Team:Hong Kong HKUST/pneumosensor/results/module one
From 2014.igem.org
(Difference between revisions)
Line 129: | Line 129: | ||
We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in <i>comD</i> extraction primer. | We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in <i>comD</i> extraction primer. | ||
<br> | <br> | ||
- | Forward primer to extract <i>comD</i> to clone into | + | Forward primer to extract <i>comD</i> to clone into pSB1C3: |
+ | <br> | ||
+ | TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG | ||
<br> | <br> | ||
<i>[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]</i> | <i>[6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD]</i> | ||
<br> | <br> | ||
<br> | <br> | ||
- | 3’ primer to extract <i>comD</i> with engineered FLAG tag gene sequence: GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT | + | 3’ primer to extract <i>comD</i> with engineered FLAG tag gene sequence: |
+ | <br> | ||
+ | GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT | ||
<br> | <br> | ||
<i>[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]</i> | <i>[6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD]</i> | ||
Line 142: | Line 146: | ||
<i>comE</i> was extracted from pKHS-<i>come</i> kindly sent to us by ??. Extraction was done using the following primers: | <i>comE</i> was extracted from pKHS-<i>come</i> kindly sent to us by ??. Extraction was done using the following primers: | ||
<br> | <br> | ||
- | Forward primer to extract <i>comE</i> to clone into pSB1C3: TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG | + | Forward primer to extract <i>comE</i> to clone into pSB1C3: |
+ | <br> | ||
+ | TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG | ||
<br> | <br> | ||
<i>[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]</i> | <i>[6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE]</i> | ||
<br> | <br> | ||
- | Reverse primer to extract comE to clone into pSB1C3: GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA | + | <br> |
+ | Reverse primer to extract comE to clone into pSB1C3: | ||
+ | <br> | ||
+ | GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA | ||
<br> | <br> | ||
<i>[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]</i> | <i>[6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE]</i> | ||
Line 169: | Line 178: | ||
<!-- one row of content , two column one picture right--> | <!-- one row of content , two column one picture right--> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
<hr> | <hr> |
Revision as of 15:00, 5 October 2014
Pneumosensor Results
Detection Module
Overview
The two-component regulatory system in S. pneumoniae, consisting of the receptor ComD and its response regulator ComE was to be used in detecting the autoinducer molecule, competence-stimulating peptide (CSP) and so detect S. pneumoniae populations correspondingly. |
Construct
Tag protein We engineered in a FLAG protein tag in the 3’ end of ComD by including the sequence in comD extraction primer. Forward primer to extract comD to clone into pSB1C3: TCTGGAGAATTCGCGGCCGCTTCTAGATGGATTTATTTGGATTTGGGACGG [6’cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comD] 3’ primer to extract comD with engineered FLAG tag gene sequence: GCCGGACTGCAGCGGCCGCTACTAGTATTATTACTTGTCGTCATCGTCTTTGTAGTCTCATTCAAATTCCCTCTTAAATCTAATGAT [6’ cap][21’ RFC10 suffix][6’ reverse complement stop codon][25’ reverse complement FLAG protein ][30 reverse complement Streptoccocus pneumoniae/NCTC7465/comD] comE was extracted from pKHS-come kindly sent to us by ??. Extraction was done using the following primers: Forward primer to extract comE to clone into pSB1C3: TCTGGAGAATTCGCGGCCGCTTCTAGATGAAAGTTTTAATTTTAGAAGATG [6’ cap][20’ RFC10 prefix][25’ Streptoccocus pneumoniae/NCTC7465/comE] Reverse primer to extract comE to clone into pSB1C3: GCCGGACTGCAGCGGCCGCTACTAGTATCACTTTTGAGATTTTTTCTCTAA [6’ cap][21’ RFC10 suffix][24’reverse complement Streptoccocus pneumoniae/NCTC7465/comE] come contained an illegal SpeI site, so we designed primers for site-directed mutagenesis: Mutagenesis forward primer: CGCTATTATCGTCTTTATCACTAGCCGATCAGAGTTTGCGACTCTAAC Mutagenesis reverse primer: GTTAGAGTCGCAAACTCTGATCGGCTAGTGATAAAGACGATAATAGCG However, site-directed mutagenesis attempts were unsuccessful, so the gene was extracted in two parts using (i) come forward primer & mutagenesis reverse primer; (ii) come reverse primer & mutagenesis forward primer. The two fragments were then combined through Gibson Assembly. |
Home |
Pneumosensor |
Riboregulator |
Human Practice |
Team |
WetLab |
Achievement |