|
|
(464 intermediate revisions not shown) |
Line 1: |
Line 1: |
| __NOTOC__ | | __NOTOC__ |
| + | {{CSS/Main}} |
| + | {{Team:Aachen/Stylesheet}} |
| {{Team:Aachen/Header}} | | {{Team:Aachen/Header}} |
| + | <span id="partners"></span> |
| | | |
- | {| cellpadding="10"
| + | =Our Work in the Lab= |
- | ! width="300" |
| + | |
- | ! width="*" |
| + | |
- | ! width="300" |
| + | |
- | |- border="0"
| + | |
- | | __TOC__
| + | |
- | | In order to detect the pathogens fast, specifically and inexpensively we are building sensor cells to detect these pathogens. These sensor cells can identify pathogens in very low concentration by responsing to specific extracellular molecules either secreted by or displayed on the pathogens. These molecules trigger a fast fluorescence response by our immobilized sensor cells which will be measured by our device.
| + | |
- | | [[File:Aachen_Cellock_standingup.png|300px]]
| + | |
- | |}
| + | |
| | | |
| + | <center> |
| + | <html><ul class="team-grid" style="width:1064px;"> |
| + | <!-- Overview --> |
| | | |
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"> |
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | preparation of competent cells |
| + | <br/><br/> |
| + | test on transformation efficiency |
| + | <br/><br/> |
| + | development of quenchers |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | More information will be available soon!
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"> |
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | development of quenchers |
| + | <br/><br/> |
| + | first transformation of BioBricks |
| + | <br/><br/> |
| + | test of BioBricks |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | = May = | + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
- | == 8th == | + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"> |
- | * SOE-PCR step 2
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | BioBrick transformation marathon |
| + | <br/><br/> |
| + | construction of first own BioBrick |
| + | <br/><br/> |
| + | processing of Biobricks |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | == 23rd == | + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
- | * Transformation some BioBricks
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"> |
- | * Colony PCR (s. picture below)
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
- | {{Team:Aachen/Figure|Aachen_14-05-23_COLONY-PCR.jpg|title=Colony PCR |subtitle=todo|width=300px}}
| + | <br/><br/> |
| + | <b> |
| + | preparation of 2D-detection chips |
| + | <br/><br/> |
| + | testing our chip system |
| + | <br/><br/> |
| + | development of chip measurement methods |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
| + | </ul></html> |
| + | </center> |
| | | |
- |
| + | <center> |
- |
| + | <html><ul class="team-grid" style="width:798px;"> |
- |
| + | <!-- Overview --> |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
- |
| + | |
| | | |
- | {{Team:Aachen/JumpUp}}
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
- | | + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"> |
- | = June = | + | <div class="team-item team-info" style="width:214px;height:214px;" > |
- | == 25th ==
| + | <br/><br/> |
- | * prepared a preculture for competent NEB10β cells
| + | <b> |
- | * submitted samples for sequencing
| + | start of Gal3 approach |
- | * made master plates of transformed BioBricks
| + | <br/><br/> |
- | * centrifuged and froze overnight expression culture of J23101.E0240 and K516132
| + | detection of HSL with chip system |
- | | + | <br/><br/> |
- | == 26th ==
| + | testing of <i> Pseudomonas fluorescens </i> |
- | * made competent NEB10β cells, however, several things went wrong. (For future reference: pre-cool centrifuge, always check if it's indeed spinning, frequently check OD of the culture)
| + | </b> |
- | * colony PCR on the transformed clones looked awful; there were too many cells in the 10 µL reaction volume. Some tubes were not fully sealed during the PCR. Basically ''only'' primers and smear, except for the positive control which contained a plasmid template instead of cells.
| + | <br/><br/> |
- | * 2x 500 mL of fresh LB and three sterile flasks were prepared and autoclaved.
| + | <!-- click for more information --> |
- | | + | </div> |
- | = July =
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
- | == 16th ==
| + | </li> |
- | * did plasmid preps
| + | |
- | * transformation of different reporter strains
| + | |
- | ** NEB
| + | |
- | ***pSEVE641_BsFbFP
| + | |
- | ***pSEVA234_LasR
| + | |
- | ***pSEVE641_BsFbFP pSEVA234_LasR
| + | |
- | ***pSEVE641_BsFbFP pSB1C3_C0179
| + | |
- | **BL21
| + | |
- | ***pSEVE641_BsFbFP pSEVA234_LasR
| + | |
- | ***pSEVE641_BsFbFP pSB1C3_C0179
| + | |
- | | + | |
- | == 22nd ==
| + | |
- | * [[User:Pdemling|Philipp]] and [[User:mosthege|Michael]] made 100x stocks for Hartmans minimal medium.
| + | |
- | * [[User:mosthege|Michael]] and [[User:VeraA|Vera]] made about 25 HM+C plates without glucose.
| + | |
- | * K731520 iLOV was plated on a HM+C plate
| + | |
- | | + | |
- | == 23rd ==
| + | |
- | * [[User:mosthege|Michael]] made 25 new HM+C plates with 1 % agar and 4 g/L glucose
| + | |
- | * He also added 170 µL of the glucose stock (500 g/L) to the glucose-free HM+C-plates
| + | |
- | * 1 L of sterile HM+glucose was prepared
| + | |
- | * K731520 iLOV was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5 mL HM+C+Glucose precultures were inoculated (17:00)
| + | |
- | | + | |
- | == 24th ==
| + | |
- | * K731520 iLOV did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E. coli'' is missing some vitamins
| + | |
- | * Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20 mL supplement stock solution that can be added to 1x HM media
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | |-
| + | |
- | ! Component !! supplement for 1x HM [g/L] !! final 1x concentration
| + | |
- | |-
| + | |
- | | Casamino acids || 2 || 2 g/L
| + | |
- | |-
| + | |
- | | Thiamine hydrochloride || 0.3 || 300 mg/L
| + | |
- | |-
| + | |
- | | MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L
| + | |
- | |-
| + | |
- | | CaCl{{sub|2}} || 0.011 || 0.1 mmol/L
| + | |
- | |}
| + | |
- | The powders for 1 L of 1x HM were dissolved in 20 mL of a 10 % w/v Casamino acid stock solution and filter-sterilized (.22 µm PES). To make agar chips, we can add 1 mL to the hot agar mixture, together with the three 500 µL 100x stocks for the HM.
| + | |
- | | + | |
- | We made 250 mL of HM+C+Glucose+Supplements plates with 1.5 % agar.
| + | |
- | | + | |
- | Then we plated the following combinations:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | |-
| + | |
- | ! Construct !! HM+C+Glucose+Supplements !! LB+C
| + | |
- | |-
| + | |
- | | K731520 iLOV || - || +
| + | |
- | |-
| + | |
- | | J23101.E0240 || + || +
| + | |
- | |}
| + | |
- | | + | |
- | We also prepared a 150 mL HM+C+Glucose+Supplements culture with K731520 iLOV to hopefully make agar chips on Friday, July 25th.
| + | |
- | | + | |
- | 6 of last weeks J23115.E0240 clones were plated on LB+C, and 5 mL LB+C precultures were inoculated for plasmid preparation.
| + | |
- | | + | |
- | == 25th ==
| + | |
- | The K731520 iLOV strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, [[User:mosthege|Michael]] set up a colony PCR:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | |-
| + | |
- | ! ID !! Template !! Product Length !! Result
| + | |
- | |-
| + | |
- | | 1 || J23101.E0240 #5 || 1233 ||
| + | |
- | |-
| + | |
- | | 2 || J23101.E0240 #6 || 1233 ||
| + | |
- | |-
| + | |
- | | 3 || J23101.E0240 #5 plasmid || 1233 ||
| + | |
- | |-
| + | |
- | | 4 || K731520 iLOV LB colony || 2053 ||
| + | |
- | |-
| + | |
- | | 5 || K731520 iLOV plasmid || 2053 ||
| + | |
- | |-
| + | |
- | | 6 || K731520 GFP plasmid || 2437 ||
| + | |
- | |-
| + | |
- | | 7 || water || none ||
| + | |
- | |}
| + | |
- | | + | |
- | Reaction volume per tube was 15 µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! parameter !! duration !! temp [°C]
| + | |
- | |-
| + | |
- | | denature||10:00||95
| + | |
- | |-
| + | |
- | | '''denature'''||00:30||95
| + | |
- | |-
| + | |
- | | '''anneal'''||00:30||49
| + | |
- | |-
| + | |
- | | '''elongate'''||02:36||72
| + | |
- | |-
| + | |
- | | elongate||05:00||72
| + | |
- | |-
| + | |
- | | store||forever||8
| + | |
- | |}
| + | |
- | | + | |
- | [[User:fgohr|Florian]] mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3 mL instead of 1.5 mL culture medium and eluted twice with 25 µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].
| + | |
- | | + | |
- | The resulting DNA concentrations are listed in this table:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! clone # !! concentration [ng/µl]
| + | |
- | |-
| + | |
- | | 1 || 73.5
| + | |
- | |-
| + | |
- | | 2 || 94.5
| + | |
- | |-
| + | |
- | | 3 || 100.5
| + | |
- | |-
| + | |
- | | 4 || 53
| + | |
- | |-
| + | |
- | | 5 || 82
| + | |
- | |-
| + | |
- | | 6 || 138
| + | |
- | |}
| + | |
- | | + | |
- | In the evening, we plated some strains on the different media to investigate why the K731520 iLOV did not grow on the HM+suppl. plate. (Note: In the morning, [[User:mosthege|Michael]] re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements
| + | |
- | |-
| + | |
- | | J23101.E0240 || NEB10beta || ++ || - || ++
| + | |
- | |-
| + | |
- | | K731520 iLOV || DH5alpha || ++ || - || (+)
| + | |
- | |-
| + | |
- | | K131026 || NEB10beta || ++ || - || -
| + | |
- | |-
| + | |
- | | K131026 || DH5alpha || ++ || - || +
| + | |
- | |}
| + | |
- | | + | |
- | [[User:Pdemling|Philipp]] inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.
| + | |
- | | + | |
- | == 28th ==
| + | |
- | <!-- WICHTIG: Unterlagen für Zollkram heraussuchen und der Frau von der ZHV zurückschreiben!!!! --> | + | |
- | | + | |
- | == 29th ==
| + | |
- | | + | |
- | * ...
| + | |
- | | + | |
- | <!-- | + | |
- | * inoculate 2x 150 ml cultures HM+Glucose+C
| + | |
- | * prepare 200 ml 1.5 % agar
| + | |
- | * pre-cool centrifuge
| + | |
- | * centrifuge 1x 50, 1x 100 and 1x 150 ml
| + | |
- | * make 3 kinds of chips - OOx1, ODx2, ODx3
| + | |
- | | + | |
- | -->
| + | |
- | | + | |
- | = August =
| + | |
- | == 1st ==
| + | |
- | * Stefan and [[User:VeraA|Vera]] made electrocompetent ''E.coli'' cells.
| + | |
- | * [[User:AZimmermann|Arne]] prepared cultures of Renés iLOV and K131026 for Saturday, August 2nd.
| + | |
- | | + | |
- | == 2nd ==
| + | |
- | * tested the OD measurement device and compared it to the spectrophotometer and the plate reader.
| + | |
- | * tested K131026 and K731520 iLOV for fluorescence in the plate reader
| + | |
- | * did a heat shock transformation of I746909 into NEB TOP 10 cells
| + | |
- | * did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta
| + | |
- | | + | |
- | == 3rd ==
| + | |
- | * OD measurements of the iGEM device in comparison to the spectrophotometer were taken.
| + | |
- | * cryo cultures of K131026 and K731520 iLOV were prepared
| + | |
- | | + | |
- | == 4th ==
| + | |
- | * [[User:AZimmermann|Arne]] and [[User:mosthege|Michael]] made cryo stocks of K731520 iLOV and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E. coli'' rosetta (DE3), respectively.
| + | |
- | * [[User:mosthege|Michael]] did a plasmid prep, most of them using 1.5 mL culture medium, and eluted with 1x 50 µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! combination !! concentration [ng/µl]
| + | |
- | |-
| + | |
- | | I746909 BL21 #1 || 73.5
| + | |
- | |-
| + | |
- | | I746909 BL21 #2 || 45
| + | |
- | |-
| + | |
- | | I746909 BL21 #3 || 49
| + | |
- | |-
| + | |
- | | K731520 iLOV DH5alpha || 60
| + | |
- | |-
| + | |
- | | K131026 DH5alpha || 150
| + | |
- | |-
| + | |
- | | pET17-Gal3 #1 || 30.5
| + | |
- | |-
| + | |
- | | pET17-Gal3 #2 || 6.4
| + | |
- | |-
| + | |
- | | pET17-Gal3 #3 || 6.3
| + | |
- | |-
| + | |
- | | pET17-Gal3 #4 || 9.4
| + | |
- | |-
| + | |
- | | pET17-Gal3 #5 || 10.1
| + | |
- | |-
| + | |
- | | pET17-Gal3 #6 || 8.2
| + | |
- | |-
| + | |
- | | pET17-Gal3 #7 || 13.8
| + | |
- | |-
| + | |
- | | pET17-Gal3 #8 || 6.9
| + | |
- | |-
| + | |
- | | pET17-Gal3 #9 || 10.2
| + | |
- | |}
| + | |
- | | + | |
- | To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.
| + | |
- | | + | |
- | {{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=200px}}
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! combination !! cut products[bp]
| + | |
- | |-
| + | |
- | | I746909 BL21 #1 || 2029, 947
| + | |
- | |-
| + | |
- | | K731520 iLOV DH5alpha || 2029, 1780
| + | |
- | |-
| + | |
- | | K131026 DH5alpha || 2029, 1848
| + | |
- | |-
| + | |
- | | pET17-Gal3 #1 || 3086, 923, 1262
| + | |
- | |}
| + | |
- | | + | |
- | All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.
| + | |
- | | + | |
- | == 5th ==
| + | |
- | * [[User:StefanReinhold|Stefan]], [[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] assembled a V{{sub|R}}=2.5 L bioreactor for cultivation of a 1 L expression culture.
| + | |
- | * Two precultures of 20 mL LB+A were inoculated at 19:00
| + | |
- | * [[User:Aschechtel|Anna]] transformed K746909 into BL21 cells and K1319000 into NEB10beta cells.
| + | |
- | | + | |
- | == 6th ==
| + | |
- | * [[User:Eshani.sood|Eshani]] and [[User:AZimmermann|Arne]] transformed J04450 in pSB1K3 and pSB1A3 in NEB Beta cells.
| + | |
- | * They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.
| + | |
- | * [[User:AZimmermann|Arne]] made precultures of NEB Beta and DH5 alpha cells
| + | |
- | * [[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] inoculated the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24 h.
| + | |
- | | + | |
- | == 25th ==
| + | |
- | * did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI).
| + | |
- | * [[User:Nbailly|Nina]] tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300 µL Fe3+ in 500 mL flasks with a filling volume of 30 mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30 °C at 250 rpm.
| + | |
- | | + | |
- | == 26th ==
| + | |
- | * ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.
| + | |
- | * plasmid prep of I20260, K516032 and B0034
| + | |
- | * restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI
| + | |
- | * A gel with restricted the I20260, K516032 and B0034 was run.
| + | |
- | * purification of vector backbones pSB1A2, pSB3K3 and pSB1C3
| + | |
- | * restriciton of synthesized TEV protease with EcoRI and PstI
| + | |
- | * [[User:Nbailly|Nina]] qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300 µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.
| + | |
- | | + | |
- | == 27th ==
| + | |
- | * ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3
| + | |
- | * transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively
| + | |
- | | + | |
- | = September =
| + | |
- | == 3rd ==
| + | |
- | [[User:Mosthege|Michael]], [[User:VeraA|Vera]] and [[User:Eshani.sood|Eshani]] prepared 50 mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.
| + | |
- | | + | |
- | == 4th ==
| + | |
- | * In the morning, at 10:15, Anna inoculated the precultures for the interlab study experiment.
| + | |
- | * [[User:Mosthege|Michael]] prepared cryo stocks of the pSBX-carrying ''E. coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30 µL water, and resulting in the following DNA concentrations:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! vector !! concentration [ng/µL]
| + | |
- | |-
| + | |
- | | pSBX1A3 || 111
| + | |
- | |-
| + | |
- | | pSBX4A5 || 14.1
| + | |
- | |-
| + | |
- | | pSBX1C3 || 31
| + | |
- | |-
| + | |
- | | pSB4C5 || 98.5
| + | |
- | |-
| + | |
- | | pSBX1K3 || 18
| + | |
- | |-
| + | |
- | | pSBX4K5 || 30
| + | |
- | |-
| + | |
- | | pSBX1T3 || 39
| + | |
- | |-
| + | |
- | | constitutive expression plasmid || 73
| + | |
- | |}
| + | |
- | | + | |
- | | + | |
- | * Anna did PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25 µL reaction volume (12.5 µL Q5 2x Master Mix, 1.25 µL per primer, 2 µL template)
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! PCR tube # !! components
| + | |
- | |-
| + | |
- | | 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R
| + | |
- | |-
| + | |
- | | 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R
| + | |
- | |-
| + | |
- | |}
| + | |
- | | + | |
- | The PCR conditions:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! step !! temperature [°C] !! duration
| + | |
- | |-
| + | |
- | | denature || 98 || 30", 98 °C for 10", 55 °C for 30", 72 °C for 2'15"
| + | |
- | |-
| + | |
- | | denature || 98 || 10"
| + | |
- | |-
| + | |
- | | anneal || 50 (insert) 55 (backbone) || 30"
| + | |
- | |-
| + | |
- | | elongate || 72 || 0'30" (insert) 2'15" (backbone)
| + | |
- | |-
| + | |
- | | elongate || 72 || 2"
| + | |
- | |-
| + | |
- | | store || 8 || indefinite
| + | |
- | |}
| + | |
- | | + | |
- | Finally, [[User:fgohr|Florian]] did the Gibson assembly and a heat shock transformation into NEB10beta cells.
| + | |
- | | + | |
- | At 10:15, [[User:AZimmermann|Arne]] inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.
| + | |
- | | + | |
- | == 5th ==
| + | |
- | * Anna made master plates of yesterday's transformed cells.
| + | |
- | | + | |
- | == 6th ==
| + | |
- | * Anna made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.
| + | |
- | | + | |
- | == 7th ==
| + | |
- | * Anna made cryos stocks of the precultures.
| + | |
- | * [[User:Mosthege|Michael]] and [[User:AZimmermann|Arne]] purified the following plasmids:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]
| + | |
- | |-
| + | |
- | |K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||
| + | |
- | |-
| + | |
- | |K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||
| + | |
- | |-
| + | |
- | |K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||
| + | |
- | |-
| + | |
- | |K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||
| + | |
- | |-
| + | |
- | |K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||
| + | |
- | |-
| + | |
- | |K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||
| + | |
- | |-
| + | |
- | |K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||
| + | |
- | |-
| + | |
- | |K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||
| + | |
- | |-
| + | |
- | |K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||
| + | |
- | |-
| + | |
- | |K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||
| + | |
- | |-
| + | |
- | |K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||
| + | |
- | |-
| + | |
- | |His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||
| + | |
- | |-
| + | |
- | |His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||
| + | |
- | |}
| + | |
- | Elution was performed with 2 * 15 µL of nuclease free water.
| + | |
- | | + | |
- | == 15th ==
| + | |
- | [[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] were able to analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008.
| + | |
- | | + | |
- | GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.
| + | |
- | GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations.
| + | |
- | | + | |
- | For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.
| + | |
- | | + | |
- | Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct.
| + | |
- | | + | |
- | The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.
| + | |
- | | + | |
- | == 16th ==
| + | |
- | | + | |
- | * [[User:VeraA|Vera]] made master plates of the transformation from the day before.
| + | |
- |
| + | |
- | * Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.
| + | |
- | | + | |
- | == 17th ==
| + | |
- | | + | |
- | * [[User:Nbailly|Nina]] prepped and autoclaved 33 500 mL shake flasks.
| + | |
- | | + | |
- | == 18th ==
| + | |
- | | + | |
- | * [[User:Nbailly|Nina]] tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500 mL flasks with 30 mL LB Pseudomonas-F medium, and inoculated each one with 1 mL culture medium of the overnight preculture. Flasks were inoculated at 30 °C at 250 rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30 mL of TB medium in a 500 mL flask were inoculated with ''E. coli'' DH5alpha cells and incubated at 37 °C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5alpha, are adequate for the kind of school experiment we are planning with the NEAnderLab.
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}
| + | |
- | | + | |
- | == 19th ==
| + | |
- | * [[User:R.hanke|René]], [[User:AZimmermann|Arne]] and [[User:Pdemling|Philipp]] made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37°C and 300 rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.
| + | |
- | | + | |
- | * [[User:VeraA|Vera]] did a plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).
| + | |
- | | + | |
- | * [[User:fgohr|Florian]] made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).
| + | |
- | | + | |
- | * [[User:AZimmermann|Arne]] also inoculated 4 cultures for the further testing of the OD/F device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015.
| + | |
- | | + | |
- | * Furthermore, [[User:Nbailly|Nina]] did a growth experiment with DH5alpha for the NEAnderLab school experiment. 3 500mL shake flasks were filled with 50mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. [[User:Nbailly|Nina]] concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th.
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}
| + | |
- | | + | |
- | * [[User:Aschechtel|Anna]] also made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. These will be inocubated for an hour at 37 degress Celsius. Then they will be induced with iPTG/HSL and fotos will be made every 30 minutes to check for fluorescence (GFP).
| + | |
- | | + | |
- | * [[User:fgohr|Florian]] tested our OD/F device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F device (fluorescence) and platereader (fluorescence).
| + | |
- | | + | |
- | * [[User:Aschechtel|Anna]] and [[User:VeraA|Vera]] made SDS gels.
| + | |
- | | + | |
- | * [[User:User:StefanReinhold|Stefan]] inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)
| + | |
- | | + | |
- | == 20th ==
| + | |
- | | + | |
- | | + | |
- | == 22nd ==
| + | |
- | | + | |
- | * [[User:Nbailly|Nina]] poured several Pseudomonas-F agar plates with 0, 150 and 300 µg/L for the NEAnderLab school experiment. She also autoclaved 12 500 mL shake flasks, partly to be used for the school collaboration on Wednesday.
| + | |
- | | + | |
- | == 26th ==
| + | |
- | * [[User:Mosthege|Michael]] did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300 bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900 bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.
| + | |
- | | + | |
- | === Gradient PCR to test new primers ===
| + | |
- | [[User:fgohr|Florian]] and [[User:Mosthege|Michael]] did gradient PCR with these new primers:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! name !! sequence
| + | |
- | |-
| + | |
- | | G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC
| + | |
- | |-
| + | |
- | | G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG
| + | |
- | |-
| + | |
- | | K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG
| + | |
- | |-
| + | |
- | | I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG
| + | |
- | |}
| + | |
- | | + | |
- | Three PCRs with different primer combinations were run. In all of them the templates were K1319004 in pSB1C3, K1319008 in pSB1C3 and I746909 in pSB1C3.
| + | |
- | | + | |
- | The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:
| + | |
- | {| class="wikitable"
| + | |
- | ! primer_F !! primer_R !! template !! expected length !! best annealing temperature
| + | |
- | |-
| + | |
- | | G00100_Alternative || G00101_Alternative || K1319004 in pSB1C3 || 1057 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || G00101_Alternative || K1319008 in pSB1C3 || 1245 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || G00101_Alternative || I746909 in pSB1C3 || 1221 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || G00101_Alternative || water || --- || ???
| + | |
- | |}
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65 °C.|width=800px}}
| + | |
- | | + | |
- | The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:
| + | |
- | {| class="wikitable"
| + | |
- | ! primer_F !! primer_R !! template !! expected length !! best annealing temperature
| + | |
- | |-
| + | |
- | | G00100_Alternative || I746916_check_R || K1319004 in pSB1C3 || none || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || I746916_check_R || K1319008 in pSB1C3 || none || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || I746916_check_R || I746909 in pSB1C3 || 820 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || I746916_check_R || water || --- || ???
| + | |
- | |}
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65 °C. Apparently the K1319008 template contained I746916.|width=800px}}
| + | |
- | | + | |
- | The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:
| + | |
- | {| class="wikitable"
| + | |
- | ! primer_F !! primer_R !! template !! expected length !! best annealing temperature
| + | |
- | |-
| + | |
- | | G00100_Alternative || K1319004_check_R || K1319004 in pSB1C3 || 541 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || K1319004_check_R || K1319008 in pSB1C3 || 502 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || K1319004_check_R || I746909 in pSB1C3 || none || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || K1319004_check_R || water || --- || ???
| + | |
- | |}
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68.1 °C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}
| + | |
- | | + | |
- | The results of these three PCRs are:
| + | |
- | # The KAPA2G Fast ReadyMix worked well
| + | |
- | # all three primers work well at >65 °C annealing temperature
| + | |
- | # the K1319008 template was contained I746916 instead of the intended K1319004 ORF
| + | |
- | | + | |
- | It was concluded that a similar check PCR with 65 °C annealing temperature will be done on all plasmids and cryos of K1319008.
| + | |
- | | + | |
- | == 27th ==
| + | |
- | * First [[User:Mosthege|Michael]] transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10beta cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50 µL cells with the plasmid into 2x 25 µL. All 100 µL were plated for all construct/machine combinations.
| + | |
- | | + | |
- | * [[User:VeraA|Vera]] transformed several constructs into chemically competent BL21(DE3) cells.
| + | |
- | | + | |
- | * [[User:Pdemling|Philipp]] and [[User:Mosthege|Michael]] did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.
| + | |
- | | + | |
- | * [[User:VeraA|Vera]] also made check a PCR on galectin-constructs:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! label !! primer_F !! primer_R !! expected length !! result
| + | |
- | |-
| + | |
- | | Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???
| + | |
- | |-
| + | |
- | | Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???
| + | |
- | |-
| + | |
- | | Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???
| + | |
- | |-
| + | |
- | | Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???
| + | |
- | |-
| + | |
- | | Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???
| + | |
- | |-
| + | |
- | | Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???
| + | |
- | |-
| + | |
- | | pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???
| + | |
- | |-
| + | |
- | | K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???
| + | |
- | |}
| + | |
- | | + | |
- | == 28th ==
| + | |
- | * [[User:Mosthege|Michael]] made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then [[User:VerA|Vera]] ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.
| + | |
- | | + | |
- | == 29th ==
| + | |
- | | + | |
- | * [[User:Eshani.sood|Eshani]] made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. [[User:VeraA|Vera]] determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.
| + | |
- | | + | |
- | * [[User:Nbailly|Nina]] prepared 3 500 mL flasks with 30 mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28 °C and ~300 rpm. The cultures are supposed to be used to test our OD device.
| + | |
- | | + | |
- | == 30th ==
| + | |
- | | + | |
- | * Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3).
| + | |
- | | + | |
- | * A plasmid prep of K1319013 and K1319014 was run.
| + | |
- | | + | |
- | * A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10beta cells.
| + | |
- | | + | |
- | * pSB1C3 plasmid backbones were amplified via PCR and purified.
| + | |
- | | + | |
- | * Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated.
| + | |
- | | + | |
- | * A transformation of K1319010 and K1319010 in pSB1C3 was conducted.
| + | |
- | | + | |
- | * Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.
| + | |
- | | + | |
- | * The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.
| + | |
- | | + | |
- | = October =
| + | |
- | == 1st ==
| + | |
- | | + | |
- | == 2nd ==
| + | |
- | | + | |
- | * At 8:30, [[User:NBailly|Nina]] and [[User:AZimmermann|Arne]] did a plasmid prep of dublicate samples of K1319011 clone #1 and #6. [User:fgohr|Florian] measured the DNA yield, and the higher concentrated sample of clone #1 and #6, respectively, were sent in for sequencing.
| + | |
- | * [[User:NBailly|Nina]] made precultures and a master plate of 6 colonies of K3139008 in psB1C3 in NEB10beta cells that had been plated at 5:30 this morning.
| + | |
| | | |
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"> |
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | interlab study |
| + | <br/><br/> |
| + | construction of GFP-quencher-fusions |
| + | <br/><br/> |
| + | further devolopment of BioBricks |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"> |
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | working 24/7 |
| + | <br/><br/> |
| + | finalizing our project |
| + | <br/><br/> |
| + | Wiki |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| + | </ul></html> |
| + | </center> |
| | | |
| {{Team:Aachen/Footer}} | | {{Team:Aachen/Footer}} |