"
Team:Bielefeld-CeBiTec/Results/CO2-fixation/Calvin-Cycle
From 2014.igem.org
(Difference between revisions)
| Line 103: | Line 103: | ||
<div class="content" style="font-size:17px"> | <div class="content" style="font-size:17px"> | ||
<p> | <p> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
For the characterization of the sedoheptulose 1,7-bisphosphatase (SBPase / glpX) we did an enzyme assay with a His-Tag purification as described before (Stolzenberger et al., 2013).<br> | For the characterization of the sedoheptulose 1,7-bisphosphatase (SBPase / glpX) we did an enzyme assay with a His-Tag purification as described before (Stolzenberger et al., 2013).<br> | ||
The proteins were overexpressed by adding 1 mM IPTG for the T7 promotor. The increasing amount of protein could be verified through a SDS gel.<br> | The proteins were overexpressed by adding 1 mM IPTG for the T7 promotor. The increasing amount of protein could be verified through a SDS gel.<br> | ||
| + | </div> | ||
| + | </div> | ||
<center>[Picture 3]</center><br> | <center>[Picture 3]</center><br> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
We purified the transketolase (tkt) and the fructose bisphosphate aldolase (fba) as well as the sedoheptulose 1,7-bisphosphatase with the His-Tag mediated purification system.<br> | We purified the transketolase (tkt) and the fructose bisphosphate aldolase (fba) as well as the sedoheptulose 1,7-bisphosphatase with the His-Tag mediated purification system.<br> | ||
| + | </div> | ||
| + | </div> | ||
<center>[Picture 4]</center><br> | <center>[Picture 4]</center><br> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
For the purified enzymes we did a Bradford assay. | For the purified enzymes we did a Bradford assay. | ||
| + | </div> | ||
| + | </div> | ||
<center> | <center> | ||
<div class="element" style="margin:10px; padding:10px; text-align:center; width:450px"> | <div class="element" style="margin:10px; padding:10px; text-align:center; width:450px"> | ||
| Line 114: | Line 126: | ||
</div> | </div> | ||
</center> | </center> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
After the purification we performed an enzyme assay as shown below.<br> | After the purification we performed an enzyme assay as shown below.<br> | ||
| + | </div> | ||
| + | </div> | ||
<center>[Picture 5]</center><br> | <center>[Picture 5]</center><br> | ||
| - | + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | |
| + | <div id="text"> | ||
With HPLC...<br> | With HPLC...<br> | ||
We decided to use glpX as a target for amplification and transformation because of the shown acitivity. The finished construct of ptac_glpX in pSB1C3 was cultivated in M9 glucose in comparison to the wildtype. We performed two biological replicates and two technical replicates. | We decided to use glpX as a target for amplification and transformation because of the shown acitivity. The finished construct of ptac_glpX in pSB1C3 was cultivated in M9 glucose in comparison to the wildtype. We performed two biological replicates and two technical replicates. | ||
| + | </div> | ||
| + | </div> | ||
<center> | <center> | ||
<div class="element" style="margin:10px; padding:10px; text-align:center; width:900px"> | <div class="element" style="margin:10px; padding:10px; text-align:center; width:900px"> | ||
| Line 125: | Line 144: | ||
</div> | </div> | ||
</center> | </center> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
The cultivation shows that the modified strain has a longer lag phase before the entrance in exponential phase. Two hours after IPTG induction of the strain results in a decrease of growth in comparison to the uninduced strain. Entering the stationary phase takes place one hour before the induced strain. The induced strain also shows a higher OD. By inducing the SBPase in <i>E. coli</i> the substances for glycolysis is deflected in other pathways. These reactions are reversible which means that the glucose of the M9 medium is not metabolized in another pathway. This time shifted use of glucose results in a higher OD in two biological replicates.<br> | The cultivation shows that the modified strain has a longer lag phase before the entrance in exponential phase. Two hours after IPTG induction of the strain results in a decrease of growth in comparison to the uninduced strain. Entering the stationary phase takes place one hour before the induced strain. The induced strain also shows a higher OD. By inducing the SBPase in <i>E. coli</i> the substances for glycolysis is deflected in other pathways. These reactions are reversible which means that the glucose of the M9 medium is not metabolized in another pathway. This time shifted use of glucose results in a higher OD in two biological replicates.<br> | ||
This result shows that the SBPase does not limit the growth maximum of <i>E. coli</i>. | This result shows that the SBPase does not limit the growth maximum of <i>E. coli</i>. | ||
| + | </div> | ||
| + | </div> | ||
<br> | <br> | ||
| Line 176: | Line 199: | ||
</div> | </div> | ||
<div class="content" style="font-size:17px"> | <div class="content" style="font-size:17px"> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
<p>For the purpose of characterizing our BioBricks we thought of using enzyme assays to verify the functionality of different proteins. Enzyme assays depend on purified enzymes. A typical purification approach is the His-Tag mediated purification system. The disadvantage of this system is that the tag remains attached at the enzyme after the purification and has to be cleaved afterwards. A further development of this system is the intein tag mediated purification.<br> | <p>For the purpose of characterizing our BioBricks we thought of using enzyme assays to verify the functionality of different proteins. Enzyme assays depend on purified enzymes. A typical purification approach is the His-Tag mediated purification system. The disadvantage of this system is that the tag remains attached at the enzyme after the purification and has to be cleaved afterwards. A further development of this system is the intein tag mediated purification.<br> | ||
By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification can be achieved. The chitin binding domain binds the column on which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows to cut the attachment of the intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column.<br> | By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification can be achieved. The chitin binding domain binds the column on which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows to cut the attachment of the intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column.<br> | ||
| + | </div> | ||
| + | </div> | ||
<center>[Picture 1]</center><br> | <center>[Picture 1]</center><br> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
We implemented this system in the pSB1C3 backbone by combining the T7 promotor with RBS and intein tag with chitin binding domain.<br> | We implemented this system in the pSB1C3 backbone by combining the T7 promotor with RBS and intein tag with chitin binding domain.<br> | ||
| + | </div> | ||
| + | </div> | ||
<center>[Picture 2]</center><br> | <center>[Picture 2]</center><br> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
By designing gibson assembly primers with following overhangs it is possible to add a coding sequence between the first and the second part of the purification vector (add the gene specific part behind the overhang with the right orientation):<br> | By designing gibson assembly primers with following overhangs it is possible to add a coding sequence between the first and the second part of the purification vector (add the gene specific part behind the overhang with the right orientation):<br> | ||
| + | </div> | ||
| + | </div> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
| + | <center> | ||
>GSP_fw<br> | >GSP_fw<br> | ||
CTATAGGGAAAGAGGAGAAAT<br> | CTATAGGGAAAGAGGAGAAAT<br> | ||
| Line 188: | Line 226: | ||
<br> | <br> | ||
Note: The stop codon of the coding sequence has to be deleted through primer design.<br> | Note: The stop codon of the coding sequence has to be deleted through primer design.<br> | ||
| - | < | + | </center> |
| + | </div> | ||
| + | </div> | ||
| + | <div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px"> | ||
| + | <div id="text"> | ||
It may be possible to redesign the pSB1C3 backbone to the purification vector by including the T7 and RBS as well as the intein tag with chitin binding domain into the backbone. The restriction sites for BioBrick assembly may be placed in between both patterns. This would allow an in frame addition of the coding sequence by using BioBrick assembly (Note again: The stop codon has to be deleted during the amplification of the coding sequence).<br> | It may be possible to redesign the pSB1C3 backbone to the purification vector by including the T7 and RBS as well as the intein tag with chitin binding domain into the backbone. The restriction sites for BioBrick assembly may be placed in between both patterns. This would allow an in frame addition of the coding sequence by using BioBrick assembly (Note again: The stop codon has to be deleted during the amplification of the coding sequence).<br> | ||
Because of problems during the transformation of the coding sequences we were not able to characterize this BioBrick.</p> | Because of problems during the transformation of the coding sequences we were not able to characterize this BioBrick.</p> | ||
| + | </div> | ||
| + | </div> | ||
</div> | </div> | ||
</div> | </div> | ||
</div> | </div> | ||
</div> | </div> | ||
Revision as of 17:07, 8 October 2014
CO2 fixation
Theory
For the characterization of the sedoheptulose 1,7-bisphosphatase (SBPase / glpX) we did an enzyme assay with a His-Tag purification as described before (Stolzenberger et al., 2013).
The proteins were overexpressed by adding 1 mM IPTG for the T7 promotor. The increasing amount of protein could be verified through a SDS gel.
The proteins were overexpressed by adding 1 mM IPTG for the T7 promotor. The increasing amount of protein could be verified through a SDS gel.
We purified the transketolase (tkt) and the fructose bisphosphate aldolase (fba) as well as the sedoheptulose 1,7-bisphosphatase with the His-Tag mediated purification system.
For the purified enzymes we did a Bradford assay.
After the purification we performed an enzyme assay as shown below.
With HPLC...
We decided to use glpX as a target for amplification and transformation because of the shown acitivity. The finished construct of ptac_glpX in pSB1C3 was cultivated in M9 glucose in comparison to the wildtype. We performed two biological replicates and two technical replicates.
We decided to use glpX as a target for amplification and transformation because of the shown acitivity. The finished construct of ptac_glpX in pSB1C3 was cultivated in M9 glucose in comparison to the wildtype. We performed two biological replicates and two technical replicates.
The cultivation shows that the modified strain has a longer lag phase before the entrance in exponential phase. Two hours after IPTG induction of the strain results in a decrease of growth in comparison to the uninduced strain. Entering the stationary phase takes place one hour before the induced strain. The induced strain also shows a higher OD. By inducing the SBPase in E. coli the substances for glycolysis is deflected in other pathways. These reactions are reversible which means that the glucose of the M9 medium is not metabolized in another pathway. This time shifted use of glucose results in a higher OD in two biological replicates.
This result shows that the SBPase does not limit the growth maximum of E. coli.
This result shows that the SBPase does not limit the growth maximum of E. coli.
References
- Stolzenberger et al., 2013. Characterization of Fructose 1,6-Bisphosphatase and Sedoheptulose 1,7-Bisphosphatase from the Facultative Ribulose Monophosphate Cycle Methylotroph Bacillus methanolicus. Journal of Bacteriology, Vol. 195, pp. 5112-5122
For the purpose of characterizing our BioBricks we thought of using enzyme assays to verify the functionality of different proteins. Enzyme assays depend on purified enzymes. A typical purification approach is the His-Tag mediated purification system. The disadvantage of this system is that the tag remains attached at the enzyme after the purification and has to be cleaved afterwards. A further development of this system is the intein tag mediated purification.
By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification can be achieved. The chitin binding domain binds the column on which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows to cut the attachment of the intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column.
We implemented this system in the pSB1C3 backbone by combining the T7 promotor with RBS and intein tag with chitin binding domain.
By designing gibson assembly primers with following overhangs it is possible to add a coding sequence between the first and the second part of the purification vector (add the gene specific part behind the overhang with the right orientation):
CTATAGGGAAAGAGGAGAAAT
>GSP_rev
CTAGTGCATCTCCCGTGATGCA
Note: The stop codon of the coding sequence has to be deleted through primer design.
It may be possible to redesign the pSB1C3 backbone to the purification vector by including the T7 and RBS as well as the intein tag with chitin binding domain into the backbone. The restriction sites for BioBrick assembly may be placed in between both patterns. This would allow an in frame addition of the coding sequence by using BioBrick assembly (Note again: The stop codon has to be deleted during the amplification of the coding sequence).
Because of problems during the transformation of the coding sequences we were not able to characterize this BioBrick.
Because of problems during the transformation of the coding sequences we were not able to characterize this BioBrick.
