Split IFP & GFP  - Week 1

1        CPXR extraction

Extraction of CPXR from genome of E. Coli strain K-12 MG1655

 

1.1       Material and methods

NEB Phusion HF PCR Protocol (see protocol), with corresponding primers (cf primers datasheet) for amplification. 

1.2       Results

1.2.1     Data

 

1.2.2     Interpretation

CPXR expected size : 699 bp

Amplification of CPXR worked as expected.

2        PCR for amplification of iGEM plasmid pSB1C3 and for addition of overlapps to CPXR

Amplification of pSB1C1 backbone from Cambridge biobrick K325219. This backbone contains the RBS, an arabinose-inducible pBAD promoter, iGEM prefix (containing ECORI and xbaI restriction sites) and suffix (contaning SpeI and PstI restriction sites), a chloramphenicol resistance gene, and an origin of replicaiton. Additon of overlapp to CPXR in order to make a Gisbon assembly of the backbone and the CPXR

2.1       Material and methods

NEB Phusion PCR and suitable primers.

2.2       Results

2.2.1     Data

 

 

2.2.2     Interpretation

We obtained the expected amplicon, and are now able to make a Gibson assembly to fuse the backbone amplicon and the CPXR.

 

1      Gibson assembly and colony PCR of pCPXR

Fusion of pSB1C3 backbone and CPXR

 

1.1       Material and methods

Gibson assembly kit (see protocol) for the Gibson assembly, and Taq polymerase for colony PCR (see protocol)

 

1.2       Results

 

1.2.1     Data

Colonies were obtained and analyzed by colony PCR, using VF2 and VR primers from iGEM

 

 

1.2.2     Interpretation

The amplicons have the expected size, meaning the Gibson assmbly worked and that we very likely obtained pCPXR (plasmid with pSB1C3 backbone and CPXR). Sequencing will reveal if the plasmid contain any mutation.

 

2        Sequencing of pCPXR

Confirmation of pCPXR sequence with Microsynth sequencing services.

2.1       Material and methods

We sent the plasmid with a concentration of 80 ng/μl and with premixed primers VR and VF2

2.2       Results

 

2.2.1     Data

We obtained the right sequence, excepted one deletion of a cytosine in the ara promoter at the position -41. This deletion appeared to be originally in the backbone pSB1C1 that we amplified from Cambridge biobrick K325219, without consequence on the transcription of the coding sequence.

 

3     Amplification of IFP1, IFP2 and pCPXR with suitable overlaps to fuse the split at the C or N terminal of CPXR

PCR amplification of fragments to fuse IFP1 and IFP2 at the C or N terminal of CPXR in pCPXR plasmid

3.1       Material and methods

NEB Phusion kit (see protocol) and suitable primers (see list). Template come from Michnick lab IFP PCA.

3.2       Results

3.2.1     Data

3.2.2     Interpretation

IFP1 C didn't work but the other ones have the expected size. We are going to try again IFP1 C in a gradient PCR

 

4        PCR gradient to obtain IFP1 C fragment

Amplification of IFP1 with overlap in order to insert it in pCPXR at the C terminal of CPXR

4.1       Material and methods

Gradient temperature was performed as the PCR didn’t work the first time. NEB Phusion kit, same procedure as last time

4.2       Results

4.2.1     Data

4.2.2     Interpretation

We finally obtain the amplicon, for each temperature.

 

Experiment 1: Transformation

Transform competent cells with plasmids recovered from Michnick’s and Waldor’s labs

 

1.1 Material and methods

14/07/14

 

Preparation of SOC: 3 x (20µl of glucose 20mM in 1ml SOB)

 

Transformation Protocol from iGEM HQ with 1 uL DNA in each Ependorf

 

Ependorf number	Content	Comments
1, 2	pYNZC (34.8 ng/uL)	Waldor, CamR
3, 4	prLucNrLucC (33 ng/uL)	Waldor, CamR
5, 6	prLuc (30 ng/uL)	Waldor, CamR
7, 8	pAG25-L-IFP [1]	Michnick, AmpR
9, 10	pAG32-L-IFP [2]	Michnick, AmpR
11, 12	10pg/ul RFP Control (pSB1A3 w/ BBa_J04450)	AmpR

 

Incubation times: 2h shaking at 37°C / 180 rpm and 2h resting on ice.

Plates set for incubation overnight at 37°C

 

15/07/14

 

Inoculated cultures in LB Chloramphenicol or Ampicillin (3ml)

Tubes left in the fridge all day

Incubation overnight at 37°C / 180 rpm

 

16/07/14

 

OD measurement

1.2 Results

1.2.1 Data

OD: 1. pYZNC A: 2.046

2. pYZNC B: 2.033

3. prLucNrLucC A: failed (overcrowded plate)

4. prLucNrLucC B: 2.072

5. prLuc A: 2.028

6. prLuc B: 2.055

7. pIFP 1 A: 1.950

8. pIFP 1 B: 1.953

9. pIFP 2 A: 1.954

10. pIFP 2 B :1.948

1.2.2 Interpretation

Tube 3 discarded, others used for miniprep and glycerol stock preparation

Experiment 2: Bioluminescence assay

Make a bioluminescence assay with the previously prepared cultures

2.1Material and methods

17.07.14:

Overnight cultures (3ml LB + chloramphenicol) inoculated with cells from a frozen glycerol stock from previously transformed competent cells (pYNZC A & B, prLucNrLucC B, prLuc A & B) were incubated at 37°C with shaking at 180 rpm). OD was measured the following day.

18.07.14:

The cultures were diluted 1:100 in 5mL fresh LB-Chloramphenicol containing 670ul of 100mM L-arabinose and grown for 3h on a rotary shaker to an OD 0.8-0.9. The cultures (500ul of each) were washed twice with phosphate buffered saline (PBS; pH 7), adjusted to an OD 0.4-0.5 (final volume of culture should be 1ml) and aliquoted into a white 96-well plates in triplicates.

Aliquots of native coelenterazine (clz) dissolved in ethanol (10mM) were stored at 80°C. Solution of glucose (30mM in bi-distilled water) were prepared and used at a concentration of 1mM. Prior to the assay, an aliquot of clz was thawed, diluted in PBS to a final concentration of 250uM, and incubated in the dark at room temperature (RT) for 1h. Clz was added to a final concentration of 7.5uM to the PBS-washed cells, which were subsequently incubated in the dark for 30 minutes at RT. The total luminescence of each well was then measured every two minute for a total of 10 min with an integration time of 1 sec using (WHICH MACHINE??). Immediatly thereafter, 10 ul of glucose solution was manually injected into each well and a second luminescence read was initiated as before.

 

2.2Results

2.2.1Data

 

 

2.2.2Interpretation

The measurements were taken too late. The substrate (clz) already started to be depleted. The positive control gave a very strong signal at the beginning, while the negative control gave a small or no signal. The construct itself gave a signal higher than the negative control but much lower than the negative control, meaning that the construct works but isn't optimal. The effect of the addition of glucose after 10 minutes can't be determined precisely. As there was no more clz in the wells after 6-7 minutes, the shut down of the luminescence observed in the construct wasn't necessarily due to glucose addition, as exprected. We cannot conclude on this experiment. We should start again and take measurements faster.

 

07.07.14-13.07.14

 

Competent Cells

 

Protocol : Thermocompetent cells protocol

First try – Not much care, all resulting tubes were thrown away

Second try – Lesser volume, more care to cold, poured liquid nitrogen right into box for freezing.

 

Results : Tests seem to indicate that our method for transformation was simply not adapted to our competent cell protocol. We do not have the appropriate sterile cold room to produce high efficiency competent cells. Therefore, for biobricks and gibson assemblies, we need to use commercial competent cells. For transformations with plasmid constructs where the concentration is in the scale of 1 ng/ul or more our competent cells are usable.

 

 

1 Experiment 1: Bioluminescence assay

Make a bioluminescence assay with the cultures transformed with plasmids from Waldor's lab

1.1 Material and methods

22.07.14: Overnight cultures (3ml LB + chloramphenicol) inoculated with cells from a frozen glycerol stock from previously transformed competent cells (pYNZC, prLucNrLucC, prLuc) were incubated at 37°C with shaking at 180 rpm). OD was measured the following day.

23.07.14: The cultures were diluted 1:100 in 5mL fresh LB-Chloramphenicol containing 670ul of 100mM L-arabinose and grown for 3h on a rotary shaker to an OD 0.6-0.7. The cultures (1ml of each) were washed twice with phosphate buffered saline (PBS; pH 7), (final volume of culture should be 1ml) and aliquoted into a white 96-well plates in triplicates.

Aliquots of native coelenterazine (clz) dissolved in ethanol (10mM) were stored at 80°C. Prior to the assay, an aliquot of clz was thawed, diluted in PBS to a final concentration of 250uM, and incubated in the dark at room temperature (RT) for 1h. Clz was added to the PBS-washed cells, at different concentrations: 7.5uM and 75uM for pYNZC and rLucNrLucC, 7.5uM, 15uM, 75uM and 150uM for rLuc, for a total volume of 300ul in each well (see table below). Cells were subsequently incubated in the dark for 5 minutes at RT. The total luminescence of each well was then measured every three minutes for a total of 30 min with an integration time of 1 sec.

 

PYNZC 7.5uM cz	PYNZC 7.5uM cz	PYNZC 7.5uM cz	PYNZC 75uM cz	PYNZC 75uM cz	PYNZC 75uM cz
PrLNrLC 7.5uM cz	PrLNrLC 7.5uM cz	PrLNrLC 7.5uM cz	PrLNrLC 75uM cz	PrLNrLC 75uM cz	PrLNrLC 75uM cz
PrLuc 7.5uM cz	PrLuc 7.5uM cz	PrLuc 7.5uM cz	PrLuc 15uM cz	PrLuc 15uM cz	PrLuc 15uM cz	PrLuc 75uM cz	PrLuc 75uM cz	PrLuc 75uM cz	PrLuc 150uM cz	PrLuc 150uM cz	PrLuc 150uM cz
PBS 7.5uM cz	PBS 7.5uM cz	PBS 7.5uM cz	PBS 75uM cz	PBS 75uM cz	PBS 75uM cz

 

1.2Results

1.2.1Data

 

1.2.2Interpretation

After addition of coelenterazine to the cells in the plate, wells were full and the cultures may have spread between the wells. Our results aren't as expected, as the signal in the negative control is higher than in the pYNZC construct.

The measurements should be taken in an opaque 96-well plate, from the bottom of the plate. The wells shouldn't be filled completely to avoid spreading.

The concentration of bacteria should be taken in account to make the gradient of concentrations.

 

 

2 Experiment 2: PCR extraction of fragments of interest

 

Extraction of sequences of interest from plasmids to proceed to Gibson assembly of the final construct: CheYrLucNCheZrLucC.

 

2.1 Material and methods

PCR kit (NEB), see protocol from kit

Minipreps from following plasmids: CheY (Bba_K569017), CheZ (Bba_K629003), rLucN (YNZC, Waldor), rLucC (YNZC, Waldor)

 

Primers (TABLE)

 

Preparation of the tubes (in duplicates) for 50uL reaction:

[uL]	MasterMix*	For_primer	Rev_primer	Template DNA	Nuclease free Water
CheY	11.5	2.5	2.5	11.7	21.8
CheZ	11.5	2.5	2.5	3.4	30.1
RlucN	11.5	2.5	2.5	4.1	29.4
RLucC	11.5	2.5	2.5	4.1	29.4

 

*MasterMix: for one tube: 9uL HF buffer, 0.9uL dNTP, 0.5uL polymerase

 

Control tubes:

[uL]	MasterMix*	For_primer	Rev_primer	Template DNA	Nuclease free Water
CheY	11	2.5	2.5	11.7	22.3
CheZ	11	2.5	2.5	3.4	30.6
RlucN	11	2.5	2.5	4.1	29.9
RLucC	11	2.5	2.5	4.1	29.9

*Control MasterMix: for one tube: 9uL HF buffer, 0.9uL dNTP

 

PCR program according to Phusion Polymerase protocol

 

2.2 Material and methods

 

1.2.1 Data

 

 

1  Gibson assembly and colony PCR for IFP2-pCPXR (at the C and N terminal)

 

Assembly of IFP2 at the C ter or N ter of CPXR in pCPXR by Gibson assembly. Colony PCR is useful to check if competent cells were transformed by our expected Gibson Assembly product and not by the empty plasmid pCPXR.

We did the GA with PCR product of pCPXR opened with corresponding primers and amplified insert, but we didn’t get rid of the pCPXR DNA template so competent cells may have been transformed with empty vectors thus acquiring chloramphenicol resistance. This is why we obtained so many negative colonies. DPN1 digestion of our PCR product would have removed the plasmids template.

1.1       Material and methods

We used VR ans VF2 sequencing primers.

1. pick a colony and pouf pouf in 10ul tubes of water. Directly put the tip in 3ml of LB with chloramphenicol in culture tubes and put at 37°.
2. Boil the 10ul tubes of water containing the picked bacteria at 95° for 10 minutes. It will be your « DNA template ».
3. Prepare the PCR mix for Taq polymerase, with 1ul of DNA template (NEB Taq protocol)

 

 

 

1.2       Results

1.2.1     Data

 

 

    

 

We also loaded PCR product of pCPXR "opened" as negative control, in order to compare the size of our GA product and pCPXR and see if it contains the IFP2. Colonies that are thought to contain the insert IFP2 are:

• IFP2 C terminal: 1, 4, 5, 6, 7, 9, 10, 11, 12
• IFP2 N terminal: 1, 2, 3, 4, 6, 9, 12

1.2.2     Interpretation

By observing the difference of size between the negative control (PCR of pCPXR that doesn’t contain the insert) and the colony PCR fragment, we see that we obtained some colonies containing empty vectors and some that contains very likely IFP2 insert. Further anlyisis and sequencing will confirm it.

2        PCR amplification of IFP2 in the plasmid thought to contain IFP2

Amplification of IFP2 from IFP2-pCPXR plasmid, to confirm that our GA product contains the insert IFP2.

 

2.1       Material and methods

We used primers previously used to amplify and to add an overlap to IFP2 Cter and Nter respectively. As the « tail » of the primers were now annealing the plasmid, one could think that changing the Annealing temp was necessary but you can keep the same that you used the first time. Unfortunately some of the PCR tubes opend in the PCR machine so we couldn’t analyzed all of the plasmid.

2.2       Results

2.2.1     Data

 

 

2.2.2     Interpretation

All of the plasmids analysed contain the insert IFP2 and the size is correct (600 bp). Our GA worked, at least for the colonies that were analyzed on this gel. We are now ready for sequencing

3        Sequencing IFP2-pCPXR plasmid

To check if our GA products, pCPXR fused to IFP2 at its Cter or Nter don’t contain any mutation. We sent sample 9 for IFP2 Nter and sample 10 for C terminal.

3.1       Material and methods

Microsynth Barcode and a plasmid concentartion of 80 ng/ul

3.2       Results

3.2.1     Data

No mutation for IFP2 at the C terminal. One mutation in the RBS of IFP2 at the Nterminal, position -18 a A instead of a T. It shouldn't matter. 

 

4       

Gibson assembly and colony PCR for IFP1-pCPXR (at the C and N terminal)

Assembly of IFP1 at the C ter or N ter of CPXR in pCPXR by Gibson assembly. Colony PCR to check if competent cells were transformed by our expected Gibson Assembly product and not by the empty plasmid pCPXR.

4.1       Material and methods

(See above for protocol)

WARNING : We should always do a negative control for the colony PCR with Bacteria transformed with the empty vectors, not a PCR of an empty plasmid. Otherwise you cannot make any conclusion if the colony PCR fails or if the Gibson Assembly fails. You can compare the colony PCR quality of an expected product (pCPXR) and colony PCR of your new Gibson Assembly.

 

4.2       Results

4.2.1     Data

 

 

 

 

In blue: IFP1 at the C terminal. In red: IFP2 at the N terminal

 

4.2.2     Interpretation

Colonies that are thought to contain IFP1:

• IFP1 at the C terminal: all
• IFP1 at the N terminal: 3, 4, 6, 7, 8, 9, 10

  

5        PCR amplification of IFP1 in IFP1-pCPXR plasmid (after mini-prep)

 

Colony PCR was not really conculsive so we decided to min-prep all the colonies and analyse the obtained plasmids.

 

5.1       Material and methods

IFP1 amplification of the obtained plasmid was done with primers previously used to add to IFP1 the overlapp (IFP1_Cter and IFP1_Nter). We used Taq polymerase.

5.2       Results

5.2.1     Data

• IFP1 amplification from colonies supposed to have the plasmid pCPXR with IFP1 at its Nterminal:

 

 

• IFP1 amplification from colonies supposed to have the plasmid pCPXR with IFP1 at its Cterminal.

 

 

Expected size: 484 bp which correspond to our results.

 

5.2.2     Interpretation

Amplicon expected size is 463 bp, which correspond to our results. Colonie 5 (N terminal) apparently doesn’t have IFP1, the other ones do contain the expected amplicon.  “+” means that we amplified IFP1 from the plasmid known to contain this sequence. We also obtained a band at 850 bp for all the colonies that have the IFP1 fragment. Interestingly we also obtained this band in the positive control.

We very likely contain pIFP1-CPXR and pCPXR-IFP1 and further sequencing will confirm it.

 

1        Restriction Analysis of IFP1 Cter and Nter

 

To check if the plasmid contains IFP1 in our Gibson Assembly product, by digesting the plasmid with NheI and SpeI and see if we obtain the expected sizes.

  

1.1       Material and methods

• 500 ng of DNA (plasmid)
• 0.5 ul of SpeI and 0.5 ul NheI (should be added at the end)
• 5 ul of cut smart buffer
• Add water to 50 ul

 

Incubate for one hour at 37°

Load on gel

 

1.2       Results

1.2.1     Data

 

Plasmid that have been digested in 2 fragments of size 1169 bp and 2773 bp contains a fragment, which is likely IFP1 (expected size). First gel reveals that all the plasmid supposed to contain IFP1 at the Cterminal of CPXR likely have IFP1. The second gel reveals that all colonies exept the 1^st one likely contains IFP1 at the Nterminal. Further sequencing will confirm it.

2        IFP1 Cter and Nter sequencing

To check if the inserts IFP1 Cter and Nter, IFP2 Cter and Nter are present in the Gibson Assembly products (pCPXR fused by the insert below)

2.1       Material and methods

We will use the primer pBad For provided by mycrosynth (standard primer list) which will allow the sequencing from the end of the arabinose promoter. We will use also the VR primer to sequence Reverse from the suffix

 

• IFP1 Cter : 10 (90 ng/ul)
• IFP1 Nter : 9 (94 ng/ul)

2.2       Results

2.2.1     Data

•  9   IFP1 Nter : No deletion 
• 10   IFP1 Cter : one deletion in the linker, doesn’t change the reading frame of IFP1

 

• 

 

Expected sequence                                      Our sequence

• GGG TCC TCC                                     GGA ---- TCC

  Glycine Ser Ser                                   Gylcine----Serine

 

 

2.2.2     Interpretation

The deletion in the linker doesn't shift the reading frame. One Serine is missing, meaning the linker will certainly not be as flexible as it should be between the split IFP and CPXR. We decided to keep working on this construct, because it shouldn't alterate too much the construct. 

 

 

1        PCR of pCPXR-IFP1 and pCPXR-IFP2 to put both fragment in the same vector

 

To do a new plasmid containing our two fragments of interest, CPXR-IFP1 and CPXR-IFP2 into each configuration (IFP1 at the C or N terminal of CPXR and IFP2 at the C or Nterminal of CPXR) to avoid co-transformation during further experiment.

1.1       Material and methods

Phusion PCR with a temperature gradient (as our two first trial failed completely). Gradient temperature was achieved from 60° to 70°, the theorical temperature being around 70°. pCPXR-IFP2 will be entirely amplified and IFP1-CPXR fragment will be amplified by PCR with suitable overlapping ends for further Gibson assembly reaction.

1.2       Results

1.2.1     Data

 

 

Every template has been amplified 7 times, each with a different annealing temperature, respectively from the first amplicons : 70°, 69.5°, 68.4°, 66.4°, 64°, 62°, 60°

1.2.2     Interpretation

Not all the annealing temperature worked but we obtained one amplicon of each IFP1-CPXR, CPXR-IFP1, pCPXR-IFP2 opened, pIFP2-CPXR opened.

2        Gibson assembly to make 4 different constructs containing both IFP1-CPXR and IFP2-CPXR in different configuration and colony PCR

Fusion of the insert IFP1-CPXR (IFP1 at the C or N terminal of CPXR) in the plasmid containing IFP2-CPXR (IFP2 at the C or N terminal of CPXR), to have our four constructs:

 

GA1: IFP1 at the Cterminal of CPXR and IFP2 at the Cterminal of CPXR

GA2: IFP1 at the Cterminal of CPXR and IFP2 at the Nterminal of CPXR

GA3: IFP1 at the Nterminal of CPXR and IFP2 at the Cterminal of CPXR

GA4: IFP1 at the Nterminal of CPXR and IFP2 at the Nterminal of CPXR

 

2.1       Material and methods

NEB Gibson assembly kit and NEB Taq polymerase for the colony PCR with primers VR and VF2

2.2       Results

We didn’t obtain any colonies for GA1 and GA3, and only a few for GA2 and GA4. We picked 13 colonies of GA4 and 10 colonies for GA.

2.2.1     Data

• Colony PCR of GA4 with VF2 and VR primers. 

 

• 
•  

 

• Colony PCR of GA2 with VF2 and VR primers. Expectations are the same.

 

 

 

2.2.2     Interpretation

Expectation is about 4050 for plasmid containing both IFP1-CPXR and IFP2-CPXR. Expectation is about 3000 for a plasmid containing only one fragment.

We can’t conclude anything with this ladder, and the difference between our wanted product and one that doesn’t contain both fragment of interest is of 1000 bases so we can’t reaaly see it on the gel. Mini-prep has been done and restriciton analysis will allow us to conclude if the colonies contained the expected product.

 

3        Restriction enzyme analysis of GA2 and GA4

Digestion of our constructs GA2 (containing IFP1 at the Cter of CPXR and IFP2 at the Nter) and GA4 (containing IFP1 at the Nter and IFP2 at the Nter) with enzymes SpeI and NHeI to see if they contain the expected fragments.

3.1       Material and methods

NEB protocol for restriction enzyme digestion was applied and enzyme SpeI and NheI were used.

3.2       Results

3.2.1     Data

• Restriction analysis of GA4

 

• Restriction analysis of GA2

3.2.2     Interpretation

Expected fragment with both inserts: 3273 bp + 2539 bp

With only CPXR-IFP1: 1200 bp + 3273 bp

With only CPXR-IFP2: 1400 bp + 3273 bp

GA4: plasmids 2, 4, 6, 7, 10 correspond to our expectation

GA2: plasmids 5, 8 correspond to our expectation 

 

 

 

1 Experiment 1: PCR for fLucN/C extraction

Purpous: extract N and C temini of firefly Luciferase from EPIC_firefly biobrick (iGEM)

1.1Material and methods

Material:

Phusion PCR kit (NEB)

EPIC_firefly Miniprep (Bba_K325108)

Method

PCR tubes preparation:

	Fragment	Mastermix (ul)	Fp (ul)	Rp(ul)	DNA (ul)	Water (ul)	Total (ul)	PCR program
1	fLucN_A	11.5	2.5	2.5	4.1	29.4	50	2
2	fLucN_B	11.5	2.5	2.5	4.1	29.4	50	1
3	fLucC_A	11.5	2.5	2.5	4.1	29.4	50	2
4	fLucC_B	11.5	2.5	2.5	4.1	29.4	50	1
5	FlucN control	11*	2.5	2.5	4.1	29.9	50	2
6	FlucN control	11*	2.5	2.5	4.1	29.9	50	1

 * For the controls, there was no phusion polymerase in the MasterMix

Primers: [TABLE]

PCR programs according to Phusion polymerase protocol

 

1.2Results

 

1.2.1Data

 

1.2.2Interpretation

The expected amplicon size for fLucN is 1248 bp. As the bands are between 1000 and 1500 bases, the amplicon seems to be correct. The expected amplicon size for fLucC is 477 bp. As the band is a bit lower than 500 bp, the amplicon seems to be correct. The negative controls without polymerase are also OK.

 

 

2Experiment 2: PCR for Gibson overlaps

Purpose of the experiment: add overlapping sequences to prepare Gibson assemblies

2.1Material and methods

Material:

Phusion PCR kit (NEB)

EPIC_firefly Miniprep (Bba_K325108)

 

Method

PCR tubes preparation:

	Fragment	Mastermix (ul)	Fp (ul)	Rp(ul)	DNA (ul)	Water (ul)	Total (ul)	PCR program
1	CheY_A	11.5	2.5	2.5	12.7	20.8	50	1
2	CheY_B	11.5	2.5	2.5	NO DNA	33.5	50	1
3	CheZ_A	11.5	2.5	2.5	5.5	28	50	1
4	CheZ_B	11.5	2.5	2.5	5.5	28	50	1
5	CheY ctrl	11 (no phusion)	2.5	2.5	12.7	21.3	50	1
6	CheZ ctrl	11 (no phusion)	2.5	2.5	5.5	28.5	50	1
7	rLucN_A	11.5	2.5	2.5	9.1	24.4	50	3
8	rLucN_B	11.5	2.5	2.5	9.1	24.4	50	3
9	rLucC_A	11.5	2.5	2.5	4.6	28.9	50	1
10	rLucC_B	11.5	2.5	2.5	4.6	33.5	50	1
11	rlucN ctrl	11 (no phusion)	2.5	2.5	9.1	24.9	50	1
12	rlucC ctrl	11 (no phusion)	2.5	2.5	4.6	29.4	50	1
13	rlucC neg_A	11.5	2.5	2.5	4.6	28.9	50	1
14	rlucC neg_B	11.5	2.5	2.5	4.6	28.9	50	1
15	rlucN neg_A	11.5	2.5	2.5	9.1	24.4	50	1
16	rLucN_neg_B	11.5	2.5	2.5	NO DNA	33.5	50	1
17	rlucC neg ctrl	11 (no phusion)	2.5	2.5	4.6	29.9	50	1
18	rlucN neg ctrl	11 (no phusion)	2.5	2.5	9.1	29.4	50	1
19	flucN_A	11.5	2.5	2.5	4.3	29.2	50	2
20	flucN_B	11.5	2.5	2.5	4.3	29.2	50	2
21	fLucC_A	11.5	2.5	2.5	4.6	28.9	50	1
22	fLucC_B	11.5	2.5	2.5	4.6	28.9	50	1
23	fLucN_neg_A	11.5	2.5	2.5	4.3	29.2	50	2
24	fLucN_neg_B	11.5	2.5	2.5	4.3	29.2	50	2
25	fLucC_neg_A	11.5	2.5	2.5	4.6	28.9	50	1
26	fLucC_neg_B	11.5	2.5	2.5	4.6	28.9	50	1
27	plasmid_A	11.5	2.5	2.5	4.1	29.4	50	4
28	plasmid_B	11.5	2.5	2.5	4.1	29.4	50	4

Primers[TABLE]

For the backbone: primers opener 1 and opener 2 were used.

PCR Programs accorgind to Phusion PCR protocol

2.2Results

2.2.1Data

 

2.2.2Interpretation

The expected amplicon size for CheY (lane 1) is 486 bp. As the band is near 500 bases, the amplicon seems good. However, we detect a weak band at approximately 1000 bases that shouldn't appear. This could be an sequence that we obtained after the first PCR for CheY extraction (week 3) and that we didn't see on the gel from last week. However, this shouldn't be a problem. As the band is weak, it has not been amplified this time and it will not react in our future Gibson assembly. The negative control without polymerase (lane 5) shows the previous PCR product that has not been amplified, which is OK.

The expected amplicon size for CheZ (lanes 3&4) is 703 bp. We see that the band is appoximately at 700 bases which confirms that the amplicon is OK. The negative control without polymerase (lane 6) shows the previous PCR product that has not been amplified, which is OK.

The expected amplicon size for rLucN (lanes 7&8) is 388 bp. As the band is detected between 300 and 500 bases, the amplicon seems to be OK.The negative control without polymerase (lane 11) shows the previous PCR product that has not been amplified, which is OK.

The expected amplicon size for rLucC (lanes 9&10) is 669 bp. We see a band a little bit lower than 700 bases, so the amplicon seems right. The negative control without polymerase (lane 12) shows the previous PCR product that has not been amplified, which is OK.

The expected amplicon size for rLucC (future negative control, lanes 13&14) is 662 bp. The band is a bit lower than 700 bases, which is as expected. The negative control without polymerase (lane 17) shows the previous PCR product that has not been amplified, which is OK.

The expected amplicon size for rLucN (future negative control, lane 15) is 420 bp. As the band is between 300 and 500 bases, which is right. The negative control without polymerase (lane 18) shows the previous PCR product that has not been amplified, which is OK.

The expected amplicon size for fLucN (lanes 19&20) is 1306 bp. The band appears a little bit lower than 1500 bases, which is OK. The expected amplicon size for fLucC (lanes 21&22) is 538 bases. We can see a band at approximately 500 bases, which is as expected.

The expected amplicon size for fLucN control (lanes 25&26) is 1306 bp and the band appears a little bit lower than 1500 bases. The expected amplicon size gor fLucC control (lanes 27&28) is 531 bp, and the band appears at approximately 500 bases. An error of pipetting happened for lane 25: no PCR product was loaded.

The expected amplicon size for the backbone was 3311 bp. The band appears a bit higher than 2500 bases, which is as expected.

 

Our products all seem to be ready for the following Gibson assemblies:

• CheY-rLucN-CheZ-rLuccC into pSB1C3 (5 fragments)
• rLucN-rLucC into pSB1C3 (negative control) (3 fragments)
• CheY-fLucN-CheZ-fLucC into pSB1C3 (5 fragments)
• fLucN-fLucC into pSB1C3 (negative control) (3 fragments)

 

 

3 Experiment 3: Gibson assembly

Purpous: to obtain the following final constructs:

• CheY-fLucN-CheZ-fLucC into pSB1C3 (5 fragments) → fYNZC
• CheY-rLucN-CheZ-rLuccC into pSB1C3 (5 fragments) → rYNZC
• fLucN-fLucC into pSB1C3 (negative control) (3 fragments) → fLucNfLucC
• rLucN-rLucC into pSB1C3 (negative control) (3 fragments) → rLucNrLucC

3.1Material and methods

We followed the protocol “Gibson Assembly Master Mix” from BioLabs, for 4-6 fragments. (Total amount of fragments should be 0.2-1pmols)

The tubes were prepared according to the following table:

 

uL	1	2	3	4	5 (neg control)
Fragment 1	0.44 (CheY)	0.44 (CheY)	0.89 (fLucNneg)	0.96 (rLucNneg)
Fragment 2	0.81 (fLucN)	0.39 (rLucN)	0.45 (fLucCneg)	0.68 (rLucCneg)
Fragment 3	0.58 (CheZ)	0.58 (CheZ)
Fragment 4	0.37 (fLucC)	0.48 (rLucC)
pSB1C3 (opened)	1.27	1.27	1.27	1.27	1.27
MasterMix	10	10	10	10	10
Deionized Water	6.53	6.84	7.39	7.09	18.73

The tubes were then incubated in a thermocycler according to the protocol.

Competent cells were transformed with the products, plated (2 plates for each construct) and incubated overnight.

3.2Results

3.2.1Data

3.2.2Interpretation

All the plates had a lot of colonies, except for the negative control, which had a lot less, as expected, as it was transformed with linear fragments. The remaining colonies can be due to some vectors that have been used for the PCR amplification and that stayed circular.

 

4 Experiment 4: Gibson inoculation

Purpose of the experiment: Pick up transformed single colonies in order to obtain the plasmids of our final constructs.

4.1Material and methods

Procedure:

Pick one colony with a tip (best = small colonies)

Agitate the tip in 1uL nuclease free water, then heat-shock the tubes for 10 min at 95° (→ colony PCR, see experiment 3)

Drop the tip in 3mL LB chloramphenicol and incubate overnight at 37°C, 180rpm (→ Minipreps + Glycerol stocks, see exp 4)

Plate 1A → tubes 1-5 Plate 1B → tubes 6-10

Plate 2A → tubes 11-15 Plate 2B → tubes 16-20

Plate 3A → tubes 21-25 Plate 3B → tubes 26-30

Plate 4A → tubes 31-35 Plate 4B → tubes 36-40

Plate Neg → tubes C1-4

 

4.2Results

Results for the colony PCR will be discussed in the third part.

 

 

5 Experiment 5: Colony PCR

Purpose of the experiment: We want to verify that the transformed cell contain the construct of interest.

5.1Material and methods

Protocol for 25uL reaction (with TAQ Polymerase)

• 2.5uL 10x ThermoPol buffer
• 0.5uL 10mM dNTPs
• 0.125uL Taq DNA Polymerase
• 1uL template DNA (from heat-shocked tubes)
• 0.5uL forward primer
• 0.5uL reverse primer
• 19.875uL nuclease free water

 

PCR program:

• Initial denaturation: 30 sec at 95°C
• 30 cycles: 10-30 sec at 95°C
• 15-60 sec at 45-68°C (annealing temperature (A.T.))
• 1 min/kb at 68°C
• Final extension: 5 min at 68°C
• Pause at 4°C

 

Program used:

• CHETAQON (A.T. 54°C, ext. time 3 min) → tubes 1 to 10 + C1, primers CheY for / fLucC rev
• CHETAQTW (A.T. 51°C, ext. time 2 min) → tubes 11 to 20 + C2, primers CheY For / rLucC rev
• CHETAQTH (A.T. 52°C, ext. time 2 min) → tubes 21 to 30 + C3, primers fLucN for / fLucC rev
• CHETAQFO (A.T. 51°C, ext time 1 min) → tubes 31 to 40 + C4, primers rLucN for / fLucC rev

Rem: control tubes were prepared the same way (1uL from heat shocked tubes + 0.5 from each primers)

The PCR products were analyzed by gel electrophoresis (1.2% agarose gels. 2uL PCR reaction + 8 uL water + 2uL 6X loading dye. The ladder that was used was 1kb ladder)

 

 

5.2Results

5.2.1Data

 

 

3.2.2Interpretation

For the construct with firefly luciferase, (fYNZC)none of the colonies had the right insert* with the expected size of 2887 bp (firefly). For the construct with renilla, lane 11 revealed a good colony with the right insert of the expected size of 2101 bp (renilla).

For the split luciferases, tubes 21, 24, 25, 26, 27, 28, 29 and 30 (split fLuc) have the good insert (1750 bp), as well as 31, 32, 33, 34, 35, 36, 38, 39 and 40 (split rLuc) (964 bp).

We will send samples 26 and 33 for sequencing. We will pick other colonies in order to obtain a colony with the construct.

6 Experiment 6: Minipreps of negative controls

Purpose of the experiment: Make minipreps of the negative controls (split alone)

6.1Material and methods

Cf. Miniprep kit from Qiagen

Done on 5mL pelleted cultures from tubes 11, 21, 24, 26, 27, 28, 29, 31, 32, 33 34, 35, 36, 38, 39, 40 (in big centrifuge)

DNA concentration was determined using the Nanodrop Spectrophotometer.

6.2Results

6.2.1Data

Sample	Concentration [ng/uL]	260/280	260/230
11	320.3	1.94	2.12
21	390.1	1.95	2.14
24	482.4	1.94	2.23
26	494.1	1.94	2.27
27	795.4	1.95	2.3
28	578.1	1.94	2.23
29	381.9	1.92	2.16
31	543.8	1.93	2.13
32	401.6	1.94	2.27
33	442.3	1.94	2.3
34	429.2	1.94	2.31
35	436.1	1.92	2.17
36	753.2	1.92	2.24
38	230	1.84	1.96
39	525.7	1.94	2.19
40	271	1.92	1.89

 

6.2.2Interpretation

Concentration were very good.

1 Experiment 1: Gibson Assembly (GA) and PCR Colonies

 

1 Experiment 1: Colony PCR (cont.)

Purpous: Retry a colony PCR to obtain the constructs of interest.

1.1Material and methods

We should pick colonies from the most efficient plate.

20 colonies were picked from plate 1B → tubes 1-20

10 colonies were picked from plate 2B → tubes 21-30

 

 

Same protocol as the week before for Colony PCR

CHETAQON → tubes 1 to 20 + C1 (primers = CheY for/fLucC rev)

→ tubes +1 to +4 (primers = openers 1 & 2)

CHETAQTW → tubes 21 to 30 + C3 (primers = CheY for/rLucC rev)

→ tubes +5, +6 (primers = openers 1 & 2)

 

1.2% Agarose gels were used for analysing the samples. The ladder used was 1kb plus ladder →

1.2Results

1.2.1Data

 

1.2.2Interpretation

For the construct with Renilla (gel on the right), it seems that lane 26 is a sample containing the expected insert (2101 bp). Miniprep will be done on this tube.

We have to pick other colonies for the construct with Firefly luciferase, as none of the picked colonies seemed to contain the right insert.

2 Experiment 2: Sequencing

Purpose of the experiment: To verify that the inserts don't have any mutations.

2.1Material and methods

Sequencing was done on tubes 26 for fLucNfLucC and 33 for rLucNrLucC

 

FlucNFlucC:

Primer pBAD for → 736 bp

SEQUENCING_Fluc_Middle → 619 bp

FlucC_pSB1C3_Forward_PCR_SN → 456 bp

 

RlucNRlucC:

primer pBAD for → 458 bp

rLucC_pBAD33_forward_PCR_SN → 583 bp

 

Sequencing on tube 26 for rYNZC

Primer pBAD For → 562 bp

rLucN_pBAD33_forward_PCR_SN → 327 bp

Ec_CheZ_pSB1C3_forward_PCR_SN → 658 bp

rLucC_pBAD33_forward_PCR_SN → 583 bp

2.2Results

2.2.1Data

[SEQUENCING RESULTS]

2.2.2Interpretation

 

 

3Experiment 3: Colony PCR (cont.)

Purpose of the experiment: Find a colony that has the right insert for Firefly construct

3.1Material and methods

PCR on firefly construct

20 colonies were picked from plate with firefly construct → tubes 1 to 20

Same protocol as the week before for Colony PCR

primers: CheY_for with FlucN_rev

CHETAQA , annealing temperature 52°C

3.2Results

 

3.2.1Data

 

3.2.2Interpretation

The expected size of 2887 seems to appear on lane 17: this sample should contain the right insert with firefly luciferase construct. The other ones are not valid.

1        Gibson assembly and Colony PCR of GA3 (IFP1 at the N terminal of CPXR and IFP2 at the C terminal of CPXR)

Last time we tried we obtained only colonies containing either only IFP1-CPXR either IFP2-CPXR.

1.1       Material and methods

Gibson assembly kit and Taq polymerase (see protocols)

1.2       Results

1.2.1     Data

1.2.2     Interpretation

The ladder doesn’t allow us to see precisely the size of the plasmid. Moreover, the colony PCR didn’t work very well as we obtained a lot of unspecific bands. Mini-prep will be necessary to analyse our Gibson assembly product.

 

2        Restriction analysis of GA3

Digestion of our Gibson assembly product GA3 (IPF1 at the N terminal of CPXR and IFP2 at the C terminal of CPXR,) to see which plasmids contain the expected insert.

2.1       Material and methods

Restriction digestion with NheI and SpeI (see protocols)

2.2       Results

2.2.1     Data

2.2.2     Interpretation

Expectation with both fragments: 3273bp + 2535 bp: Colonies 9 and 10

Expectation with only IFP1-CPXR: 3273 bp + 1110 bp: Colonies 4 and 8

Expectation with only IFP2-CPXR: 3273 bp + 1394 bp: Colonies 1, 2, 3, 5, 6, 7

 

We obtained two plasmids that seem to contain IFP1-CPXR (N terminal) and IFP2-CPXR (C terminal)

3        GA2, GA3 and GA4 sequencing

Restriction analyses of these 3 plasmids are thought to contain the expected fragments, but sequencing is necessary to see if they contain any mutations

3.1       Material and methods

Microsynth barcodes

3.2       Results

3.2.1     Data

GA2: no mutation

GA3: no mutation

GA4: no mutation (one deletion in the promoter, not important)

3.2.2     Interpretation 

We obtained our expected products for GA2, GA3, GA4

 

 

 

1Experiment 1: Verification PCR

Purpous: Verification in the constructs fYNZC and rYNZC to verify that the right inserts were present

1.1Material and methods

Done on minipreps of tubes 17 (fYNZC) and 26 (rYNZC)

1.2Results

 

1.2.1Data

 

1.2.2Interpretation

The expected fragments were obtained for rYNZC construct. As the first gel wasn't clear for fYNZC, we did an other one, which gave fragments that are all explained and expected.

We see different bands. The top one in all lanes is the whole plasmid. For lane 7, fLucN_rev primer also binds in fLucC → 2000bp instead of 1245. Lane 8: fLucC_for primer also binds to the end of fLucN → 1252 bp instead of the expected 474. Lane 4: we only obtain the “opened” primers in addition to the initial primer.

 

2Experiment 2: Restriction analysis

Purpose of the experiment: Restriction enzyme digestion of rYNZC and fYNZC in order to confirm the presence of our constructs in each plasmid, using enzymes NheI and SpeI

2.1Material and methods

Restriction digest:

uL	FYNZC – sample 17	RYNZC – sample 26
Template DNA (500 ng)	1.47	1.59
NheI	0.5	0.5
SpeI	0.5	0.5
Smart Cut Buffer	5	5
Water	42.53	42.41
Total reaction volume	50	50

 

Samples were heated for 60 minutes at 37°C before being run on a gel.

2.2Results

 

2.2.1Data

 

 

2.2.2Interpretation

The expected sizes of fragments are observed. 

Conclusion

The plasmids can be sent for sequencing.

 

 

3 Experiment 3: Bioluminescence assay 3

Purpous: We want to check if our constructs work.

3.1Material and methods

Overnight cultures were prepared from glycerol stocks of fYNZC (tube 17), rYNZC (tube 26), fLucNfLucC (tube 26-), rLucNrLucC (tube 31-), fLuc (EPIC Firefly) and rLuc (rLuc from Waldor's lab) into 5mL LB-Chloramphenicol.

50mL of overnight cultures were transferred into 5mL fresh chloramphenicol containing 1mM arabinose. These sample were incubated for 4 hours at 37°C, 180rpm shaking, to an OD ~1.

Cultures were centrifuged, medium was discarded, cells were washed once with PBS.

The substrate (coelenterazine (clz) for renilla Luciferase and d-luciferin (d-luc) for firefly Luciferase) were prepared in aliquots of 100uM and were added at 4 different concentrations (7.5uM, 15uM, 22,5uM, 30uM).

A white opaque 96-Well plate was loaded as following. Samples were loaded in triplicate, in a total volume of 200uL contaning 140uL of culture, ajusting the OD to 0.7:

 

uL	Clz	D-luc	Culture (OD 1)	PBS
A/C/E 1-3	15		140	45
A/C/E 4-6	30		140	30
A/C/E 7-9		15	140	45
A/C/E 10-12		30	140	30
B/D/F 1-3	45		140	15
B/D/F 4-6	60		140	0
B/D/F 7-9		45	140	15
B/D/F 10-12		60	140	0

Substrates for luciferins were added at the end.

After ~10 minutes RT incubation, the plate was read by a plate reader (1CPS) every 4 minutes.

 

Lanes A & B: constructs

Lanes C & E: negative controls (split luciferases alone)

Lanes D & F: positive controls (luciferases)

 

3.2Results

3.2.1Data

Figure 1: Graph of the Luminescence of the constructs with Renilla Luciferase and of the corresponding negative controls (each with 4 different substrate concentration) in function of the time. RYNZC stands for the construct EcCheY_rLucN_EcCheZ_rLucC, and RlucNrLucC stands for the split luciferase alone. “clz” is for coelenterazine.

 

Figure 2: Graph of the Luminescence of the constructs with Firefly Luciferase and of the corresponding negative controls (each with 4 different substrate concentration) in function of the time. FYNZC stands for the construct EcCheY_fLucN_EcCheZ_fLucC, and flucNfLucC stands for the split luciferase alone. “luc” is for luciferin

 

Figure 3: Graph of the luminescence of the positive and negative controls for Renilla Luciferase (each with 4 different substrate concentration) in function of the time.

 

Figure 4: Graph of the luminescence of the positive and negative controls for Firefly Luciferase (each with 4 different substrate concentration) in function of the time.

 

Figure 5: Graph of the Luminescence of the constructs with Renilla Luciferase (rYNZC) and Firefly Luciferase (fYNZC) in function of the different concentrations of substrate (coelenterazine for rLuc and luciferin for fLuc).

 

Figure 6: Graph of the Luminescence of the positive and negative controls with Renilla Luciferase and Firefly Luciferase in function of the different concentrations of substrate (coelenterazine for rLuc and luciferin for fLuc).

 

3.2.2Interpretation

As the signal detected in the plates containing our constructs was lower than the negative control, we conclude that our construct didn't work.

The problem might come from the fact that as the dimerization of CheY and CheZ should only happen in the absence of chemoattractants, it has not worked because of the presence of an attractant. This could have happened, as arabinose was used to induce the gene, and as the cells were washed only once with PBS. The next experiment should be done after more wash steps, to get rid of the arabinose.

However, the positive and negative controls of our experiment gave good results. The gap between the positive and negative controls is quite big, and it seems that the substrate concentration affects the activity of both luciferases.

We see that firefly luciferase seems to be better than renilla, because the gap between + and – controls is bigger and because it seems to be more sensitive to a substrate concentration gradient. We should consider these results for the choice of the Luciferase we will use for the rest of the project.

 

 

4 Experiment 4: Bioluminescence assay 4

Purpous: To test our constructs by measuring their relative emitted bioluminescence.

4.1Material and methods

Overnight cultures were prepared from glycerol stocks of unstransformed DH5 alpha, fYNZC (tube 17), rYNZC (tube 26), fLucNfLucC (tube 26-), rLucNrLucC (tube 31-), fLuc (EPIC Firefly) and rLuc (rLuc from Waldor's lab) into 5mL LB-Chloramphenicol.

50mL of overnight cultures were transferred into 5mL fresh chloramphenicol containing 1mM arabinose. These sample were incubated for 4 hours at 37°C, 180rpm shaking, to an OD ~1.

Cultures were centrifuged, medium was discarded, cells were washed three times with PBS.

The substrate (coelenterazine (clz) for renilla Luciferase and d-luciferin (d-luc) for firefly Luciferase) were prepared in aliquots of 100uM and added at 30 uM (d-luc) and 22.5uM (clz).

 

A white opaque 96-Well plate was loaded as following. Samples were loaded in triplicate, in a total volume of 180uL contaning 120uL of culture, ajusting the OD to 0.7:

 

4.2Results

 

4.2.1Data

 

 

Figure 1: (A) Graph of bioluminescence of different cultures with 22.5uM d-luciferin. F-PBS = PBS, DH5-alpha = untransformed competent cells, split fLuc = split Firefly Luciferase, fLuc = Firefly Luciferase, fYNZC = construct with CheY-fLucN-CheZ-fLucC. (B) Graph of bioluminescence of different cultures with 30mM coelenterazine. R-PBS = PBS, DH5-alpha = untransformed competent cells, split rLuc = split Renilla Luciferase, rLuc = Renilla Luciferase, fYNZC = construct with CheY-fLucN-CheZ-fLucC.

 

 

Figure 2: (A) Graph of bioluminescence of different cultures, with 22.5uM d-luciferin, without positive control. Same legend as 1A. (B) Graph of bioluminescence of different cultures, with 30uM coelenterazine, without positive control. Same legend as 1B.

 

Figure 3: Comparison of bioluminescence of the two constructs, with Firefly Luciferase (with 22.5uM d-luciferin) and Renilla Luciferase (with 30uM coelenterazine).

 

Figure 4: Comparison of bioluminescence of the positive and negative controls with Firefly Luciferase and Renilla Luciferase

 

4.2.2Interpretation

The obtained values are as expected for the controls, compared to the blanks with PBS and unstransformed competent cells. The values of our constructs being a bit lower than the negative controls, these results are not as good as expected. However, there is a good hope that our constructs can work, as their signals are higher than the blanks.

Conclusion

We have to try again with Waldor construct (pYNZC, with proteins from Vibrio Cholerae). We will do more steps of wash with PBS.

1        Gibson assembly and Colony PCR of GA1

To fuse CPXR-IFP1 and CPXR.IFP2 and analyse the products by colony PCR

1.1       Material and methods

Gibson assembly kit and Taq polymerase (see protocol)

1.2       Results

1.2.1     Data

1.2.2     Interpretation

None of our colony contains our expected product. Colonies 1, 3, 5, 6, 8 only contain IFP2-CPXR, and the other ones only contain IFP1-CPXR, which are our PCR templates. We should have done our PCR with a lower amount of DNA template. It results that our Gibson assembly product contains a lot of DNA template, decreasing the probability to have bacteria transformed by our expected product. We will do the PCR again with a lower amount of DNA template. (Gibson assembly kit recommends a DNA template of 0.1-0.5 ng and we used 10 ng)

2       Gibson assembly and of GA1: 2^nd try

We tried again the Gibson assembly once we did the PCR again with a lower amount of DNA template.

2.1       Material and methods

Gibson assembly kit and Taq polymerase (see protocol)

2.2       Results

2.2.1     Data

2.2.2     Interpretation

It seems that all our colonies contain the expected fragement. Restriction analysis will confirm it

3        Restriction analysis of GA1

To see if our GA1 product contains the expected fragment

3.1       Material and methods

NheI and SpeI restriction enzymes. (See protocol)

3.2       Results

3.2.1     Data

3.2.2     Interpretation

 

 We finally obtain our GA1 product (IFP1 and IFP2 at the C terminal of CPXR) in all the colonies (except the 11th). Sequencing will confirm it.

4        GA1 sequencing

To see if our GA1 product contains any mutation

4.1       Material and methods

Microsynth barcodes

4.2       Results

4.2.1     Data

No mutation occured.

Experiment 1: Arabinose promoter characterization

1.1       Material and methods

Cells with sfGFP CpxR & CpxR sfGFP constructs were cultured in different concentrations of arabinose to check the functionality of the promoter. The concentration of arabinose per sample is indicated in Table 1.

Sample	uM Ara	uL Ara	ml LB-chl	tube 96-w        plate
A	0	0	5	A	1
B	5	0.025	5	B	2
C	10	0.05	5	C	3
D	50	0.25	4.9998	D	4
E	100	0.5	4.9995	E	5
F	500	2.5	4.9975	F	6
G	1000	5	4.995	G	7
H	5000	25	4.975	H	8
I	10 000	50	4.95	I	9
J	50 000	250	4.75	J	10
K	100 000	500	4.5	K	11
L	500 000	2500	2.5	L	12
+	0	0	5	+
-	5000	25	4.975	-

Table 1 - This table shows the concentration of Arabinose in each sample, as well as the quantity of medium and of Arabinose needed to reach it.

The negative control was the medium without cells, and the positive control was a sample of cells expressing sfGFP contitutively.

 

Procedure

Cells from glycerol stocks were grown in 3 mL LB selective medium (chloramphenicol) during 3h (37 ºC & shaking).

50 uL of cells were resuspended in a total volume of 5 mL of LB-chloramphenicol and Arabinose and incubated 5h at 37 ºC with shaking until an OD of ~1 was reached.
The samples were then washed twice with PBS to a final OD of 0.4 - 0.5.

 

Table 2 shows the quantity of PBS added to each sample (depending on the OD), as well as the OD after both PBS washes. This information is used to normalize the plate reader results.

tube 96-w         plate		OD N ter	PBS N	OD PBS	OD C ter	PBS C	OD PBS	tube 96-w        plate
A	1	1.136	10.5	0.281	1.224	11	0.369	A	1
B	2	1.071	10	0.402	1.061	10	0.384	B	2
C	3	1.014	10	0.360	1.082	10	0.332	C	3
D	4	1.098	10	0.342	1.068	10	0.393	D	4
E	5	1.016	10	0.346	1.07	10	0.338	E	5
F	6	1.038	10	0.349	1.06	10	0.351	F	6
G	7	0.912	9.5	0.336	1.06	10	0.314	G	7
H	8	0.686	7	0.316	1.028	10	0.307	H	8
I	9	0.645	7	0.314	0.999	10	0.305	I	9
J	10	0.52	6	0.305	0.918	9.5	0.281	J	10
K	11	0.449	5	0.281	0.822	9	0.285	K	11
L	12	0.315	4	0.296	0.505	6	0.248	L	12
+		1.117	10	0.283	-	-	-	+
-		0.005	10.5		-	-	-	-

 Table 2 - OD measurments of the samples can be seen, as well as the OD after the PBS washes.

Results

1.4.1     Data

https://static.igem.org/mediawiki/2014/0/06/Sfgfpcpxr_gradient.jpg

Figure 1 - Photo of the pelleted samples between PBS wash steps 1 and 2.

As can be seen in the image, there is a gradient of fluorescence intensity.

The results of the plate reader are depicted in Figure 2.

https://static.igem.org/mediawiki/2014/f/f5/Twotermscpxrgfp.jpg

Figure 2 - Graphs of the intensity curves of the samples. Cterm corresponds to CpxR sfGFP (sfGFP attached to CpxR's C temrinus) and Nterm corresponds to sfGFP CpxR.

1.4.2     Interpretation

As can be seen in the graph, the the results of the sfGFP CpxR sample was much better (closer to the expected results) than the one on the CpxR sfGFP, although in general, the curves grow.

It could be seen that adding too much arabinose decreases viability, so we considered that a concentration of 5 mM was the optimum arabinose concentration.

 

1 Experiment 1: Bioluminescence assay 5

Purpous: We want to test our constructs by measuring the emitted bioluminescence with a plate reader

1.1 Material and methods

Overnight cultures were prepared from glycerol stocks of unstransformed DH5 alpha, fYNZC (tube 17), rYNZC (tube 26), pYNZC (received from Waldor's lab) fLucNfLucC (tube 26-), rLucNrLucC (tube 31-), fLuc (EPIC Firefly) and rLuc (rLuc from Waldor's lab) into 5mL LB-Chloramphenicol.

50mL of overnight cultures were transferred into 5mL fresh LB (+ chloramphenicol, except for untransformed DH5 alpha) containing 1mM arabinose. These sample were incubated for 3 hours at 37°C, 180rpm shaking, to an OD ~1.

Cultures were centrifuged, medium was discarded, cells were washed five times with PBS.

The substrate (coelenterazine (clz) for renilla Luciferase and d-luciferin (d-luc) for firefly Luciferase) were prepared in aliquots of 100uM and added at 30 uM (d-luc) and 22.5uM (clz).

 

A white opaque 96-Well plate was loaded as following. Samples were loaded in triplicate, in a total volume of 180uL contaning 120uL of culture, ajusting the OD to 0.7:

Measures were taken for 1h every 2 minutes with the plate reader Tekan Infinite.

 

 

1.2 Results

As shown in the graphs below (fig.1A and 1B), we couldn't really observe a high signal for our complementation assay. However, the signal being higher than the blanks, it is an encouraging sign that the splits luciferase can be used for other experiments of this kind. A possible explanation for these results is that arabinose being a chemoattractant, we might need to do more wash steps with PBS to get rid of the arabinose before taking the measurements. Moreover, CheY and CheZ being endogenously expressed in bacteria, the edogenous proteins could interfere with our fusion proteins and weaken our signal. This complementation assay should be tested with CheY/CheZ knock out strains, as it was done in Waldor Laboratory.

We also could determine which of the luciferases would best suit our following experiments. As shown in fig. 2, for the same concentration of substrate, we see that firefly luciferase has a more stable and higher signal. Moreover, the difference between the background noise (negative control, non fused split luciferase) and the full luciferase is bigger for Firefly luciferase, which is also preferable.

$

1.2.2 Interpretation

 

 

 

1. Experiment 1: amplification of fragments of interest

Purpous: We want to amplify the fragments of interest from different vectors in order to make the following constructs:

Fig1A: Vector of zipper-rLucN + zipper-rLucC Fig1B: Vector of zipper-fLucN + zipper-fLucC

 

The sequences will be amplified with overlapping fragments in order to further do a fusion PCR (exp. 2).

 

1.1 Material and methods

 

Material:

Phusion PCR kit

The following primers: zip01, zip03, zip06, zip04, zip07, zip08, zip09, zip11, zip12, zip14, zip15, zip17, zip18 (see Sequences/Primers on Google drive)

Vectors: zip_IFP1m rlucNrLucC (from Waldor's lab), EPIC Firefly

PCR purification kit (Qiagen)

Nanodrop spectrophotometer

 

Procedure:

 

Reaction set up:

 

PCR	Fragment	Template	Primer for	PRimer rev	Amp. size (bp)	A. temp (°C)	Programme
1	Zip + fusion OL1 for Ren	zip_IFP1	zip01	zip03	200	71	1
2	Zip + fusion OL2 for Ren	zip_IFP1	zip01	zip06	200	71	1
3	Zip + fusion OL1 for Fir	zip_IFP1	zip01	zip04	200	71	1
4	Zip + fusion OL2 for Fir	zip_IFP1	zip01	zip07	200	71	1
5	RLucN + fusion OL1	rlucNrlucC (Waldor)	zip08	zip09 1:	340	72	1
6	RLucC + fusion OL2	rlucNrlucC (Waldor)	zip11	zip12	621	71	1
7	FlucN + fusion OL1	EPIC Firefly	zip14	zip15	1263	69	2
8	FlucC + OL2	EPIC Firefly	zip17	zip18	498	69	3

 

 

Each sample was done for 50uL of reaction. See protocol for phusion PCR for detailed quantities.

 

 

Thermocycling programs:

 

 

Initial denaturation	98°C	30 seconds
30 cycles	98°C	10 seconds
	71°C	30 seconds
	72°C	30 seconds
Final Extension	72°C	10 min
stop	4°C

 

2:

 

Initial denaturation	98°C	30 seconds
30 cycles	98°C	10 seconds
	69°C	30 seconds
	72°C	1 minute
Final Extension	72°C	10 min
stop	4°C

 

3:

 

Initial denaturation	98°C	30 seconds
30 cycles	98°C	10 seconds
	69°C	30 seconds
	72°C	30 seconds
Final Extension	72°C	10 min
stop	4°C

 

 

After PCR, the products were purified according to the Qiagen PCR purification kit. Samples were analyzed by agarose gel electrophoresis

 

1.2 Results

1.2.1 Data:

Fig2A: Gel of the PCR for the amplification of the overlap fragments for fusion PCR

 

Caption: (lanes)

1: Quick-load DNA marker

2: Zip + fusion OL1 for Ren

3: Zip + fusion OL2 for Ren

4: Zip + fusion OL1 for Fir

5: Zip + fusion OL2 for Fir

6: RLucN + fusion OL1

7: RLucC + fusion OL2

8: FlucN + fusion OL1

9: FlucC + fusion OL

 

 

Fig2B: Gel of the PCR for the amplification of rLucN + fusion OL1 (second trial, with all 4 samples of split renilla luciferase we received from Waldor's lab)

 

 

Caption: (Lanes)

2: Quick-load DNA marker

3: RLucN + fusion OL1 (1)

4: RLucN + fusion OL1 (2)

5: RLucN + fusion OL1 (3)

6: RLucN + fusion OL1 (4)

 

Fig3A: Nanodrops of purified PCR products

 

Fig3B: Nanodrops of purified PCR products (rLucN + fusion OL1 only, second trial)

 

 

1.2.2 Interpretation:

There is nothing in the lane 5 in fig 2A, the PCR for RlucN+fusion OL1 didn't work. We tried it again with all the samples of split rLuc we had (which gave the gel in fig 2B) and obtained the right fragment in all 4 samples.

All the other obtained fragments have the expected size, so we can continue our experiments to obtain the 2 vectors we want.

 

 

 

 

2. Experiment 2: fusion PCR

Purpous: We want to perform a fusion PCR to obtain the following products: zipper + rLucN, zipper + rLucC, zipper + fLucN and zipper + fLucC

 

2.1 Material and methods

 

Material:

Phusion PCR kit

Primers: zip02, zip10, zip05, zip13, zip16, zip19 (see Sequences/Primers on Google drive)

PCR products from previous experiment

PCR purification kit (Qiagen)

Nanodrop spectrophotometer

 

Procedure:

 

Each sample was done for 50uL total volume reaction. See protocol for phusion PCR for detailed quantities to add. The first PCR (part A) is done without primers, for 15 cycles. Primers are add before part B

 

Reaction set up:

 

 

	1	2	3	4	5	6	7	8	Water
Tube 1	0.32µl	---	---	---	1.86µl	---	---	---	32.68µl
Tube 2	---	0.2µl	---	---	---	1.72µl	---	---	32.77µl
Tube 3	---	---	0.21µl	---	---	---	0.61µl	---	31.32µl
Tube 4	---	---	---	0.28µl	---	---	---	0.45µl	31.58µl

 

Master Mix: (for 5 samples): 50µl 5X Buffer, 5µl dNTPs, 2.5 µl polymerase

 

Thermocycling programs:

 

4A

Initial denaturation	98°C	30 seconds
15 cycles	98°C	10 seconds
	60°C	30 seconds
	72°C	45 seconds
Final Extension	72°C	10 min
stop	4°C

 

5A

Initial denaturation	98°C	30 seconds
15 cycles	98°C	10 secon
	60°C	30 seconds
	72°C	9 seconds
Final Extension	72°C	10 min
stop	4°C

 

4B

Initial denaturation	98°C	30 seconds
15 cycles	98°C	10 seconds
	72°C	30 seconds
	72°C	45 seconds
Final Extension	72°C	10 min
stop	4°C

 

5B

Initial denaturation	98°C	30 seconds
15 cycles	98°C	10 seconds
	72°C	30 seconds
	72°C	90 seconds
Final Extension	72°C	10 min
stop	4°C

 

After the PCR, the products were purified. The concentration of DNA was determined with the nanodrop spectrophotometer. The fragments were verified by agarose gel electrophoresis

Changes in PCR program for sample 4 (as it didn't work as expected the first time)

 

6A

Initial denaturation	98°C	30 seconds
15 cycles	98°C	10 seconds
	59°C	30 seconds
	72°C	45 seconds
Final Extension	72°C	10 min
stop	4°C

 

6B

Initial denaturation	98°C	30 seconds
15 cycles	98°C	10 seconds
	73°C	30 seconds
	72°C	45 seconds
Final Extension	72°C	10 min
stop	4°C

2.2 Results

2.2.1 Data:

Fig 4A: Gel of the fusion PCR

 

Caption

Lane 2: ladder quick-load DNA marker

Lane 3:Zip-rLucN

Lane 4:Zip-rLucC

Lane 5: Zip-fLucN

Lane 6: Zip-fLucC

 

 

 

 

 Fig 4B: Gel of the fusion PCR for sample 4 only (second trial)

 

Caption

Lane 3: ladder quick-load DNA marker

Lane 4: Zip-fLucC

 

 

 

 

Fig5A: Nanodrops of purified PCR products

 

Fig5B: Nanodrop of purified PCR product (sample 4 only)

 

2.2.2 Interpretation:

The first gel shows that the first three fusion PCR have been successful, as we obtain the expected sizes. We retried a PCR (changing the program) for sample 4, which was then successful too. The fragments are now ready for a Gibson assembly

 

 

3. Experiment 3: Gibson assembly

 

Purpous: We want to perform a Gibson assembly with the previous prepared fragments, in order to obtain the vectors from fig 1A and 1B

 

2.1 Material and methods

 

Material:

PCR products from previous experiment

Vector (opened) BB3 (69.6 [ng/uL])

Competent cells

Gibson assembly master mix

Taq polymerase kit

 

Procedure:

 

GA1: zip-rLucN + zip-rLucC

GA2: zip fLucN + zip-fLucC

 

We put 50 ng of vector (BB3, 69.6ng/uL) and 150ng of insert.

Reaction set up :

[uL]	Vector (BB3)	Zip-rLucN	Zip-rLucC	Zip-fLucN	Zip-fLucC	MasterMix	Water	Total
GA1	0.72	1.16	0.97			10	7.15	20
GA2	0.72			1.05	1.45	10	6.78	20

 

We transformed the competent cells according to the protocol from Neb

Cells were plated onto 2 plates per Gibson Assembly reaction (GA1 A&B, GA2 A&B)

 

The following day (04.09.14), we picked 4 colonies from each plate, for subsequent colony PCRs and cultures. The tips which picked the colonies were agitated into 10uL water and then dropped into 5mL LB chloramphenicol. Cells were cultured for 6 hours for subsequent glycerol stocks preparation and minipreps. The cells in water were heat shocked for 10 minutes at 95°C and used for colony PCR. The minipreps were used for restriction analysis.

 

 

COLONY PCR

 

Primers used for colony PCR:

GA1: zip01 and rLucC_rev

GA2: zip01 and fLucC_rev

 

Reaction Set Up: Taq Polymerase protocol

 

Colony PCR results:

 

 

 

[GEL]

 

 

 

Colonies GA1 A3 and GA2 A1, A2, B2, B3, B4 were discarded. As the colony PCR wasn't very clear, we did a restriction analysis the following day (05.09.14)

 

 

Restriction Analysis 1 (05.09.14)

Each sample was double digested with NheI and SpeI.

Sample preparation: 500ng of template DNA, 5uL of Cutsmart buffer, 0.5 uL of each restriction enzyme and water to 50uL. Samples were put at 37°C during one hour and then stored on ice to be load on agarose gel.

 

For GA1, we should obtain 2 fragments, of 3273 and 1356 base pairs. For GA2, we should obtain two fragments of 3273 and 2142 base pairs.

 

 

 

[GEL]

 

Conclusion:

The insert for GA2 seemed to be smaller than expected. At this point, we also decided to discard sample B3.

 

 

 

 

Restriction Analysis 2

We tried another restriction analysis. Each sample was used for a simple and a double digestion. We compared the obtained fragments to the supercoiled plasmids.

 

 

 

Reaction Set up

 

 

Sample	Name	NheI	Hind III	XbaI	Cutsmart Buffer	Template (500ng)	Water	Total
1	GA1 A1	0.5			5	2.81	41.69	50
2	GA1 A2	0.5			5	2.00	42.5	50
3	GA1 A4	0.5			5	2.71	41.79	50
4	GA1 B1	0.5			5	4.42	40.08	50
5	GA1 B2	0.5			5	2.50	42	50
6	GA1 B4	0.5			5	3.50	41	50
7	GA2 A3 <

	1	2
BBa_ K3396007	0.1 µl	0.1 µl
AD_01_00_fw	2.5 µl	2.5 µl
AD_01_00_rv	2.5 µl	2.5 µl
Mastermix	11.5 µl	11.5 µl
H2O	33.4 µl	33.4 µl
Total volume	50 µl	50 µl

 

PCR program :

                   Tem                 Time          repeat from step               repetitions

       1:         98 °C               30 s

       2:         98 °C               10 s

       3:         69 °C               30 s

       4:         72 °C               4 min               2                                 29

       5:         72 °C               10 min

 

 

1.2       Results

Expected (thoretical) Result :

 

Agarose gels (expected vs real):

           

 

Nano Drop results:

Sample NR	Product Name	Concentration	A260/A280	A260/A230
1	AD_01_00	45.8 ng/µl	1.88	2.24
2	AD_01_00	74.3 ng/µl	1.87	2.25

 

1.2.1     Interpretation

The fragments have the expected size. For further experiments Sample nr 2 will be used.

Experiment 2: PCR-product digestion with DPN1

The objective of this step is to digest the plasmids that served as a template, so they can not be transformed in later experiments.

2.1       Material and methods

• DpnI (NEB)
• Neb CutSmart buffer
• AD_01_00 (sample 2)
• PCR-purification Kit (Qiagen)

Tube nr	1
AD_01_00	8 µl
Dpn1	1 µl
Cutsmart buffer	1 µl
Total Volume	10 µl

Incubate at 37 °C for 30 min

Head-inactivation by incubating at 80 °C for 20 min

PCR-Purification (Qiagen)

2.2       Results

Sample NR	Concentration	A260/A280	A260/A230
AD_01_00	13.4 ng/µl	1.75	2.11

2.2.1     Interpretation

The concentration of any remaning plasmid in the sample would be to low to see on a gel. The concentration is very lowbut suffisient to run a PCR on it.

 

Experiment 3: PCR Amplification and Extention

The objective is to add the CpxR promoter to the linear sequence by PCR. The sequence is in the primers.

3.1       Material and methods

• Template: AD_01_00 (sample 2)
• Primers :
  • AD_01_01_fw
  • AD_01_01_rv
• Phiusion PCR Kit

 

	1	2
AD_01_00	0.1 µl	0.1 µl
AD_01_01_fw	2.5 µl	2.5 µl
AD_01_01_rv	2.5 µl	2.5 µl
Mastermix	11.5 µl	11.5 µl
H2O	33.4 µl	33.4 µl
Total volume	50 µl	50 µl

 

PCR program :

       1:         98 °C               30 s

       2:         98 °C               10 s

       3:         69 °C               30 s

       4:         72 °C               4 min               2          29

       5:         72 °C               10 min

 

3.2       Results

Expected result :

 Gels (Theoretical vs real):

      

 

Nano Drop results:

Sample NR	Product Name	Concentration	A260/A280	A260/A230
1	AD_01_01	43.8 ng/µl	1.88	2.24
2	AD_01_01	77.3 ng/µl	1.87	2.25

 

3.2.1     Interpretation

Sample 2 will be used for the sitedirected mutagenesis

4        Experiment 3: site directed mutagenesis

The purpose of this experiment is to close the linear plasmid with a enzymatic reaction.

 

4.1       Material and methods

Materials:

• Q5® Site-Directed Mutagenesis Kit (NEB)
• AD_01_01 sample 2

 

Methode:

Sample name	AD_01
AD_01_01	1 µl
2X KLD Reaction Buffer	5 µl
10X KLD Enzyme Mix	1 µl
Nuclease free H2O	3 µl
Totol	10 µl

 Incubated for 5 min at RT.

 

4.2       Results

Expected Results:

 

Sequencing results of the CpxR Promoter in front of the RFP show that the matagenesis worked and that there ane no muations in the sequence of interest:

 

1        Experiment Plate reader with the repaired BBa_K339007

The aim of this experiment is to verifie if the biobrick workes the way it claimes to work

1.1       Material and Methods

96-Well plate

Cells with the BBa_K339007

DH5 α

PBS (1X)

KCl 80 mM

KCl 160 mM

10% Ethanol

20% Ethanol

 

After centrifuging the cells they where resuspended in PBS and then in each well of the plate there was put 50 µl of either cell type. The wells where then filled up with either kind of liquid (50 µl):

  

Cells	Name	Fill up (50 µl)	Stress
BBa_K339007 transformed	RFP -	PBS	No stress
BBa_K339007 transformed	RFP + 40 mM KCl	80 mM KCl	40 mM KCl
BBa_K339007 transformed	RFP + 80 mM KCl	160 mM KCl	80 mM KCl
BBa_K339007 transformed	RFP + 5% Ethanol	10 % Ethanol	5 % Ethanol
BBa_K339007 transformed	RFP + 10% Ethanol	20 % Ethanol	10 % Ethanol
DH5 α	Neg -	PBS	No stress
DH5 α	Neg + 40 mM KCl	80 mM KCl	40 mM KCl
DH5 α	Neg + 80 mM KCl	160 mM KCl	80 mM KCl
DH5 α	Neg + 5% Ethanol	10 % Ethanol	5 % Ethanol
DH5 α	Neg + 10% Ethanol	20 % Ethanol	10 % Ethanol

 

The plate was then put in the plate reader where for 3h every 5 min the OD and the fluorescence was measured (exitation: 555 nm ; emission : 632)

 

1.2       Results

 

Neg stands for negative control (cells lacking the RFP coding sequence).

 

1.3       Interpretation

We successfully improved the BBa_K339007 by putting the missing sequence in front of the RFP. With the further documentation we discovered that the promoter is not specific for dimerised CpxR.

 

2        Experiment. PCR Amplifie the Backbone for the Gibson

To obtain the necessary backbone for the assembly.

 

2.1       Material and methods

 

Template :                AD_01

Primers :                  AD_01_00_rv

                               NH_04_00_fw

Phusion PCR kit

 

	1	2
AD_01_00	0.1 µl	0.1 µl
NH_04_00_fw	2.5 µl	2.5 µl
AD_01_00_rv	2.5 µl	2.5 µl
Mastermix	11.5 µl	11.5 µl
H2O	33.4 µl	33.4 µl
Total volume	50 µl	50 µl

 

PCR program :

       1:         98 °C               30 s

       2:         98 °C               10 s

       3:         69 °C               30 s

       4:         72 °C               2 min               2          29

       5:         72 °C               10 min

 

3        Experiment 6 : Gibson assembly

To obtain a plasmid with RFP wiht the native promoter that is found in front of the CpxA and the CpxP

 

3.1       Materials and Methodes

Fragments :             NH_04_00 (sample 1)

                               NH_04_01

 

	Moles	Mass	NH_04_A	NH_04_B
NH_04_00	0.03 pmol	54.0 ng	0.72 µl	0.72 µl
NH_04_01	0.05 pmol	66.7 ng	3.3 µl	---
NH_04_02	0.05 pmol	66.7 ng	---	3.3 µl
H2O			5.98 µl	5.98 µl
Gibson Master Mix			10 µl	10µl
Total			20 µl	20 µl

 

Incubated samples at 50°C for 15 min according to the NEB protocol

 

3.2       Results

The resulting plasmids are the BBa_K1486049 (NH_04_00 + NH_04_01) and the BBa_K1486050 (NH_04_00 + NH_04_01)

Sequencing reveald that there where no mutations.

 

 

 

 

 

Characterisation of BBa_K1486049 and BBa_K1486050

To charcterise theyre behavior in response to stress those two biobricks and the BBa_K1486048 were put in PBS (negative control) and in PBS + 80 mM KCl (stress). The samples were loaded on a 96-well plate reader. The light emission (ex: 555 nm em: 632 nm) and the OD was measured during several houers.

Results

As we can see, there is no stress sensitivity. The improvement we made is that our promoter is no "leaky".

 

 

Primer librery

Primer name	Sequence (5’ -> 3’)
AD_01_00_fw	AAAGAGGAGAAATACTAGATGGCTTCCTCC
AD_01_00_rv	CTCTAGAAGCGGCCGCGA
AD_01_01_fw	atgacgtaatttctgcctctactagagAAAGAGGAGAAATA CTAGATGGCTTCCTCC
AD_01_01_rv	cagacgtcgctaatccatgactttacgttgttttacCTCTAGAAGCGGCCGCGA
NH_04_00	ATGGCTTCCTCCgaagacgttatc

 

Ordered sequences

Name	Sequence (5’ -> 3’)
NH_04_01	atgatttctggaatTCGCGGCCGCTTCTAGAGTTGCTCCCAAAATCTTTC TGTCGCGATTCAACGATAGAGAGTTTACGATTCAGGCTGCAAACA TGCGTCAGGGGGTGTAAAACAACGTAAAGTCATGGATTAGCGACG TCTGATGACGTAATTTCTGCCTCGGAGGTATTTAAACAATGGCTTCC TCCgaagacgttatcaaagagttca
NH_04_02	atgatttctggaatTCGCGGCCGCTTCTAGAGTGTTTAAATACCTCCGAGG CAGAAATTACGTCATCAGACGTCGCTAATCCATGACTTTACGTTGTT TTACACCCCCTGACGCATGTTTGCAGCCTGAATCGTAAACTCTCTAT CGTTGAATCGCGACAGAAAGATTTTGGGAGCAAATGGCTTCCTCCga agacgttatcaaagagt