"

From 2014.igem.org

Jessica's Notes

Protocols and Procedures in Lab Notebook, Eric's Notebook
TO-DO:
[ ] Chronicle attempts at alpha-inducible promoters cloning, link related tasks
[ ] link/update pictures, graphs, data (if possible/desirable)
[ ] add gel photos

---

WEEK i

---

Tuesday May 27, 2014

• Meet Kara, Derrick

• Go around lab

  Generally got set up for iGEM, lab work.

Wednesday May 28, 2014

• Meet Eric

I. PCR 13 alpha-inducible yeast promoters

• PRM2
  
• ASG7
  
• FUS2
  
• PCL2
  
• FUS3
  
• CLG1
  
• YDR124W
  
• HYM1
  
• PRM6
  
• PRM1
  
• ECM18
  
• PRM3
  
• SAG1
  

II. Transformation of E. coli with backbone plasmid

• Mach 1 cells with pHY4 plasmid
  

Thursday May 29, 2014

• Come in late due to dentist appointment

I. Gel Extraction of 5/28 PCR

Friday May 30, 2014

I. Mini-Prep E. coli cultures from 5/29 Transformation
       - Extract plasmid backbone

II. Backbone Digestion

---

WEEK ii

---

Monday June 2, 2014

• Ianto returns

  I. Ligation of pHY4 Backbone + promoters

  II. PCR unsuccessful/low-yield promoters from 5/28

  III. Gel Extract 6/02 Primers

  Promoter	Concentration
  FUS2	failed
  PCL2	84.35
  YDR124W	134.3
  PRM6	84.14
  ECM18	91.99
  PRM1	64.64

Tuesday June 3, 2014

I. PCR Yeast Promoters
       - redo of 5/28 PCR due to low yield

II. Gel Extraction of PCR

Wednesday June 4, 2014

I. Mini-prep Backbone DNA + promoter
       - transformation done previously

II. Digestion of plasmids in relation to 6/03 PCR (?)

Thursday June 5, 2014

I. Mini-prep Promoters from 6/02 PCR

II. Ligation of 6/03 Promoters

III. Transformation of E. coli with 6/05 Ligation DNA

IV. Transformation of Yeast with linearized promoters
       - YTS18 strain

Friday June 6, 2014

I. Colony PCR of 6/05 E. coli transformation

WEEK 1

---

Monday June 9, 2014

• First day of bootcamp
• Meet rest of iGEM: Eleanor, Sabrina, Robert, George, Jeffrey
• Sometime before here, decide to give up on FUS2 and FUS3

I. Mini-prep Colonies from 6/06 Colony PCR

II. Yeast Colony PCR of 6/05 Yeast Transformation

Tuesday June 10, 2014

I. Digestion of pHY4 + alpha promoter + GFP

Wednesday June 11, 2014

I. PCR Purification of 6/10 digestion

Promoter	Concentration
PRM2	59.01
ASG7	89.23
PCL2	101.3
CLG1	93.58
YDR124W	127.5
HYM1	16.55
PRM6	400.0
PRM1	19.4
ECM18	118.7
PRM3	87.11
SAG1	179.2

II. Gibson Assembly of pHY4 + alpha promoter (I.) and rtTA inserts (made by Derrick 6/10)

III. Transformation of E. coli with Gibson Assembly (II.) {Attempt 1}
       - DH5alpha E. coli strain
       - 6/12 Results: failed. Use higher efficiency cells?

Thursday June 12, 2014

I. Seamless Cloning Assembly reaction of alpha promoter + rtTA

II. Transformation of E. coli with Seamless Cloning (I.) {Attempt 1.2}
       - Top 10 E. coli strain

Friday June 13, 2014

• did not come in - attending cousin's graduation
• NASA field trip

WEEK 2

---

Monday June 16, 2014

• Lab meeting
  
  • presentation on ongoing work

I. Colony PCR of 6/11 E. coli transformation

II. Yeast Colony PCR of 6/13 yeast transformations (done by ?)

Tuesday June 17, 2014

I. Colony PCR of failed yeast + alpha promoter + GFP from 6/16

II. Mini-prep of pHY4 + alpha promoter + rtTA E. coli successful colonies from 6/16 Colony PCR/ 6/11 Transformation

Promoter+rtTA	Concentration
ECM18 1	308.3
ECM18 2	231.6
PCL2 1	162.7
PCL2 2	247.3
PRM6 1	248.1
PRM6 2	327.9
ASG7 1	351.7
ASG7 2	593.5
HYM1 1	221.7
HYM1 2	413.0
PRM2 1	324.3
PRM2 2	339.6
PRM3 1	351.5
PRM3 2	316.7
CLG1 1	289.0
CLG1 2	276.8
YDR124W 1	366.0
YDR124W 2	239.3

       - sent to sequencing {Attempt 1}
       - 6/18 Results: failed

Wednesday June 18, 2014

I. Transformation of yeast with alpha promoter + GFP (from 5/30 I.)
       - yeast strains CB008 and CB008DB

II. Overnight cultures of yeast from (I.)

Thursday June 19, 2014

I. Culture colonies from 6/12 transformation (6/12 II.)

II. Glycerol stocks of successful yeast strains from 6/18 transformation

Friday June 20, 2014

I. Learned to use flow cytometer
       - Characterization of alpha-inducible promoter + GFP in CB008 yeast

II. Mini-prep successful colonies from 6/19 cultures (6/19 I.)
       - sent to sequencing {Attempt 2}
       - 6/23 Results: failed, determined rtTA gene was incomplete

WEEK 3

---

Monday June 23, 2014

• Lab meeting
  • presentation on iGEM Parts Registry and Parts Submission

I. Digestion of some pHY4 + alpha promoters - GFP (redo of 6/10 Digestion)

II. Culture DH5alpha + pHY4 + HYM1 cells for mini-prep (runnning low)

III. Gel Extraction of Digestion (I.)

Promoter	Concentration
ASG7	23.77
CLG1	16.59
HYM1	12.96
ECM18	21.39
PRM3	15.20

Tuesday June 24, 2014

I. PCR Purification of remaining pHY4 + alpha promoters - GFP (Digestion done by Derrick)

Promoter	Concentration
PRM2	0.4510
YDR124W	15.46
SAG1	12.10
PRM6	21.74
PRM1	4.186
PCL2	6.348

II. PCR of alpha promoter primer + rtTA with new rtTA RV primer

Wednesday June 25, 2014

I. Gel Check of 6/24 PCR - failed

II. Mini-prep of rtTA, other plasmids (transformed by Eric and Derrick 6/24)

Thursday June 26, 2014

I. PCR of alpha promoter primer + rtTA (Redo of 6/24 II.)

Friday June 27, 2014

I. Gel Check and PCR Purification of 6/26 PCR (6/26 I.)

Promoter	Concentration
PRM2	107.0
ASG7	111.2
PCL2	96.49
CLG1	114.8
YDR124W	90.53
HYM1	72.29
PRM6	99.83
PRM1	75.35
ECM18	18.81
SAG1	104.1
pTEF	182.3

II. Digest Excess plasmid from (I.)

III. Gibson Assembly of primer + rtTA (I.) and pHY4 + promoter (6/23, 6/24) {Attempt 3}

IV. Transformation of E. coli with pHY4 + alpha promoter + rtTA {Attempt 3}
       - use Mach 1 E. coli strain and Gibson Assembly (III.)

WEEK 4

---

Monday June 30, 2014

• Lab meeting
  • update on alpha promoters cloning
  • continue to clone alpha-inducible promoters + rtTA with Sabrina

I. Gibson Assembly of rtTA + PRM2 (related to 6/27 III.)

II. Colony PCR of 6/27 E. coli transformation (6/27 IV.)

III. PCR of rtTA + ECM 18 primer (related to 6/26 I.)

---

Tuesday July 1, 2014

I. Gel Check and PCR Purification of 6/30 PCR of rtTA + ECM18
       - rtTA+ECM18 Concentration: 173.9

II. Mini-prep of alpha promoter + rtTA from 6/30 Colony PCR (6/30 II.)
       - Sent to sequencing {Attempt 3}
       - 7/02 Results: all had CTATTCTCACTCTTTGGACCT interrupting stop codon or failed

Promoter	Colony	Concentration
ASG7	1	203.0
	2	282.9
	3	244.9
PCL2	1	205.5
	2	205.3
	3	305.3
CLG1	1	155.5
	2	187.0
	3	230.0
YDR124W	1	89.44
PRM6	1	246.4
	2	17.32
	3	154.0
PRM3	1	244.9
	3	180.1
SAG1	1	146.5
	2	243.8
	3	137.8

III. Culture PRM1 + rtTA due to low cell count

IV. Yeast Colony PCR of CB008 + constitutive promoters + GFP (made previously by Jeffrey, Sabrina, George, Robert, Eleanor)

V. Gel Check and PCR Purification of (IV.)

Wednesday July 2, 2014

I. Yeast Colony PCR and Gel Check of CB008 + constitutive promoters + GFP (Attempt 2, redo of 7/01 IV.)

II. Colony PCR and Gel Check of 7/01 Mini-preps (7/01 II.)

III. Cultures of remaining pHY4 + alpha promoters + rtTA E. coli colonies from 6/27 transformation (6/27 IV.)

IV. Gibson Assembly of failed alpha promoters + rtTA {Attempt 4}

V. Transformation of E. coli with (IV.) {Attempt 4}
       - Result: low or no yield on plates, possibly due to low backbone concentration
       - PRM2 overgrown, sequencing contained GFP

Thursday July 3, 2014

I. Mini-prep of (7/02 III.) cultures
       - Sent to sequencing {Attempt 4}
       - 7/07 Results: all had CTATTCTCACTCTTTGGACCT interrupting stop codon or failed

II. Digestion and Gel Extraction of pHY4 + alpha promoter + GFP (Redo of 6/23 I. and 6/24 I.)

Monday July 7, 2014

• No lab meeting

I. Gel Check of alpha promoter + rtTA Colony PCR (done by Sabrina)

II. Linearization of HY86E3
       - contains pTET + GFP

III. PCR Purification of (II.)

WEEK 5

---

Tuesday July 8, 2014

I. PCR & PCR Purification of alpha promoter primer + rtTA (redo of 6/26)

Wednesday July 9, 2014

I. Gibson Assembly of pHY4 + alpha promoter + rtTA {Attempt 5}
       - use backbone from 7/03 II.
       - use rtTA insert from 6/08 I.

II. Transformation of E. coli with pHY4 + alpha promoter + rtTA {Attempt 5}
       - 7/10 Results: failed negative control, GFP may still be present

Thursday July 10, 2014

• Attended Lim Lab meeting
• Work on lab meeting presentation - Parts Registry and Human Practices

I. Digestion of pHY4 + PRM1 + GFP and pHY4 + PRM2 + GFP (redo of 7/03 II.)

II. Colony PCR of 6/09 E. coli transformation (6/09 II.)

Friday Jul 11, 2014

• Work on presentation
• Continual edits to HP letters

I. Gel Check and mini-prep pHY4 + alpha promoter + rtTA plasmids from 6/10 II.
       - Sent to sequencing {Attempt 5}

Promoter	Concentration	7/14 Sequencing Results
PRM1	73.71	contains GFP
PRM2	143.0	contains GFP
PRM3	65.07	contains GFP
PRM6	80.45	contains GFP
ECM18	143.0	contains GFP
SAG1	335.9	contains GFP
YDR124W	50.44	contains GFP
CLG1	79.84	contains GFP
ASG7	36.22	contains GFP
HYM1	41.63	contains GFP
PCL2	162.3	contains GFP

       - 7/14 Results: all contained GFP, backbone not properly digested

WEEK 6

---

Monday July 14, 2014

• Lab meeting - meet Wendell officially for first time
  • present on Parts Registry and Human Practices
• PTS47 mini-prep sequencing returned - contains CTATTCTCACTCTTTGGACCT

I. Gibson Assembly using previous backbone - ABANDONED

Tuesday July 15, 2014

• Meet Shuaixin

I. PCR of rtTA + alpha promoter primer homology
       - use rtTA template from Jeffrey's successful transformation (7/14)

II. Set up cultures for Glycerol stocks of new yeast strains

yGEM37 CB008 pTEF1
yGEM39 CB008 pTEFm6
yGEM40 CB008 pTEFm7
yGEM41 CB008 pTEFm10
yGEM44 CB008DB pTEFm6
yGEM45 CB008DB pTEFm7

Wednesday July 16, 2014

• Kara gone
• PTS47 stock sequencing returned - contains CTATTCTCACTCTTTGGACCT sequence ):

I. Gel Extract of 7/15 PCR        - done by Jeffrey+Sabrina        - low concentrations, decide to rePCR

Promoter	Concentration
PRM1	TBA
PRM2
PRM3
PRM6
ECM18
SAG1
YDR124W
CLG1
ASG7
HYM1
PCL2
pTEFm3

II. Glycerol Stocks of yeast strains: pTET+GFP pTEF#+rtTA
       - use cultures from 7/15 II.

yGEM37 CB008 pTEF1
yGEM3 9CB008 pTEFm6
yGEM40 CB008 pTEFm7
yGEM41 CB008 pTEFm10
yGEM44 CB008DB pTEFm6
yGEM45 CB008DB pTEFm7

Thursday July 17, 2014

• Kara, Sabrina gone
  • Email Kara about progress
• Talk with Anasuya
  • start this online lab journal
  • Wiki pages for website - start updating/saving now, update along the way (papers, figures, schematics)
  • understand biological basis of modeling goal - specific examples (specific disease - neuroinflammation)
    • 4 slides with 4 potential examples
    • analogue to alpha-inducible promoter + rtTA?
  • Check if we're on track for medal requirements
    
  • Quick-change? (methylated digest?multiple Quick-change)
• PTS47 stock sequencing rerun and returned - still contains CTATTCTCACTCTTTGGACCT sequence

I. PCR Purification of rtTA PCR Results:

Promoter	Concentration
PRM1	102.2
PRM2	110.6
PRM3	135.5
PRM6	130.7
ECM18	136.8
SAG1	152.4
YDR124W	78.89
CLG1	133.7
ASG7	68.15
HYM1	91.08
PCL2	86.63
pTEFm3	47.19

II. Gibson Assembly using inserts from 1. {Attempt 6}

III. Transformation: E. coli {Attempt 6}
       - NEB5alpha E. coli
       - 7/18 Results:
             Plates with no colonies: PRM1, PRM3, ECM18, YDR124W, CLG1, ASG7, HYM1, PCL2, positive control, negative control
            Plates with colonies: PRM2 (4), PRM6 (countless), SAG1 (25)

TO-DO:

• Research examples of cell-cell community communication -> 4 slides with 4 examples

Friday Jul 18, 2014

• Kara & Sabrina gone
• Prepare for Monday's lab meeting

I. Colony PCR and culture successful colonies from 6/17 transformation (6/17 III.)
       - cultured by Eleanor Sunday 7/20
       - 3 cultures from PRM2, PRM6, and SAG1

II. Replate failed transformations {Attempt 6.2}
       - set in drawer over weekend
       - 7/21 Results: almost all did not grow any colonies
             - PRM6 overgrown (similar to 6/17 transformation)

WEEK 7

---

Monday July 21, 2014

• Lab meeting - RM S436a

I. Mini-prep 6/18 I. cultures

Promoter+rtTA	Concentration	7/22 Results
PRM2	225.0	failed sequencing
PRM6	491.5	has 21 bp mutation?!?!
SAG1	439.0	has GFP (backbone not properly digested)

II. Digestion and Gel Extraction of low-concentration backbones

pGEM	pHY4+Promoter	Concentration
3	PRM3
6	SAG1
7	YDR124W
10	HYM1
11	PCL2

III. Seamless Cloning of alpha-inducible promoters+rtTA {Attempt 7}

Promoter	Insert	Backbone
PRM1	7/17 I.	6/10 I.
PRM2	7/17 I.	6/10 I.
PRM3	7/17 I.	7/21 II.
PRM6	7/17 I.	6/24 I.
ECM18	7/17 I.	6/23 I.
SAG1	7/17 I.	7/21 II.
YDR124W	7/17 I.	7/21 II.
CLG1	7/17 I.	6/23 I.
ASG7	7/17 I.	6/23 I.
HYM1	7/17 I.	7/21 II.
PCL2	7/17 I.	7/21 II.

IV. Transformation of E. coli with III. {Attempt 7}
       - NEB5alpha strain

TO-DO:

• Determine Exploratorium HP topic/activity plan
• Research examples of cell-cell community communication -> 4 slides with 4 examples

Tuesday July 22, 2014

• finalize Exploratorium activity
• explain University of Virginia collaboration

I. Colony PCR of 6/18 Transformation {Attempt 6.2}
       - Abandoned due to poor Gel Photo, unlikely to contain desired gene

II. Culture pGEM colonies
       - restock pGEM for future use

III. Transformation of E. coli with pGEM
       - use pGEM4 (PRM6) and pGEM6 (SAG1)

Wednesday July 23, 2014

I. Mini-prep of cultures from 6/22 II.
       - stored in Parts and Plasmids Box

pGEM#	Promoter	Concentration
1	PRM1	269.5
2	PRM2	294.9
3	PRM3	170.1
5	ECM18	285.4
8	CLG1	297.4
9	ASG7	259.7
10	HYM1	240.2
11	PCL2	261.0

II. Digestion of pGEM plasmids
       - remove GFP
       - overnight digestion at 37 C

TO-DO:

• Digestion of pGEMs
  • use Xho1 and Not1 to remove GFP
• PCR rtTA with Xho1 and BamH1
• PCR Msn2 activating domain with BamH1 and Not1

Thursday July 24, 2014

I. Mini-prep of cultures from 6/22 III. Transformation

pGEM#	Promoter	Concentration 1	Concentration 2
4	PRM6	398.3	527.8
6	SAG1	375.2	399.1

II. Gel Extraction of 7/23 II. Digestion
       - done by Sabrina

pGEM#	Promoter	Concentration
1	PRM1
2	PRM2
3	PRM3
4	PRM6
5	ECM18
6	SAG1
7	YDR124W
8	CLG1
9	ASG7
10	HYM1
11	PCL2

III. PCR and PCR Purification of rtTA and Msn2 inserts
       - obtain rtTA with XhoI and BamHI cut sites
       - obtain Msn2 with BamHI and NotI cut sites

Insert	Concentration
rtTA	153.4
Msn2	100.9

IV. Digestion of rtTA and Msn2
       - use inserts from III.
       - rtTA: XhoI and BamHI
       - Msn2: BamHI and NotI
       - overnight digestion at 37 C

Friday July 25, 2014

I. PCR Purification of 7/24 IV. Digestion
       - done by Sabrina

II. Ligation for pHY4+alpha promoter+rtTA
       - done by Sabrina
       - use inserts from 7/25 I.
       - use backbone from 7/24 II.

III. Transformation of E. coli with 7/25 II. plasmids
       - done by Sabrina
       - DH5alpha strain
       - culture on Sunday

WEEK 8

---

Monday July 28, 2014

I. Colony PCR of successful colonies from 7/25 III. Transformation
       - Gel inconclusive, but seems as if most failed        - Pick new colonies to redo

Tuesday July 29, 2014

I. Colony PCR of 7/25 III. Transformation (redo of 7/28 I.)
       - 1st gel ran off, inconclusive        - 2nd gel

Wednesday July 30, 2014

• worked on Exploratorium Human Practices

I. Colony PCR Gel Check of 7/25 I. (redo 3 of 7/29 I.)

II. Miniprep successful colonies from I. Colony PCR
       - Sequencing Results 7/31

Promoter	Colony	Concentration	Sequencing
PRM1	6	376.7	Successful
PRM2	1	356.8	Successful
PRM3	2	364.5	Successful
PRM6	4	377.5	Failed
ECM18	1	371.7	Successful
YDR124W	5	328.4	Successful
CLG1	5	543.1	Successful
ASG7	4	348.8	Successful
HYM1	3	449.6	Successful
PCL2	6	444.4	Failed

Thursday July 31, 2014

• worked on Exploratorium Human Practices
• work on introduction for iGEM newsletter by Paris-Bethencourt

I. Colony PCR of unsuccessful AFRP+rtTA plates
       - PRM6, SAG1, and PCL2 all failed

II. Linearization of successful plasmids from 7/30 II.
       - Digested with PMEI for 2 hours at 37 degrees C

III. Ligation of pHY4+AFRP, rtTA, and Msn2 (redo of 7/25 II. for promoters from I.)
       - negative control used PRM6 backbone
       - ligated with T4 ligase overnight at 16 degrees C

---

Friday August 1, 2014

• Anasuya: various examples of how system will respond (up, down, stays, converge, diverge) depending on stimulus
• drop intermediate values when testing? Allow for more samples, less accuracy

I. Transformation of E. coli with pHY4+AFRP+rtTA plasmid
       - use 7/31 III. ligations
       - plated overnight at room temperature

II. Transformation of yeast with AFRP+rtTA
       - use 7/31 II. linearized plasmids
       - CB008 pTET+GFP and CB008DB pTET+GFP yeast strains

WEEK 9

---

Monday August 4, 2014

• Lim Lab meeting

I. Colony PCR of E. coli Transformation (8/01 I.)
       - PRM6, SAG1, PCL2 all successful

II. Colony PCR of Yeast Transformation (8/01 II.)
       - CB008(DB) pTET+GFP AFRP+rtTA plates
       - CB008 all successful except ECM18
       - CB008DB all failed

III. Colony PCR of Yeast Transformation (redo of II.)
       - CB008DB AFRP+rtTA, CB008 ECM18
       - all failed

Tuesday August 5, 2014

• Work on iGEM Collaborations with Paris-Bettencourt

I. Colony PCR of Yeast Transformation (redo of 8/04 III.)
       - CB008DB AFRP+rtTA, CB008 ECM18
       - on hold, need more primers

II. Streak successful colonies from 8/04 II.

Wednesday August 6, 2014

• Exploratorium Presentation Practice
• Work on iGEM Collaborations with Paris-Bettencourt
  

I. Transformation of Yeast with AFRP + rtTA
       - CB008 pTET+GFP, PRM6, ECM18, SAG1, PCL2 +rtTA (use Mini-prep of 8/01 I., [for ECM18, redo of 8/01 II.)
       - CB008DB pTET+GFP with all 11 AFRP+rtTA (redo of 8/01 II.)
       - 8/08 Results: all grew colonies except CB008 PRM6+rtTA

Thursday August 7, 2014

• Human Practices: Exploratorium After Night Event
  • Super Science: the science behind superheroes
    

I. Culture 8/05 II. streaks for glycerol stocks

Friday August 8, 2014

• send in iGEM newsletter information
  

I. Yeast Colony PCR of 8/06 I. Transformation
       - all failed

II. Glycerol stocks of 8/05 II. yeast strains
       - CB008 pTET+GFP PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7, HYM1 + rtTA

III. Transformation of Yeast with pTET+mfalpha
       - use strains: CB008 pTET+GFP, PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7, HYM1+ rtTA
       - 8/11 Results: all grew colonies

Week 10

---

Monday August 11, 2014

• lab meeting
  • email Kara about upcoming class schedules, days you can't go in
  • re-organize box
  • brainstorm project titles
  • Parts Registry - help Eleanor
  • finish Santa Cruz poster by Wed. - help Ianto

I. Yeast Colony PCR of 8/06 I. Transformation (redo of 8/08 I.)
       - all failed again

II. Yeast Colony PCR of 8/08 III. Transformation
       - all successful except CLG1 and HYM1

Tuesday August 12, 2014

I. Yeast Colony PCR of 8/06 and 8/08 Transformation (redo of 8/11 I. and II.)
       - CLG1+rtTA pTET+mfalpha successful; all others failed

II. Linearization of plasmids
       - use PmeI

III. Start cultures for retransformation (8/13 II.)

Wednesday August 13, 2014

• Poster arrived!

I. Yeast Colony PCR
       - check CB008 pTET+GFP HYM1+rtTA pTET+mfalpha
       - colony 10 worked; culture made for glycerol stocks and transformation

II. Yeast Tranformation
       - a. add pPCL2+RFP, pAGA+RFP, pPCL2+BFP to CB008 pTET+GFP AFRP+rtTA pTET+mfalpha
       - b. add AFRP+rtTA to CB008 pTET+GFP: PRM6, ECM18, SAG1, PCL2
       - suspend CB008DB pTET+GFP AFRP+rtTA transformations
       - Results (Checked 8/18): b. all failed. BFP suspended due to lack of supplies. a. first Colony PCR failed, HYM1 failed, rest successful

III. Glycerol Stocks of CB008 pTET+GFP AFRP+rtTA pTET+mfalpha        - PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7

Thursday August 14, 2014

• Practice presentations 2-4PM

Friday August 15, 2014

• last official day of iGEM
• visit Santa Cruz for iGEM meet-up

Week 11

---

Monday August 18, 2014

• Kilobot workshop! no group meeting
• Sunday August 17: Jeffrey did Colony PCR for 8/13 II. Yeast Transformations

Successful yeast strains (Colony PCR'ed by Jeffrey)

yGEM Number	Characteristics
105	CB008 pTET-GFP::LEU2 pPRM1-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
106	CB008 pTET-GFP::LEU2 pPRM2-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
107	CB008 pTET-GFP::LEU2 pPRM3-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
111	CB008 pTET-GFP::LEU2 pYDR124W-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
112	CB008 pTET-GFP::LEU2 pCLG1-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
113	CB008 pTET-GFP::LEU2 pASG7-rtTA::URA3 pTET-mfalpha::HIS pAGA1+mCherry::TRP
116	CB008 pTET-GFP::LEU2 pPRM1-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
117	CB008 pTET-GFP::LEU2 pPRM2-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
118	CB008 pTET-GFP::LEU2 pPRM3-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
122	CB008 pTET-GFP::LEU2 pYDR124W-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
123	CB008 pTET-GFP::LEU2 pCLG1-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP
124	CB008 pTET-GFP::LEU2 pASG7-rtTA::URA3 pTET-mfalpha::HIS pPCL2+mCherry::TRP

I. Yeast Transformation
       - redo of 8/13 II.
       - Results (8/20): all failed, redo?

Tuesday August 19, 2014

• Kilobot workshop!

Wednesday August 20, 2014

• Kilobot workshop!

I. Yeast Transformation
       - CB008 AFRP+rtTA pTET+GFP pTET+mfalpha add in pPCL2+BFP
       - PRM1, PRM2, PRM3, YDR124W, CLG1, ASG7, HYM1

Thursday August 21, 2014

• Kilobot workshop!

I. Yeast Transformation
       - CB008 pTET+GFP, add in AFRP+rtTA: SAG1 nd PCL2
       - PRM6 and ECM18 suspended due to poor expression

Friday August 22, 2014

• Kilobot workshop!

Week 12

---

Monday August 25, 2014

• Results: Friday 8/22 Transformation failed

I. Make cultures for Yeast Transformation tomorrow

II. Linearize plasmids for Yeast Transformation

Culture	Added part
CB008 pTET+GFP m3+rtTA	pTET+mfalpha
CB008 pTET+GFP m6+rtTA pTET+mfalpha	pAGA1+mCherry
CB008 pTET+GFP	SAG1+rtTA
CB008 pTET+GFP	PCL2+rtTA
CB008 pTET+GFP PRM1+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP PRM2+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP PRM3+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP YDR124W+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP CLG1+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP ASG7+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP HYM1+rtTA pTET+mfalpha	pPCL2+BFP
CB008 pTET+GFP HYM1+rtTA pTET+mfalpha	pPCL2+mCherry
CB008 pTET+GFP HYM1+rtTA pTET+mfalpha	pAGA1+mCherry

Tuesday August 26, 2014

I. Yeast Transformation (redo of a lot of failed transformations II. E. coli Transformation (redo of 8/85, which failed due to plating on wrong antibiotic)

Thursday August 28, 2014

• First day of class at UC Berkeley

Week 13+

---

• 9/08/2014 - 10/29/2014 Came in on Mondays and Wednesdays to work on Kilobots modeling, iGEM details, reduced wet lab work.