Team:Hong Kong HKUST/pneumosensor/results/module one

From 2014.igem.org

(Difference between revisions)
 
(10 intermediate revisions not shown)
Line 1: Line 1:
-
<html>
+
{{Team:Hong_Kong_HKUST/shell|
-
<head>
+
<html><head>
-
+
<style type="text/css">
-
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/anti-main.css&action=raw&ctype=text/css" type="text/css" >
+
td.content_cell{
-
<link rel="stylesheet" href="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/indexpage.css&action=raw&ctype=text/css" type="text/css" >
+
text-indent:0;
-
<script src="http://ajax.aspnetcdn.com/ajax/jQuery/jquery-1.11.1.min.js"></script>
+
}
-
<script src="https://2014.igem.org/wiki/index.php?title=Template:Team:Hong_Kong_HKUST/access-menu.js&action=raw&ctype=text/css"></script>
+
</style>
-
+
</head></html>
-
</head>
+
|
-
+
<html><body>
-
<body>
+
-
<nav role="navigation">
+
-
<ul class="access-menu">
+
-
<li><a href="#">Home</a></li>
+
-
<li>
+
-
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a>
+
-
<ul class="access-submenu">
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_one">Sensing</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_two">Expressing</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Parts</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/characterization">Characterization</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/results">Results</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/future_work">Future Work</a></li>
+
-
</ul>
+
-
</li>
+
-
<li>
+
-
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">Riboregulator</a>
+
-
<ul class="access-submenu">
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/CR_TA_Feature_Page">Feature Page</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts">Parts</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data">Data</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results">Results</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work">Future Work</a></li>
+
-
</ul>
+
-
</li>
+
-
<li>
+
-
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice">Human Practice</a>
+
-
<ul class="access-submenu">
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit">Start-up Kit</a></li>
+
-
<li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/handbook" >--Handbook</a></li>
+
-
<li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/report" >--Report</a></li>
+
-
<li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/database" >--Database</a></li>
+
-
<li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" >--Interview</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach">Outreach</a></li>
+
-
<li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/Workshop" >--Workshop</a></li>
+
-
<li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/talks" >--Talk</a></li>
+
-
<li class= "indent_list"><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/isf_academy" >--ISF Academy</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">Safety and Ethics</a></li>
+
-
</ul>
+
-
</li>
+
-
<li>
+
-
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team">Team</a>
+
-
<ul class="access-submenu">
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/members">Members</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/advisers">Advisers</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/instructors">Instructors</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/attribution">Attributions</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/acknowledgement">Acknowledgement</a></li>
+
-
<li><a href="https://igem.org/Team.cgi?year=2014">Official Team Profile</a></li>
+
-
</ul>
+
-
</li>
+
-
<li>
+
-
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab">Wetlab</a>
+
-
<ul class="access-submenu">
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/notebook">Notebook</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols">Protocols</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/safety">Safety</a></li>
+
-
</ul>
+
-
</li>
+
-
<li>
+
-
<a href="https://2014.igem.org/Team:Hong_Kong_HKUST/Achievements">Achievements</a>
+
-
<ul class="access-submenu">
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/medal_requirement">Medal Requirements</a></li>
+
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/deliverable">Deliverable</a></li>
+
-
</ul>
+
-
</li>
+
-
<li class="access_logo">
+
-
<a href="https://2014.igem.org/Main_Page"><img src= "https://static.igem.org/mediawiki/2014/5/55/Hkust_logo.gif"></a>
+
-
</li>
+
-
<li class="access_logo">
+
-
<a href="http://www.ust.hk/"><img src= "https://static.igem.org/mediawiki/igem.org/6/60/Igemlogo_300px.png"></a>
+
-
</li>
+
-
+
-
 
+
-
</ul>
+
-
</nav>
+
-
<!-- ================ do not touch any thing above this, dont even think about it =========================-->
+
-
+
-
+
-
+
<div id="content_container">
<div id="content_container">
<div class= "banner_area">
<div class= "banner_area">
Line 100: Line 17:
<div id="description_area">
<div id="description_area">
<h2>Pneumosensor Results</h2>
<h2>Pneumosensor Results</h2>
-
<p align="center" style= "font-size: 30px"> Detection Module </p>
+
<p style= "font-size: 30px; text-align:center">Detection Module</p>
</div>
</div>
Line 112: Line 29:
</div>
</div>
</td>
</td>
-
</tr>
+
</tr>
-
 
+
</table>
-
</table>
+
</div>
</div>
<!-- end of one row of content , two column-->
<!-- end of one row of content , two column-->
Line 124: Line 40:
<td class= "content_cell">
<td class= "content_cell">
<div class= "content_area_one_row">
<div class= "content_area_one_row">
-
<br>
+
<p>
<b>Tag protein</b>
<b>Tag protein</b>
-
We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in <i>comD</i> extraction primer.
+
<br>
-
<br>
+
We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in <i>comD</i> extraction primer.
-
Forward primer to extract <i>comD</i> to clone into PSB1C3:
+
<br>
-
TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG
+
<br><br>
-
<i>[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]</i>
+
Forward primer to extract <i>comD</i> to clone into pSB1C3:  
-
<br>
+
<br><br>
-
<br>
+
TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG
-
3’ primer to extract <i>comD</i> with engineered FLAG tag gene sequence:
+
<br>
-
GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT  
+
<i>[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]</i>
-
<i>[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]</i>
+
<br>
-
<br>
+
<br><br>
-
<br>
+
3’ primer to extract <i>comD</i> with engineered FLAG tag gene sequence:
-
<i>comE</i> was extracted from pKHS-<i>come</i> kindly sent to us by ??. Extraction was done using the following primers:
+
<br><br>
-
<br>
+
GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT  
-
Forward primer to extract <i>comE</i> to clone into pSB1C3:
+
<br>
-
TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG
+
<i>[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]</i>
-
<br>
+
<br>
-
<i>[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]</i>
+
<br>
-
<br>
+
<br><br>
-
Reverse primer to extract comE to clone into pSB1C3:
+
-
GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA
+
-
<br>
+
<i>comE</i> was extracted from pKHS-<i>come</i> kindly sent to us by Dr. Don Morrison (Université de Toulouse, UPS, Laboratoire de Microbiologie et Génétique Moléculaires). Extraction was done using the following primers:
-
<i>[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]</i>
+
<br>
-
<br>
+
<br><br>
-
<br>
+
Forward primer to extract <i>comE</i> to clone into pSB1C3:  
-
<i>come</i> contained an illegal SpeI site, so we designed primers for site-directed mutagenesis:
+
<br><br>
-
<br>
+
TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG
-
Mutagenesis forward primer:
+
<br>
-
CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC
+
<i>[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]</i>
-
<br>
+
<br>
-
<br>
+
<br><br>
-
Mutagenesis reverse primer:
+
Reverse primer to extract <i>comE</i> to clone into pSB1C3:
-
GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG
+
<br><br>
-
<br>
+
GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA
-
<br>
+
<br>
-
However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) <i>come</i> forward primer & mutagenesis reverse primer; (ii) <i>come</i> reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly.</p>
+
<i>[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]</i>
-
</div>
+
<br>
 +
<br>
 +
<br><br>
 +
 +
<i>comE</i> contained an illegal SpeI site, so we designed primers for site-directed mutagenesis:
 +
<br>
 +
<br><br>
 +
Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC
 +
<br>
 +
<br>
 +
Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG
 +
<br>
 +
<br><br>
 +
However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) <i>comE</i> forward primer & mutagenesis  
 +
reverse primer; (ii) <i>comE</i> reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly.</p>
 +
</div>
</td>
</td>
</tr>
</tr>
-
</div>
 
</table>
</table>
</div>
</div>
-
<!-- one row of content , two column one picture right-->
+
<!-- end of one row of content , two column-->
-
<!-- one row of content , two column one picture left-->
 
-
<div class='content_1'><h3>PCelA (BBa_ K1379002) and Phelicase (BBa_ K1379003) construct </h3>
 
-
<table class="content_table" align= "center" >
 
-
 
-
<tr class= "content_row">
 
-
<td class= "content_cell">
 
-
 
-
<div class= "content_area_one_row">
 
-
<div class="content_image">
 
-
 
-
</div>
 
-
<p>
 
-
Backbone pSB1C3 was used for PCelA and Phelicase construct. PCelA / Phelicase gene was fused with BBa_E0240, which contains a medium RBS (BBa_B0032), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this GFP generator is to indicate the functionality of PCelA and Phelicase in the presence and absence of ComX protein. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E.coli used is DH10B.
 
-
 
-
<Br><br>
 
-
<b><u>PCelA / Phelicase gene</u></b><br>
 
-
PCelA and Phelicase gene was cloned from the genomic DNA of E.Coli strain NCTC7465 by PCR using Vent Polymerase. The difference between these two promoters is the whole sequence of Phelicase was obtained from Wellcome Trust Sanger Institute, a British genomics and genetics research institute. (https://www.sanger.ac.uk/)
 
-
 
-
<br><br>
 
-
PcelA Forward primer: TTTCTGTCTAGAGTTGACCAAGGAAGACTATTTTGC<br><br>
 
-
PcelA Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAATTTTCTCCTCTCTTAGATTATTCGTAAGAGG<br><br>
 
-
Phelicase Forward primer: TTTCTGTCTAGAGTGGACTTGGCCGTCCTCT<br><br>
 
-
Phelicase Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAGACGTTCTTCTTCTGTTAATTCATTCTCAG<br><br>
 
-
 
-
</p>
 
-
 
-
</td>
 
-
 
-
 
-
</tr>
 
</div>
</div>
-
</table>
 
</div>
</div>
-
 
-
 
-
 
-
 
-
<!-- one row of content , two column one picture left-->
 
-
<div class='content_1'><h3>Assembly and Characterization </h3>
 
-
<table class="content_table" align= "center" >
 
-
 
-
<tr class= "content_row">
 
-
<td class= "content_cell">
 
-
 
-
<div class= "content_area_one_row">
 
-
<div class="content_image">
 
-
 
-
</div>
 
-
<p><b><u>Assembly</b></u>
 
-
<i>comX</i> and <i>comW</i> construct contain 3 parts that needs to be assembled: K880005 which contains constitutive promoter and RBS, <i>comX</i> engineered with C-myc tag / comW engineered with FLAG tag, and a double terminator in pSB1C3 backbone. Promoter, RBS, <i>comX</i> engineered with C-myc tag, and double terminator were combined using traditional digestion and ligation method. The ligation product was confirmed by digestion check and sequencing. <br><br>
 
-
Combox construct also contains 3 parts that need to be assembled: PcelA/Phelicase promoter, BBa_E0240 which contains RBS, GFP and double terminator, and pSB1C3 backbone. All three parts were combined using traditional digestion and ligation method. The final ligation product was confirmed by digestion check and sequencing.
 
-
 
-
 
-
<Br><br>
 
-
<b><u>Characterization</u></b><br>
 
-
RPU (Relative promoter unit) and leakage will be measured as a characterization of 100 base pairs combox promoter (PcelA), and 160 base pairs combox promoter (Phelicase). For combox promoter characterization, ComX generator construct which contain K880005, <i>comX</i> gene, and B0015, is ligated with PcelA / Phelicase construct which contain combox promoter and GFP generator. In order to characterize the two combox promoters, ComX generator-combox construct was migrated from pSB1C3 to pSB3K3. RPU are measured with J23100 Andersen family promoter as a reference promoter.
 
-
 
-
</p>
 
-
 
-
</td>
 
-
 
-
 
-
</tr>
 
-
</div>
 
-
</table>
 
-
</div>
 
-
 
-
 
-
 
-
 
-
 
-
 
-
<!-- end of one row of content , two column one picture left-->
 
-
 
-
<hr>
 
-
</div>
 
-
<table class= "site_map_table" align= "center">
 
-
<tr>
 
-
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST">Home</a></h4>
 
-
<ul class= 'site_list'>
 
-
<li class='site_link'><a href="">Pneumosensor</a></li>
 
-
<li class='site_link'><a href="">Riboregulator</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice">Human Practice</a></li>
 
-
<li class='site_link'><a href="">Team</a></li>
 
-
<li class='site_link'><a href="">WetLab</a></li>
 
-
<li class='site_link'><a href="">Achievements</a></li>
 
-
</ul>
 
-
 
-
</td>
 
-
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor">Pneumosensor</a></h4>
 
-
<ul class= 'site_list'>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_one">Sensing</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/module_two">Expressing</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/parts">Parts</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/data">Data</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/characterization">Characterization</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/results">Results</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/pneumosensor/future_work">Future Work</a></li>
 
-
</ul>
 
-
</td>
 
-
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator">Riboregulator</a></h4>
 
-
<ul class= 'site_list'>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/CR_TA_Feature_Page">Feature Page</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/RNA_devices_catalog">Catalog Page</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/parts">Parts</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/data">Data</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/characterization">Characterization</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/results">Results</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/riboregulator/future_work">Future Work</a></li>
 
-
</ul>
 
-
</td>
 
-
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice">Human Practice</a></h4>
 
-
<ul class= 'site_list'>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit">Start-up Kit</a>
 
-
<ul>
 
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/handbook" >--Handbook</a></li>
 
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/report" >--Report</a></li>
 
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/database" >--Database</a></li>
 
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/start-up_kit/interview" >--Interview</a></li>
 
-
</ul>
 
-
</li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach">Outreach</a>
 
-
<ul>
 
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/Workshop" >--Workshop</a></li>
 
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/talks" >--Talk</a></li>
 
-
<li><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/outreach/isf_academy" >--ISF Academy</a></li>
 
-
</ul>
 
-
</li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/human_practice/safety_and_ethics">Safety and Ethics</a></li>
 
-
</ul>
 
-
</td>
 
-
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team">Team</a></h4>
 
-
<ul class= 'site_list'>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/members">Members</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/advisers">Advisers</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/instructors">Instructors</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/attribution">Attributions</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/team/acknowledgement">Acknowledgement</a></li>
 
-
<li class='site_link'><a href="https://igem.org/Team.cgi?year=2014">Official Team Profile</a></li>
 
-
</ul>
 
-
</td>
 
-
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab">WetLab</a></h4>
 
-
<ul class= 'site_list'>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/notebook">Notebook</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/protocols">Protocols</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/wetlab/safety">Safety</a></li>
 
-
</ul>
 
-
</td>
 
-
<td class= 'site_map_column'><h4><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/Achievements">Achievement</a></h4>
 
-
<ul class= 'site_list'>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/medal_requirement">Medal Requirements</a></li>
 
-
<li class='site_link'><a href="https://2014.igem.org/Team:Hong_Kong_HKUST/acheivement/deliverable">Deliverable</a></li>
 
-
</ul>
 
-
</td>
 
-
 
-
</tr>
 
-
 
-
</table>
 
-
</div>
 
-
 
-
 
</body>
</body>
</html>
</html>
 +
}}

Latest revision as of 09:29, 12 October 2014




Pneumosensor Results

Detection Module

Overview

The two-component regulatory system in S. pneumoniae, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the autoinducer molecule, competence-stimulating peptide (CSP) and so detect S. pneumoniae populations correspondingly.

Construct

Tag protein
We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in comD extraction primer.


Forward primer to extract comD to clone into pSB1C3:

TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG
[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]


3’ primer to extract comD with engineered FLAG tag gene sequence:

GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT
[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]



comE was extracted from pKHS-come kindly sent to us by Dr. Don Morrison (Université de Toulouse, UPS, Laboratoire de Microbiologie et Génétique Moléculaires). Extraction was done using the following primers:


Forward primer to extract comE to clone into pSB1C3:

TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG
[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]


Reverse primer to extract comE to clone into pSB1C3:

GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA
[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]



comE contained an illegal SpeI site, so we designed primers for site-directed mutagenesis:


Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC

Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG


However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) comE forward primer & mutagenesis reverse primer; (ii) comE reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly.

Home

Pneumosensor

Riboregulator

Human Practice

Team

WetLab

Achievement