|
|
| (44 intermediate revisions not shown) |
| Line 3: |
Line 3: |
| | {{Template:Team:SJTU-BioX-Shanghai/article}} | | {{Template:Team:SJTU-BioX-Shanghai/article}} |
| | {{Template:Team:SJTU-BioX-Shanghai/clear}} | | {{Template:Team:SJTU-BioX-Shanghai/clear}} |
| | + | {{Template:Team:SJTU-BioX-Shanghai/preview}} |
| | <html> | | <html> |
| | <style type="text/css"> | | <style type="text/css"> |
| | .header_logo{ background-image:url("/wiki/images/8/84/SJTU14_Results.png");} | | .header_logo{ background-image:url("/wiki/images/8/84/SJTU14_Results.png");} |
| | + | .projtile { |
| | + | margin-right:1.167%; |
| | + | margin-left:1.167%; |
| | + | width:31%;} |
| | </style> | | </style> |
| | <div class="content"> | | <div class="content"> |
| | + | <article class="post__article"> |
| | + | <h2>Wet Lab Results</h2> |
| | | | |
| | | | |
| - | <article class="post__article">
| + | <h3>Reformed Plasmid Result</h3> |
| - | <div id="overview"> | + | <p>We designed four reformed plasmids, pBluescript II KS(+) ScaI deletion, pBluescript II KS(+) EcoRV deletion, pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy. |
| - | <h2><a href="#Enduring Features">Enduring Features</a></h2><hr />
| + | And we tested their co-transformation ability and got the result picture. All of these plasmids have Amp antibiotic resistance. </p> |
| - | <h2><a href="#New Features">New Features</a></h2><hr />
| + | <p> |
| - | <h2><a href="#The Ten Parts">The Ten Parts</a></h2><hr />
| + | We co-transformed pRSFDuet-1 and two plasmids, pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion, respectively. So the plate has two antibiotic resistance, Kan and Amp. We cultured two different strains on the plate and got the result picture.</p> |
| - | <h2><a href="#Exceptional Value Formats">Exceptional Value Formats</a></h2><hr />
| + | |
| - | <h2><a href="#Media and Supplements for the Ninth Edition">Media and Supplements for the Ninth Edition</a></h2><hr />
| + | <center><img src="https://static.igem.org/mediawiki/2014/5/5f/123123123.jpg" width=55% style='max-width=600px'></img></center> |
| - | <h2><a href="#Many People to Thank">Many People to Thank</a></h2><hr/>
| + | |
| - | </div>
| + | <center><small><strong>Figure 2.1.1 Two plates of Co-transfected bacteria (pBluescript II KS(+) ScaI deletion & pBluescript II KS(+) EcoRV deletion)</small></strong></center> |
| - | <p> Biology is a dynamic, exciting, and important subject. It is dynamic because it is constantly changing, with new discoveries about the living world being made every day. (Although it is impossible to pinpoint an exact number, approximately 1 million new research articles in biology are published each year.) The subject is exciting because life in all of its forms has always fascinated people. As active scientists who have spent our careers teaching and doing research in a wide variety of fields, we know this first hand.< br> | + | |
| - | Biology has always been important in peoples’ daily lives, if only through the effects of achievements in medicine and agriculture. Today more than ever the science of biology is at the forefront of human concerns as we face challenges raised both by recent advances in genome science and by the rapidly changing environment.<br>
| + | <p>Moreover, we verified our pBluescript II KS(+)_3_copy, pBluescript II KS(+)_5_copy part through lacl & blue-white spot screening.</p> |
| - | Life’s new edition brings a fresh approach to the study of biology while retaining the features that have made the book successful in the past. A new coauthor, the distinguished entomologist May R. Berenbaum (University of Illinois at Urbana-Champaign) has joined our team, and the role of evolutionary biologist David Hillis (University of Texas at Austin) is greatly expanded in this edition. The authors hail from large, medium-sized, and small institutions. Our multiple perspectives and areas of expertise, as well as input from many col- leagues and students who used previous editions, have in- formed our approach to this new edition.</p>
| + | |
| - | <h2 id="Enduring Features">Enduring Features</h2>
| + | <center><img src="https://static.igem.org/mediawiki/2014/c/c6/212121.jpg" width=55% style='max-width=600px'></img></center> |
| - | <p>We remain committed to blending the presentation of core ideas with an emphasis on introducing students to the process of scientific inquiry. Having pioneered the idea of depicting seminal experiments in specially designed figures, we continue to develop this here, with 79 INVESTIGATING LIFE figures. Each of these figures sets the experiment in perspective and relates it to the accompanying text. As in previous editions, these figures employ a structure: Hypothesis, Method, Results, and Conclusion. They often include questions for further research that ask students to conceive an experiment that would explore a related question. Each Investigating Life figure has a reference to BioPortal (yourBioPortal.com), where citations to the original work as well as additional discussion and references to follow-up re- search can be found.<br>
| + | |
| - | A related feature is the TOOLS FOR INVESTIGATING LIFE figures, which depict laboratory and field methods used in biology. These, too, have been expanded to provide more useful context for their importance.<br>
| + | <center><small><strong>Figure 2.1.2 Two plates of lacl & blue-white spot screening</strong></small></center> |
| - | Over a decade ago—in Life’s Fifth Edition—the authors and publishers pioneered the much-praised use of BALLOON CAP- TIONS in our figures. We recognized then, and it is even truer today, that many students are visual learners. The balloon captions bring explanations of intricate, complex processes directly into the illustration, allowing students to integrate information without repeatedly going back and forth between the figure, its legend, and the text.<br>
| + | |
| - | Life is the only introductory textbook for biology majors to begin each chapter with a story. These OPENING STORIES pro- vide historical, medical, or social context and are intended to intrigue students while helping them see how the chapter’s biological subject relates to the world around them. In the new edition, all of the opening stories (some 70 percent of which are new) are revisited in the body of the chapter to drive home their relevance.<br>
| + | <p>So we have experimentally validated that our reformed plasmids perform as expected. </p> |
| - | We continue to refine our well-received chapter organization. The chapter-opening story ends with a brief IN THIS CHAPTER preview of the major subjects to follow. A CHAPTER OUTLINE asks questions to emphasize scientific inquiry, each of which is answered in a major section of the chapter. A RECAP at the end of each section asks the student to pause and answer questions to review and test their mastery of the previous material. The end-of-chapter summary continues this inquiry framework and highlights key figures, bolded terms, and activities and animated tutorials available in BioPortal.</p>
| + | |
| - | <h2 id="New Features">New Features</h2>
| + | <h3>Function Identification of TAL USB</h3> |
| - | <p>Probably the most important new feature of this edition is new authorship. Like the biological world, the authorship team of Life continues to evolve. While two of us (Craig Heller and David Sadava) continue as coauthors, David Hillis has a greatly expanded role, with full responsibility for the units on evolution and diversity. New coauthor May Berenbaum has rewritten the chapters on ecology. The perspectives of these two ac- claimed experts have invigorated the entire book (as well as their coauthors).<br>
| + | <p>The membrane anchor system (ssDsbA-Lgt) comes from iGEM12_SJTU-BioX-Shanghai BBa_K771000. |
| - | Even with the enduring features (see above), this edition has a different look and feel from its predecessor. A fresh new de- sign is more open and, we hope, more accessible to students. The extensively revised art program has a contemporary style and color palette. The information flow of the figures is easier to follow, with numbered balloons as a guide for students. There are new conceptual figures, including a striking visual timeline for the evolution of life on Earth (Figure 25.12) and a single overview figure that summarizes the information in the genome (Figure 17.4).<br>
| + | In order to connect TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.</p> |
| - | In response to instructors who asked for more real-world data, we have incorporated a feature introduced online in the Eighth Edition, WORKING WITH DATA. There are now 36 of these exercises, most of which relate to an Investigating Life figure. Each is referenced at the end of the relevant chapter and is available online via BioPortal (yourBioPortal.com). In these exercises, we describe in detail the context and approach of there search paper that forms the basis of the figure. We then ask the student to examine the data, to make calculations, and to draw conclusions.<br>
| + | <center><img src="https://static.igem.org/mediawiki/2014/9/9b/Part%EF%BC%9ABBa_K1453000.png" width=55% style='max-width=600px'></img></center> |
| - | We are proud that this edition is a greener Life, with the goal of reducing our environmental impact. This is the first introductory biology text to be printed on paper earning the Forest Steward- ship Council label, the “gold standard” in green paper products, and it is manufactured from wood harvested from sustainable forests. And, of course, we also offer Life as an eBook.</p>
| + | <center><small><strong>Figure 2.1.3 The structure of TAL USB</strong></small></center> |
| - | <h2 id="The Ten Parts">The Ten Parts</h2>
| + | <p> |
| - | <p>We have reorganized the book into ten parts. Part One, The Science of Life and Its Chemical Basis, sets the stage for the book: the opening chapter focuses on biology as an exciting science. We begin with a startling observation: the recent, dramatic de- cline of amphibian species throughout the world. We then show how biologists have formed hypotheses for the causes of this environmental problem and are testing them by carefully de- signed experiments, with a view not only to understanding the decline, but reversing it. This leads to an outline of the basic principles of biology that are the foundation for the rest of the book: the unity of life at the cellular level and how evolution unites the living world. This is followed by chapters on the basic chemical building blocks that underlie life. We have added a new chapter on nucleic acids and the origin of life, introducing the concepts of genes and gene expression early and expanding our coverage of the major ideas on how life began and evolved at its earliest stages.<br>
| + | When digested with BsmBI, this part produces two sticky-ends that can bind TAL-Protein (BBa_K747000 to BBa_K747095) |
| - | In Part Two, Cells, we describe the view of life as seen through cells, its structural units. In response to comments by users of our previous edition, we have moved the chapter on cell signal- ing and communication from the genetics section to this part of the book, with a change in emphasis from genes to cells. There is an updated discussion of ideas on the origin of cells and organelles, as well as expanded treatment of water transport across membranes.<br>
| + | After doing ligation with T4 ligase, we experimentally validated this part's function.</p> |
| - | Part Three, Cells and Energy, presents an integrated view of bio- chemistry. For this edition, we have worked to clarify such challenging concepts as energy transfer, allosteric enzymes, and bio- chemical pathways. There is extensive revision of the discussions of alternate pathways of photosynthetic carbon fixation, as well as a greater emphasis on applications throughout these chapters.<br>
| + | <p> |
| - | Part Four, Genes and Heredity, is extensively revised and reorganized to improve clarity, link related concepts, and provide updates from recent research results. Separate chapters on prokaryotic genetics and molecular medicine have been re- moved and their material woven into relevant chapters. For ex- ample, our chapter on cell reproduction now includes a discus- sion of how the basic mechanisms of cell division are altered in cancer cells. The chapter on transmission genetics now includes coverage of this phenomenon in prokaryotes. New chapters on gene expression and gene regulation compare prokaryotic and eukaryotic mechanisms and include a discussion ofPREFACE xi epigenetics. A new chapter on mutation describes updated applications of medical genetics.<br>
| + | Sequencing result is followed:</p> |
| - | In Part Five, Genomes, we reinforce the concepts of the previous part, beginning with a new chapter on genomes—how they are analyzed and what they tell us about the biology of prokaryotes and eukaryotes, including humans. This leads to a chapter describing how our knowledge of molecular biology and genetics underpins biotechnology (the application of this knowledge to practical problems). We discuss some of the latest uses of biotechnology, including environmental cleanup. Part Five finishes with two chapters on development that explore the themes of molecular biology and evolution, linking these two parts of the book.<br>
| + | <pre><center> |
| - | Part Six, The Patterns and Processes of Evolution, emphasizes the importance of evolutionary biology as a basis for comparing and understanding all aspects of biology. These chapters have been extensively reorganized and revised, as well as updated with the latest thinking of biologists in this rapidly changing field. This part now begins with the evidence and mechanisms of evolution, moves into a discussion of phylogenetic trees, then covers speciation and molecular evolution, and concludes with the evolutionary history of life on Earth. An integrated time- line of evolutionary history shows the timing of major events of biological evolution, the movements of the continents, floral and faunal reconstructions of major time periods, and depicts some of the fossils that form the basis of the reconstructions.<br>
| + | GGAATTCCATATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCGATGGCTTCC |
| - | In Part Seven, The Evolution of Diversity, we describe the latest views on biodiversity and evolutionary relationships. Each chapter has been revised to make it easier for the reader to appreciate the major changes that have evolved within the various groups of organisms. We emphasize understanding the big picture of organismal diversity, as opposed to memorizing a taxonomic hierarchy and names (although these are certainly important). Throughout the book, the tree of life is emphasized as a way of understanding and organizing biological information. A Tree of Life Appendix allows students to place any group of organisms mentioned in the text of our book into the context of the rest of life. The web-based version of this appendix provides links to photos, keys, species lists, distribution maps, and other information to help students explore biodiversity of specific groups in greater detail.<br>
| + | TCCGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGTTCCGTTAACGGTCACGAGTTCGAAA |
| - | After modest revisions in the past two editions, Part Eight, Flowering Plants: Form and Function, has been extensively reorganized and updated with the help of Sue Wessler, to include both classical and more recent approaches to plant physiology. Our emphasis is not only on the basic findings that led to the elucidation of mechanisms for plant growth and reproduction, but also on the use of genetics of model organisms. There is expanded coverage of the cell signaling events that regulate gene expression in plants, integrating concepts introduced earlier in the book. New material on how plants respond to their environment is included, along with links to both the book’s earlier descriptions of plant diversity and later discussions of ecology.<br>
| + | TCGAAGGTGAAGGTGAAGGTCGTCCGTACGAAGGTACCCAGACCGCTAAACTGAAAGTTACCAAAGGTGGTCCGCT |
| - | Part Nine, Animals: Form and Function, continues to provide a solid foundation in physiology through comprehensive coverage of basic principles of function of each organ system and then emphasis on mechanisms of control and integration. An important reorganization has been moving the chapter on immunology from earlier in the book, where its emphasis was on molecular genetics, to this part, where it is more closely allied to the information systems of the body. In addition, we have added a number of new experiments and made considerable effort to clarify the sometimes complex phenomena shown in the illustrations.<br>
| + | GCCGTTCGCTTGGGACATCCTGTCCCCGCAGTTCCAGTACGGTTCCAAAGCTTACGTTAAACACCCGGCTGACATC |
| - | Part Ten, Ecology, has been significantly revised by our new coauthor, May Berenbaum. A new chapter of biological interactions has been added (a topic formerly covered in the community ecology chapter). Full of interesting anecdotes and discus- sions of field studies not previously described in biology texts, this new ecology unit offers practical insights into how ecologists acquire, interpret, and apply real data. This brings the book full circle, drawing upon and reinforcing prior topics of energy, evolution, phylogenetics, Earth history, and animal and plant physiology.</p>
| + | CCGGACTACCTGAAACTGTCCTTCCCGGAAGGTTTCAAATGGGAACGTGTTATGAACTTCGAAGACGGTGGTGTTG |
| - | <h2 id="Exceptional Value Formats">Exceptional Value Formats</h2>
| + | TTACCGTTACCCAGGACTCCTCCCTGCAAGACGGTGAGTTCATCTACAAAGTTAAACTGCGTGGTACCAACTTCCC |
| - | <p> We again provide Life both as the full book and as a cluster of paperbacks. Thus, instructors who want to use less than the whole book can choose from these split volumes, each with the book’s front matter, appendices, glossary, and index.< br> | + | GTCCGACGGTCCGGTTATGCAGAAAAAAACCATGGGTTGGGAAGCTTCCACCGAACGTATGTACCCGGAAGACGGT |
| - | Volume I, The Cell and Heredity, includes: Part One, The Science of Life and Its Chemical Basis (Chapters 1–4); Part Two, Cells (Chapters 5–7); Part Three, Cells and Energy (Chapters 8–10); Part Four, Genes and Heredity (Chapters 11–16); and Part Five, Genomes (Chapters 17–20).<br>
| + | GCTCTGAAAGGTGAAATCAAAATGCGTCTGAAACTGAAAGACGGTGGTCACTACGACGCTGAAGTTAAAACCACCT |
| - | Volume II, Evolution, Diversity, and Ecology, includes: Chapter 1, Studying Life; Part Six, The Patterns and Processes of Evolution (Chapters 21–25); Part Seven, The Evolution of Diversity (Chapters 26–33); and Part Ten, Ecology (Chapters 54–59).<br>
| + | ACATGGCTAAAAAACCGGTTCAGCTGCCGGGTGCTTACAAAACCGACATCAAACTGGACATCACCTCCCACAACGA |
| - | Volume III, Plants and Animals, includes: Chapter 1, Study- ing Life; Part Eight, Flowering Plants: Form and Function (Chapters 34–39); and Part Nine, Animals: Form and Function (Chapters 40–53).<br>
| + | AGACTACACCATCGTTGAACAGTACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTGCTGAGGCCGCCGCAAAA |
| - | Responding to student concerns, we offer two options of the entire book at a significantly reduced cost. After it was so well received in the previous edition, we again provide Life as a loose- leaf version. This shrink-wrapped, unbound, 3-hole punched ver- sion fits into a 3-ring binder. Students take only what they need to class and can easily integrate any instructor handouts or other resources.<br>
| + | GAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGACCAGTAGCTATCTGCATTTTCCGGAGTTTGATCCGGTCATTT |
| - | Life was the first comprehensive biology text to offer the en- tire book as a truly robust eBook. For this edition, we continue to offer a flexible, interactive ebook that gives students a new way to read the text and learn the material. The ebook integrates the student media resources (animations, quizzes, activities, etc.) and offers instructors a powerful way to customize the textbook with their own text, images, Web links, documents, and more.</p>
| + | TCTCAATAGGACCCGTGGCGCTTCACTGGTACGGCCTGATGTATCTGGTGGGTTTCATTTTTGCAATGTGGCTGGC |
| - | <h2 id="Media and Supplements for the Ninth Edition">Media and Supplements for the Ninth Edition</h2>
| + | AACACGACGGGCGAATCGTCCGGGCAGCGGCTGGACCAAAAATGAAGTTGAAAACTTACTCTATGCGGGCTTCCTC |
| - | <p>The wide range of media and supplements that accompany Life, Ninth Edition have all been created with the dual goal of help- ing students learn the material presented in the textbook more efficiently and helping instructors teach their courses more effectively. Students in majors introductory biology are faced with learning a tremendous number of new concepts, facts, and terms, and the more different ways they can study this mate- rial, the more efficiently they can master it.<br>
| + | GGCGTCTTCCTCGGGGGACGTATTGGTTATGTTCTGTTCTACAATTTCCCGCAGTTTATGGCCGATCCGCTGTATC |
| - | All of the Life media and supplemental resources have been developed specifically for this textbook. This provides strong consistency between text and media, which in turn helps students learn more efficiently. For example, the animated tutorials and activities found in BioPortal were built using textbook art, so that the manner in which structures are illustrated, the colors used to identify objects, and the terms and abbreviations used are all consistent.<br>
| + | TGTTCCGTGTCTGGGACGGCGGCATGTCTTTCCACGGCGGCCTGATTGGCGTTATCGTGGTGATGATTATCTTCGC |
| - | For the Ninth Edition, a new set of Interactive Tutorials gives students a new way to explore many key topics across the text- book. These new modules allow the student to learn by doing, including solving problem scenarios, working with experimental techniques, and exploring model systems. All new copies of the Ninth Edition include access to the robust new version of BioPortal, which brings together all of Life’s student and instructor resources, powerful assessment tools, and new integration with Prep-U adaptive quizzing.<br>
| + | CCGCCGTACTAAACGTTCCTTCTTCCAGGTCTCTGATTTTATCGCACCACTCATTCCGTTTGGTCTTGGTGCCGGG |
| - | The rich collection of visual resources in the Instructor’s Media Library provides instructors with a wide range of options for enhancing lectures, course websites, and assignments. High- lights include: layered art PowerPoint® presentations that break down complex figures into detailed, step-by-step presentations; a collection of approximately 200 video segments that can help capture the attention and imagination of students; and Power- Point slides of textbook art with editable labels and leaders that allow easy customization of the figures.<br>
| + | CGTCTGGGCAACTTTATTAACGGTGAATTGTGGGGCCGCGTTGACCCGAACTTCCCGTTTGCCATGCTGTTCCCTG |
| - | For a detailed description of all the media and supplements available for the Ninth Edition, please turn to “Life’s Media and Supplements,” on page xvii.</p>
| + | GCTCCCGTACAGAAGATATTTTGCTGCTGCAAACCAACCCGCAGTGGCAATCCATTTTCGACACTTACGGTGTGCT |
| - | <h2 id="Many People to Thank">Many People to Thank</h2>
| + | GCCGCGCCACCCATCACAGCTTTACGAGCTGCTGCTGGAAGGTGTGGTGCTGTTTATTATCCTCAACCTGTATATT |
| - | <p>“If I have seen farther, it is by standing on the shoulders of giants.” The great scientist Isaac Newton wrote these words over 330 years ago and, while we certainly don’t put ourselves in his lofty place in science, the words apply to us as coauthors of this text. This is the first edition that does not bear the names of Bill Purves and Gordon Orians. As they enjoy their “retirements,” we are humbled by their examples as biologists, educators, and writers.<br>
| + | CGTAAACCACGCCCAATGGGAGCTGTCTCAGGTTTGTTCCTGATTGGTTACGGCGCGTTTCGCATCATTGTTGAGT |
| - | One of the wisest pieces of advice ever given to a textbook author is to “be passionate about your subject, but don’t put your ego on the page.” Considering all the people who looked over our shoulders throughout the process of creating this book, this advice could not be more apt. We are indebted to many people who gave invaluable help to make this book what it is. First and foremost are our colleagues, biologists from over 100 institutions. Some were users of the previous edition, who suggested many improvements. Others reviewed our chapter drafts in detail, including advice on how to improve the illustrations. Still others acted as accuracy reviewers when the book was al- most completed. All of these biologists are listed in the Reviewer credits.<br>
| + | TTTTCCGCCAGCCCGACGCGCAGTTTACCGGTGCCTGGGTGCAGTACATCAGCATGGGGCAAATTCTTTCCATCCC |
| - | Of special note is Sue Wessler, a distinguished plant biologist and textbook author from the University of Georgia. Sue looked critically at Part Eight, Flowering Plants: Form and Function, wrote three of the chapters (34–36), and was important in the revision of the other three (37–39). The new approach to plant biology in this edition owes a lot to her.<br>
| + | GATGATTGTCGCGGGTGTGATCATGATGGTCTGGGCATATCGTCGCAGCCCACAGCAACACGTTTCCTTAGGAGGT |
| - | The pace of change in biology and the complexities of preparing a book as broad as this one necessitated having two developmental editors. James Funston coordinated Parts 1–5, and Carol Pritchard-Martinez coordinated Parts 6–10. We benefit- ted from the wide experience, knowledge, and wisdom of both of them. As the chapter drafts progressed, we were fortunate to have experienced biologist Laura Green lending her critical eye as in-house editor. Elizabeth Morales, our artist, was on her third edition with us. As we have noted, she extensively revised al- most all of the prior art and translated our crude sketches into beautiful new art. We hope you agree that our art program remains superbly clear and elegant. Our copy editors, Norma Roche, Liz Pierson, and Jane Murfett, went far beyond what such people usually do. Their knowledge and encyclopedic recall of our book’s chapters made our prose sharper and more accurate. Diane Kelly, Susan McGlew, and Shannon Howard effectively coordinated the hundreds of reviews that we described above. David McIntyre was a terrific photo editor, finding over 550 new photographs, including many new ones of his own, that enrich the book’s content and visual statement. Jefferson Johnson is responsible for the design elements that make this edition of Life not just clear and easy to learn from, but beautiful as well. Christopher Small headed the production department—Joanne Delphia, Joan Gemme, Janice Holabird, and Jefferson Johnson—who contributed in innumerable ways to bringing Life to its final form. Jason Dirks once again coordinated the creation of our array of media and supplements, including our superb new Web resources. Carol Wigg, for the ninth time in nine editions, oversaw the editorial process; her influence pervades the entire book.<br>
| + | GGAGGTAGTGGTGGAGGTGGAAGTGGTGGAGGTGGTAGTGCTGCAGCTCTGGACACGGGCCAGTTGCTGAAGATCG |
| - | W. H. Freeman continues to bring Life to a wider audience. Associate Director of Marketing Debbie Clare, the Regional Specialists, Regional Managers, and experienced sales force are effective ambassadors and skillful transmitters of the features and unique strengths of our book. We depend on their expertise and energy to keep us in touch with how Life is perceived by its users. And thanks also to the Freeman media group for eBook and BioPortal production.<br>
| + | CGAAGCGGGGAGGAGTCACGGCGGTCGAGGCGGTGCACGCGTGGCGCAATGCGCTCACGGGAGCACCCCTCAACCT |
| - | Finally, we are indebted to Andy Sinauer. Like ours, his name is on the cover of the book, and he truly cares deeply about what goes into it. Combining decades of professionalism, high standards, and kindness to all who work with him, he is truly our mentor and friend.</p>
| + | GACCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTT |
| - | <p>DAVID SADAVA DAVID HILLIS CRAIG HELLER MAY BERENBAUM</p>
| + | CCGGTTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCACGATGGCGGTAAACAAG |
| | + | CCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAGGCCCACGGGCTCACGCCTGAGCAGGTAGTGGCTAT |
| | + | TGCATCCAACGGAGGGGGCAGACCCGCACTGGAGTCAATCGTGGCCCAGCTTTCGAGGCCGGACCCCGCGCTGGCC |
| | + | CACCACCACCACCACCACTAACTCGAGCGG |
| | + | </center></pre> |
| | + | <br> |
| | + | <br><br><br> |
| | + | |
| | + | <p><big><b>Furthermore</b></big>, we found some mismatch cases in our sequencing result. Here are a typical mismatch result.</p> |
| | + | <p>There is the partial sequencing result.</p> |
| | + | <center><img src="https://static.igem.org/mediawiki/2014/f/f5/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%881.26.07.png" width=62% style='max-width=700px'></img><center> |
| | + | |
| | + | <center><strong><small>Figure 2.1.4 Partial sequencing result of mismatch</strong></small></center> |
| | + | |
| | + | <p>We tried to understand why we got this wrong sequence. We checked our part and 2012 Freiburg's project. And we found that the the mismatch sticky ends appearing in original sequence are <b>GCTC</b> and <b>ACTC</b>. What similar sticky ends! Here are the two components in the mismatch sequence. </p> |
| | + | |
| | + | <center><img src="https://static.igem.org/mediawiki/2014/d/dd/%E5%B1%8F%E5%B9%95%E5%BF%AB%E7%85%A7_2014-10-18_%E4%B8%8A%E5%8D%882.40.42.png" width=72% style='max-width=800px'></img></center> |
| | + | |
| | + | <center><strong><small>Figure 2.1.5 The process of generating mismatch</small></strong></center> |
| | + | |
| | + | <p>So the sequencing result proves that similar sticky ends can mismatch when T4 ligase exists. This result enlightens us on improving TALE construction parts.</p> |
| | + | |
| | + | |
| | + | <p>2012 Freiburg's parts have seven sticky ends:</p> |
| | + | <p>< center> TGAC, GCTC, CTTG, GCTT, ACTG, CCTG, ACTC< /center>< /p> |
| | + | <p>Inpired by BLAST algorithm, we calculated the similarity of each other sticky ends. </p> |
| | + | <center><img src="https://static.igem.org/mediawiki/2014/8/8e/TAL%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF%E8%A1%A8%E6%A0%BC.png" width=37% style='max-width=400px'></img></center> |
| | + | <center><strong><small>Figure 2.1.6 Strict rules score table</small></strong></center> |
| | + | <p id="dianweidian5">The higher score, the higher similarity, and the higher possibility of mismatch. |
| | + | The table shows that more than 30% of pairs’ score is equal to 3, which means that the possibility of mismatch cannot be neglected. |
| | + | |
| | + | Even if we employed the relatively loose rule to calculate the similarity, we still found that error rates cannot be neglected.</p> |
| | + | <center><img src="https://static.igem.org/mediawiki/2014/9/9b/Tal_%E8%A1%A8%E6%A0%BC%E7%B2%98%E6%80%A7%E6%9C%AB%E7%AB%AF2.png" width=37% style='max-width=400px'></img></center> |
| | + | |
| | + | <center><strong><small>Figure 2.1.7 Loose rules score table</small></strong></center> |
| | + | |
| | + | <p>So how to solve this problem?</p> |
| | + | < p> Our team designed seven new sticky ends which are theoretically better than original version. For more information please go to <a href="https://2014. igem. org/Team:SJTU-BioX-Shanghai/Part3_TAL_Improvement" > TAL Improvement </ a> page!</p> |
| | + | |
| | </article> | | </article> |
| - | </div></html> | + | </div> |
| | + | </html> |
| | {{Team:SJTU-BioX-Shanghai/footer}} | | {{Team:SJTU-BioX-Shanghai/footer}} |
"
