Team:Hong Kong HKUST/pneumosensor/results/module two

The activity of Com-Box promoter is turned on by a specific sigma factor that is produced by a regulatory gene comX. The sσ^x will bind to the Com-Box promoter region and activate gene expression. σ^x serve as an inducer with high specificity as it binds to an area of several specific base pairs on the Com-Box promoter. This σ^x-Com-Box system could be used as a highly specific reporting system in our S.pneumonia detection platform. However in nature, ComX protein will be degraded by clpXP enzyme which exists in E. coli and some other bacteria. Hence, to ensure the induction of Com-Box promoter by σ^x, ComW protein is needed as it functions to protect σ^x from being degraded by clpXP. ComW protein will be degraded instead, increasing the amount of σ^x produced.

Construct
The three main components of the construct are comX gene, comW gene, and Com-Box promoter. We assembled comX and Com-Box promoter in one vector plasmid, while comW in a different plasmid. The system will be fused with a tagging protein and a reporting protein. Tagging protein is essential for detecting the σ^x and ComW protein expression by means of western blot. Reporting protein which is fluorescence protein is needed for reporting purpose, hence σ^x-Com-Box system could serve as a specific reporting system that will be useful for many synthetic constructs. σ^x and Com-Box promoter construct will be assembled separately in different plasmid before being combined into one plasmid.

Backbone pSB1C3 was used for σ^x generator construct and comW construct. comX gene / comW gene were fused with BBa_K880005 which contains a constitutive promoter (J23100) and strong RBS (B0034). The purpose of this strong constitutive promoter and strong RBS is to unsure the large production of σ^x and ComW protein throughout time. Then, a double terminator (BBa_B0015) is fused with the promoter, RBS, and comX. BBa_K880005 and BBa_B0015 were obtained from 2014 iGEM distribution kit.

Construct using pSB1C3 backbone with only comX gene (BBa_K1379004), with comX gene and BBa_B0015 double terminator (BBa_K1379045) were also built.

Bacterial Strain
The bacterial strain of E. coli used is DH10B. Since this strain of E. coli has clpXP degradation enzyme which targets ComX for degradation, an excess amount of ComX protein is required to maintain enough amount of ComX for Com-Box promoter induction.

comX and comW gene
comX gene and comW gene were cloned from NCTC 7465 S.pneumoniae strain genomic DNA by PCR using Vent Polymerase.

ComX Tag Protein
We engineered a C-myc protein tag in the 3’ ends of comX by including the sequence in comX extraction primer.

3’ primer to extract comX with engineered C-myc tag gene sequence:

GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CAGATCCTCTTCTGAGATGAGTTTTTGTTC GTGGGTACGGATAGTAAACTCCTTAAACAC

[6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [30’ C-myc protein] [30' reverse complementary of 3’ comX]

ComW Tag Protein
We engineered a FLAG protein tag in the 3’ ends of comW by including the sequence in comW extraction primer.

3’ primer to extract comW with engineered FLAG tag gene sequence:

GCCGGA CTGCAGCGGCCGCTACTAGTA TTATTA CTTGTCGTCATCGTCTTTGTAGTC ACAAGAAATAAAACCCCGATTCATTACCAATT

[6’ Cap] [21’ SpeI and PstI restriction site] [6’ terminator sequence] [24’ FLAG protein] [32' reverse complementary of 3’ comW]

Backbone pSB1C3 was used for P_celA and P_comFA construct. P_celA / P_comFA gene was fused with BBa_E0240, which contains a medium RBS (BBa_B0034), GFP (BBa_E0040) and double terminator (BBa_B0015). The purpose of this GFP generator is to indicate the functionality of P_celA and P_comFA in the presence and absence of σ^x. BBa_E0240 was obtained from 2014 iGEM distribution kit. The bacterial strain of E.coli used is DH10B.

P_CelA / P_comFA gene
P_CelA and P_comFA gene were cloned from the genomic DNA of S.pneumoniae strain NCTC7465 by PCR using Vent Polymerase. The difference between these two promoters is the whole sequence of P_comFA was obtained from Wellcome Trust Sanger Institute, a British genomics and genetics research institute. (https://www.sanger.ac.uk/)

P_celA Forward primer: TTTCTGTCTAGAGTTGACCAAGGAAGACTATTTTGC

P_celA Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAATTTTCTCCTCTCTTAGATTATTCGTAAGAGG

P_comFA Forward primer: TTTCTGTCTAGAGTGGACTTGGCCGTCCTCT

P_comFA Reverse primer: GCCGGACTGCAGCGGCCGCTACTAGTAGACGTTCTTCTTCTGTTAATTCATTCTCAG

Assembly
comX and comW construct contain 3 parts that need to be assembled: K880005 which contains constitutive promoter and RBS, comX engineered with C-myc tag / comW engineered with FLAG tag, and a double terminator in pSB1C3 backbone. Promoter, RBS, comX engineered with C-myc tag, and double terminator were combined using traditional digestion and ligation method. The ligation product was confirmed by digestion check and sequencing.

Com-Box construct also contains 3 parts that need to be assembled: P_celA/P_comFA promoter, BBa_E0240 which contains RBS, GFP and double terminator, and pSB1C3 backbone. All three parts were combined using traditional digestion and ligation method. The final ligation product was confirmed by digestion check and sequencing.

Characterization
RPU (Relative promoter unit) and leakage will be measured as a characterization of 100 base pairs Com-Box promoter (P_celA), and 160 base pairs Com-Box promoter (P_comFA). For Com-Box promoter characterization, σ^x generator construct which contains BBa_K880005, comX gene, and B0015, is ligated with P_celA / P_comFA construct containing Com-Box promoter and GFP generator. In order to characterize the two Com-Box promoters, σ^x generator-Com-Box construct was migrated from pSB1C3 to pSB3K3. RPU are measured with BBa_J23101 Andersen family promoter as a reference promoter.