Team:Aachen/Notebook/Wetlab/August
From 2014.igem.org
(Difference between revisions)
(→6th) |
|||
(4 intermediate revisions not shown) | |||
Line 93: | Line 93: | ||
== 4th == | == 4th == | ||
- | * made cryo stocks of K1319042 and K131026 in NEB/BL21/ | + | * made cryo stocks of K1319042 and K131026 in NEB/BL21/DH5α, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E. coli'' rosetta (DE3), respectively. |
* made plasmid prep, most of them using 1.5 mL culture medium, and eluted with 1x 50 µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below. | * made plasmid prep, most of them using 1.5 mL culture medium, and eluted with 1x 50 µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below. | ||
Line 106: | Line 106: | ||
| I746909 BL21 #3 || 49 | | I746909 BL21 #3 || 49 | ||
|- | |- | ||
- | | K1319042 | + | | K1319042 DH5α || 60 |
|- | |- | ||
- | | K131026 | + | | K131026 DH5α || 150 |
|- | |- | ||
| pET17-Gal3 #1 || 30.5 | | pET17-Gal3 #1 || 30.5 | ||
Line 140: | Line 140: | ||
| I746909 BL21 #1 || 2029, 947 | | I746909 BL21 #1 || 2029, 947 | ||
|- | |- | ||
- | | K1319042 | + | | K1319042 DH5α || 2029, 1780 |
|- | |- | ||
- | | K131026 | + | | K131026 DH5α || 2029, 1848 |
|- | |- | ||
| pET17-Gal3 #1 || 3086, 923, 1262 | | pET17-Gal3 #1 || 3086, 923, 1262 | ||
Line 158: | Line 158: | ||
* made alliquots of HM, 1 L HM + glucose + supplements and 500 ml LB | * made alliquots of HM, 1 L HM + glucose + supplements and 500 ml LB | ||
- | * The | + | * The '''Quikchange''' mutagenesis PCR with a tamplate K1319000 and following primers was made. The PCR was made in two steps. The first step is PCR with both primers separatly and the second step includes PCR with two PCR products mixed with each other. |
** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC | ** forward primer EYFPtoREACh1_F: AGTACAACTGGAACAGCCACAACGTCTATATC | ||
** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG | ** rewerse primer EYFPtoREACh1_R: GTTGTGGCTGTTCCAGTTGTACTCCAGCTTG | ||
Line 203: | Line 203: | ||
<center> | <center> | ||
- | {{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after | + | {{Team:Aachen/Figure|Aachen_14-07-5_PCR_toREACh1%262.png|title=Agarose gel with PCR products after Quikchange from K1319000 to K1319001 and K1319002 |width=400px}} |
</center> | </center> | ||
Line 213: | Line 213: | ||
== 6th == | == 6th == | ||
* transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells. | * transformation of J04450 in pSB1K3 and pSB1A3 in NEB10β cells. | ||
- | * | + | * plasmid prep of J04450 in pSB1C3, pSEVA234_LasR and pSEVA641_BsFbFP. |
- | * made precultures of | + | * made precultures of NEB10β and DH5α cells |
* inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24 h. | * inoculation of the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24 h. | ||
* as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55°C, 57°C and 60°C. Then the agarose gel with PCR product samples was made. | * as the first Quickchange PCR for REACh2 was not sucsessful, it was reapeted as a gradient PCR with annealing temperatire 55°C, 57°C and 60°C. Then the agarose gel with PCR product samples was made. |
Latest revision as of 22:39, 17 October 2014