Team:Bielefeld-CeBiTec/Results/CO2-fixation

From 2014.igem.org

(Difference between revisions)
Line 45: Line 45:
-
 
-
<div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px">
 
-
  <div id="text">
 
-
        <div class="tab" id="Intein">
 
-
            <div class="show">
 
-
                <a href="#Intein">Intein tag mediated purification system</a>
 
-
            </div>
 
-
            <div class="hide">
 
-
                <a  style="font-size:24px" href="#"><h6>Intein tag mediated purification system</h6></a>
 
-
               
 
-
            </div>
 
-
            <div class="content" style="font-size:17px">
 
-
              <p>For the purpose of characterizing our BioBricks we thought of using enzyme assays to verify the functionality of different proteins. Enzyme assays depend on purified enzymes. A typical purification approach is the His-Tag mediated purification system. The disadvantage of this system is that the tag remains attached at the enzyme after the purification and has to be cleaved afterwards. A further development of this system is the intein tag mediated purification.<br>
 
-
By adding an intein tag attached to a chitin binding domain to the enzyme of interest a purification can be achieved. The chitin binding domain binds the column on which chitin beads are stored. After adding binding buffers and washing solutions an elution with DTT allows to cut the attachment of the intein tag to the coding sequence. The enzyme is eluted from the column and can be stored in the desired buffer. The chitin binding domain and intein tag can be eluted from the column afterwards to reuse the column.<br>
 
-
<center>[Picture 1]</center><br>
 
-
We implemented this system in the pSB1C3 backbone by combining the T7 promotor with RBS and intein tag with chitin binding domain.<br>
 
-
<center>[Picture 2]</center><br>
 
-
By designing gibson assembly primers with following overhangs it is possible to add a coding sequence between the first and the second part of the purification vector (add the gene specific part behind the overhang with the right orientation):<br>
 
-
&gt;GSP_fw<br>
 
-
CTATAGGGAAAGAGGAGAAAT<br>
 
-
&gt;GSP_rev<br>
 
-
CTAGTGCATCTCCCGTGATGCA<br>
 
-
<br>
 
-
Note: The stop codon of the coding sequence has to be deleted through primer design.<br>
 
-
<br>
 
-
It may be possible to redesign the pSB1C3 backbone to the purification vector by including the T7 and RBS as well as the intein tag with chitin binding domain into the backbone. The restriction sites for BioBrick assembly may be placed in between both patterns. This would allow an in frame addition of the coding sequence by using BioBrick assembly (Note again: The stop codon has to be deleted during the amplification of the coding sequence).<br>
 
-
Because of problems during the transformation of the coding sequences we were not able to characterize this BioBrick.</p>
 
-
            </div>
 
-
        </div>
 
-
  </div>
 
-
</div>
 
-
 
-
 
-
 
-
<div class="element" style="margin:10px 10px 10px 10px; padding:10px 10px 10px 10px">
 
-
  <div id="text">
 
-
        <div class="tab" id="SBPase">
 
-
            <div class="show">
 
-
                <a href="#SBPase">Sedoheptulose 1,7-bisphosphatase</a>
 
-
            </div>
 
-
            <div class="hide">
 
-
                <a  style="font-size:24px" href="#"><h6>Sedoheptulose 1,7-bisphosphatase</h6></a>
 
-
               
 
-
            </div>
 
-
            <div class="content" style="font-size:17px">
 
-
              <p>
 
-
For the characterization of the sedoheptulose 1,7-bisphosphatase (SBPase / glpX) we did an enzyme assay with a His-Tag purification as described before (Stolzenberger et al., 2013).<br>
 
-
The proteins were overexpressed by adding 1 mM IPTG for the T7 promotor. The increasing amount of protein could be verified through a SDS gel.<br>
 
-
<center>[Picture 3]</center><br>
 
-
We purified the transketolase (tkt) and the fructose bisphosphate aldolase (fba) as well as the sedoheptulose 1,7-bisphosphatase with the His-Tag mediated purification system.<br>
 
-
<center>[Picture 4]</center><br>
 
-
After the purification we performed an enzyme assay as shown below.<br>
 
-
<center>[Picture 5]</center><br>
 
-
              </p>
 
-
            </div>
 
-
        </div>
 
-
  </div>
 
-
</div>
 

Revision as of 00:00, 8 October 2014


CO2 fixation

Here you will find information about the execution of our experiments.