Basic Parts

Review previous parts

ssDsbA: SsDsbA is the signal recognition particle (SRP)-dependent signaling sequence of DsbA. SsDsbA-tagged proteins are exported to the periplasm through the SRP pathway. With ssDsbA fused to the N-terminus, fusion proteins with Lgt are expected to be anchored onto inner membrane of E.coli.
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand ( (BBa_K771002, SJTU-BioX-Shanghai)

Lgt: Phosphatidylglycerol:: prolipoprotein diacylglyceryl transferase (Lgt) is an inner membrane protein act as an membrane anchor of E.coli with seven transmembrane segments and has been successfully overexpressed in E. coli without causing harm to cells.
From: ssDsbA-PDZ Ligand-LGT-SH3 Ligand (BBa_K771002, SJTU-BioX-Shanghai)

mRFP: Red Fluorescent Protein. To visualize the localization of fusion protein with fluorescence test , we added mRFP in the Connectee1 and placed it just after the ssDsbA.
From: Highly engineered mutant of red fluorescent protein from Discosoma striata (BBa_E1010, Antiquity )

FL3-TALE(BBa_K1453300)

This is a TALE protein with a flexible linker 3 before it.

Since we cannot connect TALE by Golden Gate method designed by 2012 Freiburg, so the sequence was synthesized by Genwize company. This TALE can recognize the DNA sequence TTGGTCATGAGA(12bp). Moreover, we use this part with our part BBa_K14530000 to make our composite part BBa_K1453305.

Connector

We have four types of connector.

pBluescript II KS(+) ScaI deletion (BBa_K1453901)

pBluescript II KS(+) EcoRV deletion (BBa_K1453001)

pBluescript II KS(+)_3_copy (BBa_K1453003)

pBluescript II KS(+)_5_copy (BBa_K1453004)

Each type of connector has its own function. If you want to know the details, please click it. We have introduction on our part's main page.

ssDsbA-mRFP-Lgt-TAL1-His Tag(BBa_K1453005)

The structure is based on the BBa_1453000 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.

TAL1-His Tag(BBa_K1453007)

This part is a first second of connectee, which we used to check the connection between connectee and connector in our basic test.

The structure is based on the BBa_K1453006 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089.

USB

We make two kinds of USB. One is TAL USB, the other is Enzyme USB. They can help us easily and quickly insert our target TALE or Enzyme, respectively.

TAL USB(BBa_K1453000)

We design a sequence which can be used together with 2012 Freiburg's part. The TAL USB can make two specific sticky ends. The two ends are the same as the first part and the last part of Freiburg design. So when we digest and ligate them together, we can get a whole TALE. But unluckily, since the sticky ends designed by Freiburg are too similar, we can just have some mismatch sequence by using these TAL USB.

Enzyme USB(BBa_K1453400)(BBa_K1453401)

In order to easily and quickly insert the target function enzyme into our system, we design two enzyme-USBs. The enzyme USB have three fundamental components, flexible linker- enzyme adaptor-flexible linker.

The first flexible linker has deleted the PstI recognition site. And at the beginning of the sequence there is a Bsu36I recognition site. The second flexible linker we replace the original PstI site with a isocaudamer SduI, since our part can not have a PstI recognition site.

On the other hand, the enzyme adaptor has two same restriction enzyme recognition sites. In one of our enzyme-USB, it is the AarI recognition site; The other enzyme-USB is the BsmAI recognition site. The AarI and BsmAI are similar to BsmBI which all can make a 4bp sticky end designed by ourselves.

When we want to insert a functional enzyme into our fusion protein, first we need to have a PCR experiment to add a head and a tail around our enzyme. After that, the enzyme product also has the restriction enzyme recognition site. When digested by the specific restriction enzyme, it can generate the same sticky ends, so our enzyme can be inserted into our part.

TAL_USB-His Tag(BBa_K1453006)

In order to bind TAL protein designed by 2012 Freiburg iGEM team, the TAL USB also consists of T1 sequence, T14 sequence and two sites for type II restriction enzyme BsmBI.

When digested with BsmBI, this part can produce two sticky-ends that can bind TAL-Protein DiRepeat (Bba_K747000 to Bba_K747095)

ssDsbA-Lgt-Enzyme USB(BsmAI)-TAL_USB-His Tag(BBa_K1453402)

This part is the combination of BBa_K1453401 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.

ssDsbA-Lgt-Enzyme USB(AarI)-TAL_USB-His Tag(BBa_K1453403)

This part is the combination of BBa_K1453400 BBa_K1453006 and BBa_K1453000.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.

Enzyme USB(BsmAI)-TAL_USB-His Tag(BBa_K1453406)

This part is the combination of BBa_K1453401 and BBa_K1453006.

Enzyme USB(AarI)-TAL_USB-His Tag(BBa_K1453407)

This part is the combination of BBa_K1453400 and BBa_K1453006.See more details please search these two parts of iGEM14_SJTU_BioX_Shanghai.

Application

We chose some functional enzymes and inserted them into connectees
We want to prove that our connectees and connectors system can successfully achieve our designed function in the end.

ssDsbA-Lgt-pykF-TAL1-His Tag(BBa_K1453404)

This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.

ssDsbA-Lgt-poxB-TAL1-His Tag(BBa_K1453405)

This part is based on the BBa_K1453402 or BBa_K1453403 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB

pykF-TAL1-His Tag(BBa_K1453408)

This part is used in our application test free in the cytoplasm.

This part is based on the BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate kinase (EC:2.7.1.40) or pykF.

poxB-TAL1-His Tag(BBa_K1453409)

This part is used in our application test free in the cytoplasm.

This part is based on the BBa_1453006 and BBa_K1453406 or BBa_K1453407 and the recognition sequence is T-TCGATATCAAGC-T. Therefore, the TAL-Protein DiRepeats protein we need are BBa_K747013, BBa_K747024, BBa_K747044, BBa_K747061, BBa_K747064 and BBa_K747089. The enzyme we used here is the pyruvate dehydrogenase (quinone) [EC:1.2.5.1] or poxB

New TAL

New TAL with better sticky ends(BBa_K1453500) (501) (502) (503) (504) (505) (506)

We design seven new sticky ends which get the least score when judging the similarity.
If you want to know how we design these ends, please go to see our project-Part3 TAL improve.

PART-left:
…CTGACCCCGGAGACG

PART1(150bp):
CGTCTCGCCCCGGAACAGGTGGTGGCCATTGCAAGCAACGGTGGTGGCAAGCAGG CCCTGGAGACAGTCCAACGGCTGCTTCCGGTTCTGTGTCAGGCCCACGGCCTGACT CCAGAACAAGTGGTTGCTATCGTGGCGGAAAATGAGACG

PART2(219bp):
CGTCTCTAAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGTGTCAG GCCCACGGGCTCACCCCGGAACAGGTGGTGGCCATCGCATCTAACAATGGCGGTA AGCAGGCACTGGAAACAGTGCAGCGCCTGCTTCCGGTCCTGTGTCAGGCTCATGG CCTGACCCCAGAGCAGGTCGTGGCAATTGCCTCCAACATTGGAGGGCGAGACG

PART3(262bp):
CGTCTCTAGGGAAGCAGGCACTGGAGACCGTGCAGCGGCTGCTGCCGGTGCTGTG TCAGGCCCACGGCTTGACCCCGGAACAGGTGGTGGCCATCGCCTCCAACGGCGGT GGCAAACAGGCGCTGGAAACAGTTCAACGCCTCCTTCCGGTCCTGTGCCAGGCCC ATGGTCTGACTCCAGAGCAGGTTGTGGCAATTGCAAGCAACATTGGTGGTAAACA AGCTTTGGAAACCGTCCAGCGCTTGCTGCCAGTACGGAGACG

PART4(224bp):
CGTCTCCGTACTGTGTCAGGCCCACGGGCTTACCCCGGAACAGGTGGTGGCCATT GCAAGCAACGGTGGTGGCAAGCAGGCCCTGGAGACAGTCCAACGGCTGCTTCCGG TTCTGTGTCAGGCCCACGGCCTGACTCCAGAACAAGTGGTTGCTATCGCCAGCCA CGATGGCGGTAAACAAGCCCTCGAAACCGTGCAGCGCCTGCTTCCGGTGCTGGGA
GACG

PART5(194bp):
CGTCTCCGCTGTGTCAGGCCCACGGACTGACCCCGGAACAGGTGGTGGCCATCGC CTCCAACATTGGTGGTAAGCAAGCCCTCGAAACTGTGCAGCGGCTGCTTCCAGTC TTGTGCCAGGCTCACGGCCTGACACCGGAGCAGGTGGTTGCAATCGCGTCTAATA
TCGGCGGCAAACAGGCACTCGATGAGACG

PART6(249bp):
CGTCTCATCGAGACCGTGCAGCGCTTGCTTCCAGTGCTGTGTCAGGCCCACGGCC TGACCCCGGAACAGGTGGTGGCCATCGCCTCTAACAATGGCGGCAAACAGGCATT GGAAACAGTTCAGCGCCTGCTGCCGGTGTTGTGTCAGGCTCACGGCCTGACTCCG GAGCAGGTTGTGGCCATCGCAAGCCATGATGGCGGTAAACAAGCTCTGGAGACAG
TGCAACGCCTCTTGCCAGTTTTAGAGACG

PART-right:
CGTCTCATTTTGTGTCAGGCCCACGGA...

The recognition sequence of the TALE protein: