From 2014.igem.org

Brauer Notebook

Captains’ Log. iGEM 2014. Team NitroGENIUS. The Brauer Group.

Day 1. 6/2/2014 (Monday)

● Plan to do: design primers/plasmids

● Got done: started primer/plasmid design

Day 2. 6/3/2014 (Tuesday)

● Plan to do: Create and work on presentation

● Got done: Monsanto Presentation

Day 3. 6/4/2014 (Wednesday)

● Plan to do: Monsanto Visit

● Got done: Monsanto Visit

Day 4. 6/5/014 (Thursday)

● Plan to do: More plasmid editing/primer design. Edit website. Plan out video series.

● Got done: Finished pLight plasmid design and primers, sent to Cheryl for verification. Typed up brainstorming for video sessions, contacted WUTV about using equipment, contacted WashU Assembly Series director for permission to allow a Monsanto scientist to give a lecture during the Fall 2014 semester

Day 5. 6/6/2014 (Friday)

● Plan to do: Get iGEM safety forms filled out. Go over primer/plasmid design. Order primers. Get keys/access to Brauer Hall. Design a timeline for the summer.

● Got done: Finished design of plasmid PBJ001. Finished all (including sequencing) primer design. Take another look on Sunday, 6/8/2014.

Name	Primer
EYFP-> ColE1 _f	5’ tttttttgctcttcaaatGGGATAACGCAGGAAAGAAC 3’
EYFP-> ColE1 _r	5’ tttttttgctcttcagtgCTGAAGGCTGACAAAATCTATACTG 3’
Pcpcg2 -> Ptet_f	5’ tttttttgctcttcaTTCCCAGTCACGACGTTG 3’
Pcpcg2 -> Ptet_r	5’ tttttttgctcttcaTCGGTCAGTGCGTCCTG 3’
TetR_f	5’tttttttgctcttcaCACCTACAACAAAGCTCTCATC 3’
TetR_r	5’tttttttgctcttcagaaGGCTAGCTCAGTCCTAGGTACAG 3’
EYFP_f	5’ tttttttgctcttcaattCTTGTGCAATGTAACATCAGAG 3’
EYFP_r	5’ tttttttgctcttcacgaGTGGAATTGTGAGCGGATAAC 3’
Seq1_f	5’ ACAAATCCGCCGCCCTAG 3’
Seq1_r	5’ GACTTGAGCGTCGATTTTTGTG 3’
Seq2_f	5’ GGCTTTTTTACCGGCTAGTTTC 3’
Seq2_r	5’ GATTTTCTCCCCCTTTTCTTC 3’

Day 6. 6/9/2014 (Monday)

● Plan to do: Get iGEM safety forms filled out. Order primers. Get keys/access to Brauer Hall. Design a timeline for the summer. Complete lab safety forms for WashU. Design primers/plasmid map for positive/negative control.

● Got done: Ordered primers (should arrive by Wednesday at the latest). Got keys/access to Brauer Hall. Completed lab safety forms for WashU.

Day 7. 6/10/2014 (Tuesday)

● Plan to do: Finish design of pos/neg control plasmids. Print Brauer lab safety form. Finalize proposal and send to Penn State iGEM contact along with project presentation. Design light experiment.

● Got done: Designed primers for the positive and negative control plasmids. Printed safety form. Sent Penn State iGEM project info. PCR, ran visualization, and extracted pieces.

Name	Primer
PJT122_modNeg_minuslacZ1_Forward	GGTTTTCCCAGTCACGACG
PJT122_modNeg_minuslacZ1_Reverse	CTGGAGCCCGTCAGTATCG
PJT122_modNeg_minuscph8_2_Forward	GCAGGGCATGACAAAAGAAG
PJT122_modNeg_minuscph8_2_Reverse	CTGAGTTGTACGGTGGTGGC
PJT122_modNeg_seq_cph8_Foward	CAACGTGCCAACCAGTTTTAG
PJT122_modNeg_seq_cph8_Reverse	GAACGACCTACACCGAACTG
PJT122_modNeg_seq_lacZ_Forward	CAAAAACGCCGTCAATTTG
PJT122_modNeg_seq_lacZ_Reverse	GCTTTACACCGTTGATATTGC
pSL2264_EYFP_pos_Foward	tttttttgctcttcaCGTGGCTTTGTTGAATAAATC
pSL2264_EYFP_pos_Reverse	tttttttgctcttcatcaAGCGGATAACAATTTCACACATAC
pTetR100_pos_Forward	tttttttgctcttcaTGAGCTAGCACTGTACCTAGGAC
pTetR100_pos_Reverse	tttttttgctcttcaacgCTGAAGTGGCGGAACTGC
pTetEYFP03_seq_Forward	GGTCATGGTAAAGGCAATGG
pTetEYFP03_seq_Reverse	TATGGCAATGGCACAATTAGATG

Day 8. 6/11/2014 (Wednesday)

● Plan to do: Moon Lab Group meeting at 3PM. Work on finishing Gel DNA extraction, Dpn1, Purification, then One-Pot, then finally Transformation and plating (2 LB/cm plates). [Realization! We discovered today that in order for the ccaS/ccaR light system to function correctly, we need the PCC6803 genes ho1 and pcyA which are needed to heme into PCB (a chromophore) via a two step oxidation/reduction process. Ray is working on this aspect and we are planning to help/take over this part of his work. Our plan is to still transform plasmid PBJ and send it off for sequencing to make sure we have our designed plasmid. The next step would be to co-transform the two plasmids, one containing the ho1 and pcyA genes and the plasmid PBJ into E. coli and after sending off for sequencing, test the light promoter system. ]

● Got done: Finished Gel DNA extraction and measured concentration using nanoquant tecan. Did not need to do Dpn1 nor purification. Put in one-pot after 12 noon. Transformed and incubated O/N. PCR for Ray’s Biobrick plasmid for ho1 and pcyA parts.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
TetR	143.1	EYFP	128.4
Col A	12.3	Col B	5.8
Col D	12.9	Col E	2.8
G2 A	26.2	G2 B	26.2
G2 C	45.4	G2 D	26.6
G2 E	15.3	G2 F	77.7

Day 9. 6/12/2014 (Thursday)

● Plan to do: Gel extract, one-pot for Ray’s plasmid then transform and plate. pick PBJ002 colonies, start O/N liquid cultures. Work on negative and pos. control once primers arrive (check around noon). Also, grow a culture of Ray’s BbaP DNA (AmpR) as well as Cheryl’s pTet 100-T (where we get the TetR from)

Plan out seq PCR for PBJ002.

● Got done: Gel extract and one pot for Ray’s plasmid. Re-ran PCR for Rays BbaP (SpeC_AraC_Bba) plasmid. Gel extract on new BbaP part. Did not yield bands- only saw a smear. Received primers for neg and pos controls- mixed appropriate primer concentrations. Cheryl started pTet liquid culture. Started BbaP liquid cultures. Electroporated original Bbap. Plated on 2 specR plates (100 uL) and (the rest). put into incubator.

Planned out seq PCR for PBJ002.

Day 10. 6/3/2014 (Friday)

● Plan to do: meet at 9:15 in the ICARES to set up video conference with the Penn State.

1. PBJ002: Miniprep -> PCR with sequencing primers before ICARES meeting

miniprep pTet and BbaP we made liquid cultures for yesterday. miniprep this along with the PBJ miniprep.

2. pour gel for visual confirmation

...ICARES meeting… then...

3. take PCR product and run a gel (10 uL DNA, 2uL 6X dye) to check. 30 minutes.

Observe which PCR product in gel (which lane from tube) is of the right length.

~~Purify PCR product.~~

Send miniprepped plasmid ~~AND~~ ~~purified PCR~~ off for sequencing of PBJ002.

4. work on both the Positive and negative controls.

5. Pick colonies and start O/N culture for Spec_AraC_Bba.

● Got done: From the above mentioned steps: Steps 1- 5.

○ For the Pos and Neg controls, we did PCR -> nanoquant measure after purification step (reference pos/neg control step documents) TetR backbone not present. Re-run tomorrow.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
PBJ 02 #1	103.9	PBJ 02 #2	90.1
PBJ 03 #3	137.5	PBJ 02 #4	76.9
Ptet	60.4	BbaP	62.2
(-) lacZ #2	103.9	(-) lacZ #6	90.1
(-) lacZ #3	137.5	(-) lacZ #7	76.9
(-) lacZ #5	60.4	(-) lacZ #8	62.2
EYFP	34.6

Day 11. 6/14/2014 (Saturday)

● Plan to do:

○ Miniprep -> Visualize seq PCR product of Spec_AraC_Bba

■ could not run seq PCR on this because seq primers do not work. Re-design sequencing primers and order them.

○ Re-run PCR for TetR backbone. Failed yesterday.

○ ~~One pot Pos control~~

○ One pot Neg control

...Later...

○ Transform/plate neg control

○ ~~Transform/plate pos control~~

● Got done:

○ Miniprepped and measured concentration on SAB product.

■ Project SAB is on hold until primers arrive.

○ Re ran PCR on the TetR backbone.

○ sent new redesigned sequencing primers for SAB to Ray for ordering.

○ Gel Extraction/Recovery on TetR backbone PCR product

○ Dpn1 for TetR backbone

○ TetR purification and measurement= 4.4 ng/uL

■ Project Positive Control is on hold until we can re-evaluate the primers and find the error/form a new plan of approach.

■ Correction: re-did PCR for TetR backbone again. (was the reason we couldn’t get it to work before because we used the wrong plasmid?)

● gel only yielded bands indicating primers.

○ One pot Negative control (-) lacZ

○ Transform/plated Negative control (-) lacZ

Day 12. 6/15/2014 (Sunday)

● Plan to do:

○ TetR backbone for positive control run from PCR- >Transformation/Plating

○ Pick Neg Control colonies.

■ Start liquid cultures for O/N

● Got done:

○ (+) TetR backbone from TetR-100T miniprepped plasmid: PCR -> DNA purification

○ Picked Neg Control colonies.

■ Started liquid cultures for O/N

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
TetR Backbone A	148.4	E	75.9
B	123.5	F	76.7
C	109.1	G	78.0
D	29.3	H	74.3

Day 13. 6/16/2014 (Monday)

● Plan to do:

○ Negative control: freeze and miniprep -> Send to Medical School for sequencing

○ Positive control: One-pot -> Transform/plate

● Got done:

○ Freeze and miniprep negative control

○ Negative Control: Ran Sequencing PCR for (-) lacZ

■ Visualization gel (smear)

■ Rerun sequencing PCR with new settings- failure

Redux starting with DPN1 (-) lacZ #5

■ Purify

■ Nanoquant

■ Blunt end ligation

■ Transformation/Electroporation and plating on cm plates

○ Positive Control (EYFP + TetR backbone) Run One Pot

■ Transformed

■ plated 100uL, rest at 8:05pm

■ Incubate o/n

Day 14. 6/17/2014 (Tuesday)

● Plan to do: Pick both Positive and Negative Control colonies

○ Positive: kan antibiotic

○ Negative: cm antibiotic

■ no colonies seen as of 10 AM

■ colonies seen at 12 noon!

● Got done:

○ redesigned new PBJ003 plasmid map and designed/verified new sequencing primers. Sent them to Cheryl for verification. SAB primers have not yet arrived. Liquid cultures into the incubator by 9PM

Day 15. 6/18/14 (Wednesday) -Worldly Wednesday!

● Plan to do:

○ Get both Pos and Neg frozen and miniprepped -> send off for sequencing

■ concurrently with SAB?

○ Go to Worldy Wednesday Lunch hosted by Andrew Ng

○ Work on SAB?

● Got done:

○ Froze both Pos and Neg and miniprepped.

■ Pos process went to sequencing.

■ Negative control: start at seq PCR.

○ Ran SAB SeqPCR.

■ negative results

○ Benjamin Colony PCR negative control (- lacZ) from old plates

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
Pos #1	54.1	Neg #1	92.5
Pos #2	163.4	Neg #2	73.1
Pos #3	63.7	Neg #3	78.8
Pos #4	109.5	Neg #4	126.5

Day 16. 6/19/14 (Thursday)

● Plan to do:

● Got done:

○ Re-designed the SEQ primers for SAB.

○ CPCR for (-)lacZ

■ move on to (-)cph8

○ begin work on PBJ003

Name	Primer
TetR_forward_new	tttttttgctcttcacacTCTCTACTAGAGTCACACTGGCTC
EYFP_forward_new	tttttttgctcttcaattGGGAGCACTGTATTCACAGCGCTCCCtttaccggtctcaattcgcag
Spec2_Seq_For	CGAGATAACCGTTGGCCTC
AraC2_Seq_For	gttatccaataataactctgatagtgctag
Bba2_Seq_Rev	cacttcactgacaccctcatc

Day 17. 6/20/14 (Friday)

● Plan to do:

● Got done:

○ PCR and gel extracted correct EYFP

○ working on getting piece Ori PCR -> gel extract and setting up one-pot for PBJ003

○ (-) cph8 took all the way through DNA clean & concentrate and added wrong wash buffer

■ 5µl purified DNA remaining in -20 (inside cph8 box)

Day 18. 6/21/14 (Saturday)

● Plan to do:

● Got done:

○ Negative Control:DPN1, purify, nanoquant measure, blunt end ligation (BEL) and transform/plate on cm

○ PBJ003: PCR -> DNA Recover and Nanoquant measure. Digestion/Ligation (One-Pot) all pieces. Transformation/Plating on cm

Day 19. 6/22/14 (Sunday)

● Plan to do: Pick colonies start liquid colonies for -cph8, pbj003

● Got done: Pick colonies start liquid colonies for -cph8, pbj003

Day 20. 6/23/14 (Monday)

● Plan to do: Freeze, miniprep, sequencing pcr, visualization gel, send for sequencing

● Got done: negative control, pbj003: Freeze, miniprep, sequencing pcr, visualization gel, send for sequencing

○ SAB: Sequencing PCR, visualization gel

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
Neg #1	128	PBJ003 #1	146.3
Neg #2	81.2	PBJ003 #2	86.9
Neg #3	47.8	PBJ003 #3	69.4
Neg #4	50.7	PBJ003 #4	95.2

Day 21. 6/24/14 (Tuesday)

● Plan to do: design experimental methods and procedures, design around hybrid promoter, find lacI resistant strain

● Got done:

○ did modified SEQPCR on SAB and ran visualization gel- confirmed S and B present, A not present

○ Ran PCR on part AraC/p15a ( part A), extracted and DNA recovered along with nanoquant measurements.

○ S,A,B Digestion

○ S+A+B Ligation into SAB2

○ Transformation and Plating of SAB2 (failed)

Day 22. 6/25/14 (Worldly Wednesday)

● Plan to do: Transform SAB2 C and D. Check sequencing results for the negative control and PBJ003 if they come in today.

● Got done: Verfied sequences for some positive control #4, some PBJ003. Sent T2 and E4 of PBJ003 in for sequencing confirmation, send in (-) lacZ sequencing on (-)cph8 plasmid, transformed and plated SAB2 C and D. Design primers for hybrid promoter

Day 23. 6/26/14 (Thursday)

● Plan to do: Pick and grow colonies for liquid culture

● Got done: Grew liquid Colonies for SAB2. Work on website. Look up experimental procedures

Day 24. 6/27/14 (Friday)

● Plan to do: Freeze and miniprep SAB2; Sequencing PCR, Send for sequencing

● Got done: Freeze and miniprep SAB2; Sequencing PCR, PCR fail, will re run with a gradient. Verified completely PBJ003 #2, #4. (-) lacZ funky. Received primers for hybrid promoter

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
SAB #1	86.6	SAB #2	97.1
SAB #3	79.1	SAB #4	65.8

Day 25. 6/28/14 ( Saturday)

● Plan to do: Run Sequencing PCR (gradient) for SAB2C #2. Send out purified PCR product for Sequencing. Set up experimental procedures, write out experiment protocol.

● Got done: Ran sequencing PCR with a gradient for SAB2 C#2. Verified negative control completely finished.

Day 26. 6/29 /14 ( Sunday)

● Plan to do: Run SEQPCR (gradient) for SAB2C #2 and visualize.

● Got done: Ran SEQPCR for SAB2C #1. Same results on from 6/28/14. Redesigned primers for new plasmid (not using SAB anymore) called pHOP

Day 27. 6/30 /14 ( Monday)

● Plan to do:

● Got done: picked ice mix from Ray’s pSB1C3-BBa_M30109 frozen stock. Preparing for miniprep tomorrow morning (0800).

Day 28. 7/1 /14 ( Tuesday)

● Plan to do: Miniprep pSB1C3-BBa_M30109. Do a digestion and gel visualization step for pSB1C3-BBa_M30109 to see if its legit. Start PCR and steps for PBJ_Hybrid (PBJ003 + hybrid promoter)

● Got done: Saw nothing in the first digestion, could not re-run digestion due to no enzyme left. PCR, DPN1, Clean, BEL of PBJ_Hyb_001, transform, plate

Name	Primer
PBJ_hyb_for	5’ cattatacgagccggatgattaattgtcaa ttt CATTAAAAATGCGATCCTAAC 3’
PBJ_hyb_rev	5’ tgtggaattgtgagcggataacaatttcacaca ATGATAGATCCCGTCGTTTTAC 3’

PBJ_hyb_seq_for	5’ GCGACTTGATGCTCTTGATC 3’
PBJ_hyb_seq_rev	5’ CGAGGTCATATTCCAGTCG 3’

Day 29. 7/2/14 (Worldly Wednesday)

● Plan to do: make LB/cm plates (follow protocol), look at plated cultures and wrap when necessary. pHOP primers should arrive today so we can get started working on that

● Got done: Pulled plates (2) from incubator, wrapped them and put into 4 fridge. Picked colonies for PBJ_hyb_001. started pHOP procedures.

Day 30. 7/3/14 (Thursday)

● Plan to do: Miniprep -> send off for sequencing for PBJ_hyb_001. One pot then Transform and plate pHOP

● Got done: Miniprep-> visualize for PBJ_hyb_001. Plan on preparing for sequencing on Sunday. One pot, transformed and plated pHOP.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
PBJ_hyb E1	187.3	PBJ_hyb H1	204
PBJ_hyb E2	90	PBJ_hyb_H2	160.3

Day 31. 7/4/14 (Friday. ‘Murica.)

● Plan to do: Pick pHOP colonies and start liquid cultures with kan for O/N.

● Got done: Start liquid cultures

Day 32. 7/5/14 (Saturday)

● Plan to do: Freeze -> Run SEQPCR Gel on pHOP.

● Got done: pHOP gel bands are of the wrong length.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
pHOP 1	76.4	pHOP 3	157.9
pHOP 2	128	pHOP 4	164.8

Day 33. 7/6/14 (Sunday)

● Plan to do: Get sequencing ready for PBJ_hyb_001, re run pHOP SEQPCR

● Got done: Go sequencing ready for hybrid promoter. pHOP SEQPCR gel visualization not of correct length.

Day 34. 7/7/14 (Monday)

● Plan to do: One Pot enhanced pHOP2/ Colony PCR pHOP3

● Got done: Colony PCR for pHOP3 showed wrong bands. Enhanced One Pot for pHOP2, transformed, plated on LB/Kan

Day 35. 7/8/14 (Tuesday)

● Plan to do: Start Liquid culture for pHOP2

● Got done: Started Liquid culture for pHOP2, Colony PCR pHOP2, Verified Sequencing for PBJ_hyb_001 3F, ready to go.

Day 36. 7/9/14 (Wednesday)

● Plan to do: Sequencing pcr for pHOP2, send for sequencing

● Got done: Sequencing PCR failed, do a modified digest of BBa_M30109 using BSG1, failed. Work on degradation tag design (finished)

Day 37. 7/10/14 (Thursday)

● Plan to do: Get a protocol written for testing of PBJ_hyb_001 (light and dark)

● Got done: Protocol for testing written out. Started liquid cultures in light/dark

Day 38. 7/11/14 (Friday)

● Plan to do:

● Got done: Tested hybrid and PBJ003 without chromophore. designed primers for PBJ004 (with Ptet promoter Ptet-pp+ plasmid from Dr. Moon to control EYFP).

Name	Primer
PBJ003_F	atcagtgatagagatactgagcacatctcCGGATAACAATTTCACACATACTAGAG
PBJ003_R	agggatgtcaatctctatcactgatagggaGACGAAAGGTGATACCGCTC
SEQ004_F	GTGCCAAGGGAAAAACTAGTC
SEQ004_R	gaacttcagggtcagcttg

Day 39. 7/14/14 (Monday)

● Plan to do: Begin cloning for degradation tags on PBJ003 AND PBJ_hyb_001

● Got done: Started PCR for Degradation Tags as well as Ptet-pp (same as: Ptet-T*2) minus the TetR (as a control). Designed light-box.

Day 40. 7/15/14 (Tuesday)

● Plan to do: meet with Andrew to go over light-box ordering. Continue cloning projects.

● Got done: cloning project up to Purification after Dpn1- no DNA present so re-did from PCR. Design primers for pChrom.

Name	Primers
pChrom_seq_for	GTGCCACCTGACGTCTAAG
pChrom_seq_rev	GCTGACTTGACGGGACTC

Day 41. 7/16/14 (Wednesday)

● Plan to do: Keep cloning

● Got done: kept working on pet(-)tetR, PBJ003_DegTetR, and PB_hyb_001 DegTetR up to transformation and plating

Day 42. 7/17/14 (Thursday)

● Plan to do: Check on and wrap plates. Start liquid cultures for both degradation tags, ptet(-)tetR and biobrick part from shipped frozen stock.

● Got done: Checked plates, wrapped them around 10:20 AM. Started Liquid culture at 6pm.

Day 43. 7/18/14 (Friday)

● Plan to do: Miniprep, sequencing PCR degradation tags, ptet(-). Start cloning for pChrom: Miniprep Biobrick part, digestion & ligation alongside PFM109 & transform

● Got done: Sequencing PCR for degradation tags. ptet(-) doesnt look right. Only miniprepped biobrick part.

Piece	Concentration (ng/µl)	Piece2	Concentration (ng/µl)3
Hyb degradation 1	82.3	hyb deg 2	67.1
hyb deg 3	143.4	hyb deg 4	48
PBJ 003 1	153	PBJ 003 2	61.1
PBJ 003 3	612.5	PBJ 003 4	75.1
ptet (-) tetR 1	248.8	ptet (-) tetR 2	386.4
ptet (-) tetR 3	67.6	ptet (-) tetR 4	37.7
Bba_k1017726	86.2	pFM109	8.9

Day 44. 7/19/14 (Saturday)

● Plan to do: Sequencing grad PCR for ptet(-), Sequential Digestion for pFM109, Bba_K1017726 -> Gel Extract -> Ligation -> Transform & plate

● Got done: Digested with EcoR1, Digested with SpeI, Ligation; Sequencing PCR for ptet(-): piece size not as expected ran colony pcr- band length still indicates tetR present

Day 45. 7/20/14 (Sunday)

● Plan to do: Prep DegTag products PBJ003 and hybrid for Sequencing. Transform and Plate pChrom.

● Got done: Degradation Tag on TetR for both PBJ003 and hybrid are ready for sequencing. Transform and plate pChrom on lb/kanR plates. Put in 37 at 7:50pm

Day 46. 7/21/14 (Monday)

● Plan to do: send tags off for sequencing. Start ptet(-) tetR cloning steps. Start liquid cultures for Chromophore project.

● Got done: tags sent for sequencing. finished from PCR to dpn1 on ptet (-) tetR. colony pcr for chromophore failed. Redo ligation and transformation

Day 47. 7/22/14 (Tuesday)

● Plan to do: redo colony pcr for chromophore. Work on ptet(-)tetR positive control.

● Got done: kept working on ptet(-)tetR positive control- dpn1 and purify,transformed and plated. Not enough colonies for chromophore to colony pcr. Started liquid culture at night.

Day 48. 7/23/14 (Wednesday)

● Plan to do: Miniprep and sequencing pcr for chromophore. Check and wrap plates, start liquid cultures around 8 or 9.

● Got done: Miniprep and Sequencing PCR for chromophore. Prepped for sequencingstarted (-)tetR liquid cultures. worked on PCR seq for Degradation tags on PBJ003 and Phybrid. “need” to purify before sending pcr product.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
pChrom #1	142.2	pChrom #2	122.8
pChrom #3	112.8	pChrom #4	78.7

Day 49. 7/24/14 (Thursday)

● Plan to do: Purify PCR products. Miniprep and check sequencing pcr for (-)tetR. Send all for sequencing

● Got done: Purified PCR product for chrom and degradation tags. Prepped for sequencing. Miniprep and run sequencing PCR for (-)tetR (no bands)

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
(-) tetR 1	102	(-) tetR 2	129.6
(-) tetR 3	455.3	(-) tetR 4	906.4

Day 50. 7/25/14 (Friday)

● Plan to do: Gradient SEQPCR on (-)tetR, run a gel visualizatoin, prep for sequencing.

● Got done: Ran gradient on (-)tetR #3 and 4 with gel visualization, saw bands at wrong length. doing colony PCR tomorrow.

Day 51. 7/26/14 (Saturday)

● Plan to do: Brute Force Colony PCR (basically picking 32 colonies!). Freeze and Miniprep correct ones.

● Got done: Brute Force Colony PCR and gel visualization finished.

Day 52. 7/27/14 (Sunday)

● Plan to do: Start all cloning procedures by taking #4 of the degradation tags from hybrid and pBJ003. Prep for sequencing the miniprepped (-)tetR DNA samples (#9,12,15,16).

● Got done: Prep (-)tetR for sequencing. Start cloning PBJ004 and PBJ_hyb_002

Day 53. 7/28/14 (Monday)

● Plan to do: Digest Biobrick part to check for correct lengths… continue cloning of PBJ004 and PBJ_hyb_002 with the new ptet promoter insertion. Look more at LED grid coding.

● Got done: Digestion of biobrick part only showed a smear. Still send both miniprep and pcr product for sequencing

Day 54. 7/29/14 (Tuesday)

● Plan to do: Check plates in the morning, wrap. Start cloning for PBJ005 and Hybrid 003 which are PBJ003 and Hybrid001 plasmids that just have the new ptet promoter inserted. Start liquid cultures at night.

● Got done: plates checked and wrapped. Sanity check #2 for biobrick part, doing a double digestion. Started cloning of PBJ005 and Hybrid003. Liquid cultures started. Retransform003, order new sequencing primer, redo double digestion.

Day 55. 7/30/14 (Wednesday)

● Plan to do: Freeze, miniprep, send off for sequencing of PBJ004 and Hybrid002. Delete the CAC in the maps for PBJ003 with DegTagTetR and PBJ_hyb with DegTagTetR. Get iGEM calendar set up. Email Pakrasi and Moon about setting up final iGEM meeting

● Got done: Start Modeling of light promoter system. (-) tetR still no luck. Sequence verified pCHROM #1. Freeze miniprep, PBJ004, Hybrid 002. Start liquid cultures for PBJ005, Hybrid 003.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
PBJ004 #1	145.6	PBJ004 #2	165.4
PBJ004 #3	97.7	PBJ004 #4	122.3
Hybrid002 #1	80	Hybrid002 #2	436.8
Hybrid002 #3	102.4	Hybrid002 #4	117.5

Day 56. 7/31/14 (Thursday)

● Plan to do: Make LB/ (spec + cm) & (spec + kan) plates. Seq PCR for (-) tetR. Freeze miniprep PBJ005, Hybrid003. Send PBJ004, PBJ005, Hybrid 003, Hybrid 002, (-) tetR for sequencing. Design experimental protocol. Transform.

● Got done: Made plates. Miniprep PBJ005, hybrid 003. Sequencing PCR, gel visualization for PBJ005, hybrid003, (-) tetR. Gel visualize. Gradient PCR hybrid003, (-)tetR, visualize. Found Hybrid003 1E, 1F, (-)tetR wrong bands. Prep PBJ004, PBJ005, hybrid002 for sequencing. Transform/ plate pchrom + (pos/neg/pbj003,phybrid).

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
PBJ005 #1	145.6	PBJ005 #2	165.4
PBJ005 #3	97.7	PBJ005 #4	122.3
Hybrid003 #1	80	Hybrid003 #2	436.8
Hybrid003 #3	102.4	Hybrid003 #4	117.5

Day 57. 8/1/14 (Friday)

● Plan to do: Prep Hybrid003 for sequencing. Send all in before 9. Pick cotransformed colonies. Start liquid culture.

● Got done: Sent for sequencing. Colonies not growing well. Colony PCR pchrom3 (from 7/29/14). Work on modeling.

Day 58. 8/2/14 (Saturday)

● Plan to do: Check plates. Wrap. Start liquid cultures

● Got done: Wrap colony PCR plate. Transformants not growing. *** Realization, pCHROM has kan resistance, so using the wrong plates the whole time. Started liquid cultures for pCHROM3, pCHROM1.

Day 59. 8/3/14 (Sunday)

● Plan to do: Miniprep pCHROM3 and 1

● Got done: Freeze pCHROM3, Miniprep pCHROM3 and 1. Sequencing results for new Ptet bad

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
pChrom 1	157.5	pChrom3 #4	133.6
pChrom3 #5	102.6	pChrom3 #12	79.4
pChrom3 #13	91.5

Day 60. 8/4/14 (Monday)

● Plan to do: Make Kan/CM plates. Check Sequence for pCHROM3. Transform and plate for experiment

● Got done: Made plates. Sequence PCR #1 showed multiple bands. Sequence PCR #2 showed wrong bands. Started new Ptet stuff over again from PCR. Transformed and plate experimental stuff

Day 61. 8/5/14 (Tuesday)

● Plan to do: Wrap Plates. Miniprep PBJ003, PBJ_Hyb_001. Redo cloning for new Ptet plasmids. Start liquid cultures for experimentation. Work on presentation

● Got done: Wrap plates. Miniprep. Redo PBJ005

Day 62. 8/6/14 (Wednesday)

● Plan to do: Run experiment. Induce. Check data

● Got done: Lighted growth chamber in use at 30 degrees. Cheryl advise to abort util tomorrow… Work on presentation. Purify, Transform PBJ005 redo. Design PBJpos

Day 63. 8/7/14 (Thursday)

● Plan to do: Run experiment. Induce. Check data

● Got done: Ran experiment. Dilute to OD .1, grow for 2 hours, induction. Start PBJ005 liquid cultures, measure fluorescence. NO FLUORESCENCE. Plan out new positive control, knocking out CcaR/CcaS/Pcpcg2/tetR from PBJ003.

Name	Primer
PBJpos_F	GAGCGGTATCACCTTTCGTC
PBJpos_R	CCTCGAGCTTAGGACGTCG
SEQpos_F	GTTCTTTACGATGCCATTGG
SEQpos_R	CACCATCTAGTATTTCTCCTCTTTC

Day 64. 8/8/14 (Friday)

● Plan to do: Send PBJ005 for sequencing

● Got done: Froze, miniprep, Sequencing PCR. Send Purified Seq PCR product for sequencing. Jeffrey’s last day

Day 65. 8/11/14 (Monday)

● Plan to do: Start cloning for PBJpos

● Got done: PCR, visualize, DPN1, purify, Blunt end ligate. Transform PBJpos. Also Transform PSL2264

Day 66. 8/12/14 (Tuesday)

● Plan to do: Start liquid culture for PBJpos, PSL2264

● Got done: Wrapped plates. Checked sequence results for PBJ005=bad. Started liquid cultures for PBJpos

Day 67. 8/13/14 (Wednesday)

● Plan to do: Miniprep, send for sequencing, start liquid cultures for experimentation

● Got done: Miniprepped and sent PBJpos #1-#4 for sequencing. Started liquid cultures for pSL2264, PBJpos 1-4, current positive control and negative control for experimentation tomorrow.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
PBJpos #1	360.5	PBJpos #2	349.9
PBJpos #3	443.9	PBJpos #4	270.8

Day 68. 8/14/14 (Thursday)

● Plan to do: Run fluorescence tests for old and new positive controls. Sanity check for pSL2264

● Got done: pSL2264 not fluorescing as expected. PBJpos slightly better, Old positive control and negative control as expected. Induce pSL2264 with IPTG. Design new PBJ003 with deletion of competing TSS

Day 69. 8/15/14 (Friday)

● Plan to do: Design primers for new PBJ plasmids with modified RBS. Plan out fall semester work schedule.

● Got done: Design primers for new PBJ plasmids with modified RBS.

Day 70. 8/25/14 (Monday)

● Plan to do: Start cloning for PBJposrbs (new positive control with enhanced RBS) until transformation

● Got done: PCR, gel visualize, DPN1, Ligation, Transformation, Plating. Work on Protocol section for website.

Day 71. 8/26/14 (Tuesday)

● Plan to do: Start Liquid Culture

● Got done: Start liquid culture. Work on protocols.

Day 72. 8/27/14 (Wednesday)

● Plan to do: Miniprep. Run sequencing PCR, send for sequencing

● Got done: Miniprep. Run sequencing PCR, results bad. Rerun sequencing PCR with correct primers.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
PBJpos_rbs #1	166.3	PBJpos_rbs #2	165.2
PBJpos_rbs #3	107.9	PBJpos_rbs #4	271.5

Day 73. 8/28/14 (Thursday)

● Plan to do: Visualize sequencing PCR. PCR purify, prep for sequencing. Send

● Got done: visualize sequencing PCR. PCR purify, prep for sequencing. Work on title and abstract

Day 74. 8/29/14 (Friday)

● Plan to do: Send in for sequencing (morning). Make electrocompetent cells

● Got done: Send in for sequencing. Make electrocompetent cells. Work on title and abstract.

Day 75. 9/1/14 (Monday)

● Plan to do: Sequence verify PBJpos_RBS. Start liquid cultures for experimentation.

● Got done: Sequence verify PBJpos_RBS. Start liquid cultures for experimentation. Final safety forms due.!

Day 76. 9/2/14 (Tuesday)

● Plan to do: Test for Fluorescence of newest positive control.

● Got done: tested for fluorescence. Dilute to 0.1 grew an extra 6 hours, tested again. EYFP did not fluoresce as expected. Compard 5’ UTRs between different positive controls. redesign primers in order to change pTet from tabor to moon’s.

Name	Primer
PBJptet_F	tagagatactgagcacatctcCGGATAACAATTTCACACATACTAGAG
Pbjptet_R	tcactgatagggatgtcaatctctatcactgatagggaACGAAAGGTGATACCGCTCG
PBJpos_seq_F	Use PBJRBS seq_F
PBJpos_seq_R	Use PBJRBS seq_R
BbaMoonptet_F	Use PBJptet_F
BBaMoonptet_R	tcactgatagggatgtcaatctctatcactgatagggaAACTGCTTTCGGTTAGACTTC
BbaMoon_seq_f	AACCGGTAACAGTACAAATCC
BbaMoon_seq_r	Use PBJRBS seq_R

Day 77. 9/4/14 (Thursday)

● Plan to do: Start cloning once primers are received.

● Got done: Organize primers for assembly. Start cloning for swapping Ptet on positive controls.

Day 78. 9/5/14 (Friday)

● Plan to do: Take cloning through transformation

● Got done: Gel, Digestion, Purification, Ligation, Transformation

Day 79. 9/6/14 (Saturday)

● Plan to do: Start liquid cultues

● Got done: Wrapped plates in the morning. Start liquid cultures at night

Day 80. 9/7/14 (Sunday)

● Plan to do: Miniprep, Sequencing PCR, Prep for sequencing.

● Got done: Miniprep, Sequencing PCR, Prepare for sequencing and send off tomorrow morning.

Piece	Concentration (ng/µl)	Piece	Concentration (ng/µl)
PBJposmoon #1	82.9	PBJposmoon #2	179.4
PBJposmoon #3	91.1	PBJposmoon #4	50.5
Bbaposmoon #1	84.9	Bbaposmoon #2	180.3
Bbaposmoon #3	72.7	Bbaposmoon #4	28.5

Day 81. 9/10/14 (Wednesday)

● Plan to do: Check on sequences

● Got done: Verified sequence for Bba_pos_moon. Started liquid cultures for experimentation tomorrow. Start designing primers for biobricking.

Day 82. 9/11/14 (Thursday)

● Plan to do: Check for fluorescence of new pTet. Finish and clarify design of primers for biobricking.

● Got done: Bba_pos_moon fluoresces as expected!!!!! Designed primers to start biobricking. Sent for ordering.

Name	Primers
Bba_PBJ_f	gaattcgcggccgcttctagagAGCCCATTGTGCTTTTC
Bba_PBJ_r	ctgcagcggccgctactagtaGATTATTAGGACCCACTTTCAC
PBJ_seq_prefix_f	CCTATAAAAATAGGCGTATCAC
PBJ_seq_prefix_r	GCAAAAGTGAGTATGGTG
PBJ_seq_Suffix_f	CTTTGAGTGAGCTGATACC
PBJ_seq_Suffix_r	GATTAACAGCGCATTAGAG
Bba_pos_f	gaattcgcggccgcttctagagGAAGTCTAACCGAAAGCAG
Bba_pos_r	actagtaAGTAGAGAGCGTTCACCG
Bba_seq_prefix_f	Use PBJ_seq_prefix_f
Bba_seq_prefix_r	TGTTCTGCTGGTAGTGGTC
Bba_seq_suffix_f	Use PBJ_seq_suffix_f
Bba_seq_suffix_r	CACAAGCTGGAGTACAACTAC

Team:WashU StLouis/Notebook/Brauer

From 2014.igem.org

Brauer Log

Brauer Notebook

Special thanks to our 2014 Sponsors:

If you want to sponsor us, please contact us below!