGGAGGGGGCAGACCCGCACTGGAGTCAATCGTGGCCCAGCTTTCGAGGCCGGACCCCGCGCTGGCC
CACCACCACCACCACCACTAACTCGAGCGG
Furthermore, we found some mismatch cases in our sequencing result. Here are a typical mismatch result.
There is the partial sequencing result.
Figure 2.1.4 Partial sequencing result of mismatch
We tried to understand why we got this wrong sequence. We checked our part and 2012 Freiburg's project. And we found that the the mismatch sticky ends appearing in original sequence are GCTC and ACTC. What similar sticky ends! Here are the two components in the mismatch sequence.
Figure 2.1.5 The process of generating mismatch
So the sequencing result proves that similar sticky ends can mismatch when T4 ligase exists. This result enlightens us on improving TALE construction parts.
2012 Freiburg's parts have seven sticky ends:
TGAC,GCTC,CTTG,GCTT,ACTG,CCTG,ACTC
Inpired by BLAST algorithm, we calculated the similarity of each other sticky ends.
Figure 2.1.6 Strict rules score table
The higher score, the higher similarity, and the higher possibility of mismatch.
The table shows that more than 30% of pairs’ score is equal to 3, which means that the possibility of mismatch cannot be neglected.
Even if we employed the relatively loose rule to calculate the similarity, we still found that error rates cannot be neglected.
Figure 2.1.7 Loose rules score table
So how to solve this problem?
Our team designed seven new sticky ends which are theoretically better than original version. For more information please go to TAL Improvement page!