|
|
(224 intermediate revisions not shown) |
Line 1: |
Line 1: |
| __NOTOC__ | | __NOTOC__ |
| + | {{CSS/Main}} |
| + | {{Team:Aachen/Stylesheet}} |
| {{Team:Aachen/Header}} | | {{Team:Aachen/Header}} |
| + | <span id="partners"></span> |
| | | |
- | {| cellpadding="10"
| + | =Our Work in the Lab= |
- | ! width="300" |
| + | |
- | ! width="*" |
| + | |
- | ! width="300" |
| + | |
- | |- border="0"
| + | |
- | | __TOC__
| + | |
- | | In order to detect the pathogens fast, specifically and inexpensively we are building sensor cells to detect these pathogens. These sensor cells can identify pathogens in very low concentration by responsing to specific extracellular molecules either secreted by or displayed on the pathogens. These molecules trigger a fast fluorescence response by our immobilized sensor cells which will be measured by our device.
| + | |
- | | [[File:Aachen_Cellock_standingup.png|300px]]
| + | |
- | |}
| + | |
| | | |
| + | <center> |
| + | <html><ul class="team-grid" style="width:1064px;"> |
| + | <!-- Overview --> |
| | | |
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/April" style="color:black"> |
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | preparation of competent cells |
| + | <br/><br/> |
| + | test on transformation efficiency |
| + | <br/><br/> |
| + | development of quenchers |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/2/2d/Aachen_14-10-10_April_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | More information will be available soon!
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/May" style="color:black"> |
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | development of quenchers |
| + | <br/><br/> |
| + | first transformation of BioBricks |
| + | <br/><br/> |
| + | test of BioBricks |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/67/Aachen_14-10-10_May_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | = April = | + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
- | == 1st == | + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/June" style="color:black"> |
- | '''Organisation'''
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | BioBrick transformation marathon |
| + | <br/><br/> |
| + | construction of first own BioBrick |
| + | <br/><br/> |
| + | processing of Biobricks |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/1/1d/Aachen_14-10-10_June_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | Where we can get:
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
- | * key cards and keys for the lab
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/July" style="color:black"> |
- | * cooled centifuge
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
- | * space in -80 °C
| + | <br/><br/> |
- | * bottles for 70 % ethanol
| + | <b> |
- | * ... (problems of a first year team ^^)
| + | preparation of 2D-detection chips |
| + | <br/><br/> |
| + | testing our chip system |
| + | <br/><br/> |
| + | development of chip measurement methods |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/1/19/Aachen_14-10-10_July_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | == 12th ==
| + | </ul></html> |
- | * make chemically competent NEB Top10, DH5α and BL21
| + | </center> |
| | | |
- | == 15th == | + | <center> |
- | * 800 mL LB for plates with 1,5% agar and kanamycin (50 µg/L) ([[User:StefanReinhold|Stefan]])
| + | <html><ul class="team-grid" style="width:798px;"> |
- | * test the efficiency of our competent cells ([[User:aschechtel|Anna]])
| + | <!-- Overview --> |
- | Colonies on the agar plates were counted after transformation with 147 ng/µL DNA and afterwards incubated in SOC or LB medium
| + | |
- | {| class="wikitable"
| + | |
- | ! Dilution !! 200 µL(stock) !! 100 µL (stock) !! 1:5 !! 1:10 !! 1:100 | + | |
- | |-
| + | |
- | | '''DH5α''' || SOC: 30 LB: 10 ||SOC: 7 LB: 1 || SOC: 1 LB: 2 || SOC: 2 LB: 1 ||
| + | |
- | |-
| + | |
- | | '''NEB Top 10''' || SOC: 170 LB: 135 ||SOC: 100 LB: 79 || SOC: 25 LB: 22 || SOC: 9 LB: 9 || SOC: 1 LB:0
| + | |
- | |-
| + | |
- | |}
| + | |
- | *BL21 all cells were centrifuged and plated. Only 128 colonies grew in total...very bad efficiency (~482.11)...
| + | |
| | | |
- | With the formula:
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
- | Efficiency = (CFU /µg DNA) / dilution
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/August" style="color:black"> |
- | *for DH5α: medial efficiency in SOC: 1864.36 and in LB: 440.68
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
- | *for NEB: medial efficiency in SOC: 6779.66 and in LB: 4698.30
| + | <br/><br/> |
- | *:'''With SOC the efficiency is much better!'''
| + | <b> |
| + | start of Gal3 approach |
| + | <br/><br/> |
| + | detection of HSL with chip system |
| + | <br/><br/> |
| + | testing of <i> Pseudomonas fluorescens </i> |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/4/4e/Aachen_14-10-10_August_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | == 22th == | + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/September" style="color:black"> |
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
| + | <br/><br/> |
| + | <b> |
| + | interlab study |
| + | <br/><br/> |
| + | construction of GFP-quencher-fusions |
| + | <br/><br/> |
| + | further devolopment of BioBricks |
| + | </b> |
| + | <br/><br/> |
| + | <!-- click for more information --> |
| + | </div> |
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/d/d4/Aachen_14-10-10_September_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
| + | </li> |
| | | |
- | '''Pcq lab PCR''' advanced primus 25, 96
| + | <li style="width:220px;margin-left: 23px;margin-right: 23px;margin-bottom: 23px;margin-top: 23px;"> |
- | {| class="wikitable"
| + | <a href="https://2014.igem.org/Team:Aachen/Notebook/Wetlab/October" style="color:black"> |
- | ! !! Lenght [bp] !! % GC !! T<sub>m</sub> !! T<sub>A</sub>
| + | <div class="team-item team-info" style="width:214px;height:214px;" > |
- | |-
| + | <br/><br/> |
- | | '''EYFP_RFC25''' || 778 || 61 || 84 || 56
| + | <b> |
- | |-
| + | working 24/7 |
- | | '''REACh1_C''' || 481 || 62 || 84 || 57
| + | <br/><br/> |
- | |-
| + | finalizing our project |
- | | '''REACh1_N''' || 320 || 59 || 82 || 54
| + | <br/><br/> |
- | |-
| + | Wiki |
- | | '''REACh2_C''' || 487 || 62 || 83 || 57
| + | </b> |
- | |-
| + | <br/><br/> |
- | | '''REACh2_N''' || 320 || 59 || 82 || 54
| + | <!-- click for more information --> |
- | |-
| + | </div> |
- | |}
| + | <div class="team-item team-img" style="background: url(https://static.igem.org/mediawiki/2014/6/60/Aachen_14-10-10_October_iFG.png); norepeat scroll 0% 0% transparent; background-size:100%;width:214px;height:214px;"> </div></a> |
- | | + | </li> |
- | Program name IGEM.cyc
| + | </ul></html> |
- | | + | </center> |
- | {| class="wikitable"
| + | |
- | ! Parameter !! Duration !! Temp [°C]
| + | |
- | |-
| + | |
- | | Denature||10:00||98
| + | |
- | |-
| + | |
- | | '''Denature'''||00:30||98
| + | |
- | |-
| + | |
- | | '''Anneal'''||00:30||52
| + | |
- | |-
| + | |
- | | '''Elongate'''||02:36||72
| + | |
- | |-
| + | |
- | | Elongate||05:00||72
| + | |
- | |-
| + | |
- | | Store||forever||8
| + | |
- | |}
| + | |
- | | + | |
- | # RFC25_F RFC25_R
| + | |
- | # RFC25_F REACh1_R
| + | |
- | # REACh1_F RFC25_R
| + | |
- | # RFC25_F REACh2_R
| + | |
- | # REACh2_F RFC25_R
| + | |
- | | + | |
- | == 23th ==
| + | |
- | * get our PCR tubes and run 5 µL on a 1,5% agarose gel
| + | |
- | * purify bands from gel with High Pure Product Purification Kit. Full lenght contaminated with REACh1
| + | |
- | | + | |
- | | + | |
- | *'''SOE'''
| + | |
- | * ca. 30 ng/µL
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! !! 20x !! -> 20 µL thereof: 30x
| + | |
- | |-
| + | |
- | | '''HF'''||10||10
| + | |
- | |-
| + | |
- | | '''dNTP'''||4||4
| + | |
- | |-
| + | |
- | | '''template'''||2x 1||10
| + | |
- | |-
| + | |
- | | '''Phusion'''||0.5||0.5
| + | |
- | |-
| + | |
- | | '''primer'''||-||2x 2.5
| + | |
- | |-
| + | |
- | | '''water'''||33.5||21.5
| + | |
- | |}
| + | |
- | | + | |
- | '''Anneling''': 52 °C
| + | |
- | | + | |
- | '''Elongation''': 20 sec
| + | |
- | | + | |
- | | + | |
- | *'''PCR with Phusion polymerase'''
| + | |
- | {| class="wikitable"
| + | |
- | ! !!volume [µL]
| + | |
- | |-
| + | |
- | | '''HF'''||10
| + | |
- | |-
| + | |
- | | '''dNTP'''||4
| + | |
- | |-
| + | |
- | | '''template'''||1
| + | |
- | |-
| + | |
- | | '''Phusion'''||0.5
| + | |
- | |-
| + | |
- | | '''primer'''||2x 2.5
| + | |
- | |-
| + | |
- | | '''water'''||29.5
| + | |
- | |-
| + | |
- | | '''total'''||50
| + | |
- | |}
| + | |
- | | + | |
- | *'''Digestion for restriction with NEB enzymes'''
| + | |
- | {| class="wikitable"
| + | |
- | ! !!volume
| + | |
- | |-
| + | |
- | | '''destination vector'''||500 ng
| + | |
- | |-
| + | |
- | | '''EcoRI-HF'''||1 µL
| + | |
- | |-
| + | |
- | | '''PstI'''||1 µL
| + | |
- | |-
| + | |
- | | '''10x NEB Buffer 2.1'''||5 µL
| + | |
- | |-
| + | |
- | | '''water'''||??? µL
| + | |
- | |-
| + | |
- | | '''total'''||??? µL
| + | |
- | |}
| + | |
- | *Ligation with NEB Kit
| + | |
- | | + | |
- | == 28th == | + | |
- | *[[User:aschechtel|Anna]] measured DNA concentration of SOE2 after purification
| + | |
- | *:# 57 ng/µL
| + | |
- | *:# 69.5 ng/µL
| + | |
- | | + | |
- | == 29th ==
| + | |
- | *'''PCR SOE1 and SOE2'''
| + | |
- | | + | |
- | == 30th ==
| + | |
- | * Run SOE2 on agasose gel for checking
| + | |
- | *: → doesn't look good; only full length products this time
| + | |
- | | + | |
- | | + | |
- | | + | |
- | * Run SOE again
| + | |
- | *: → more template
| + | |
- | *: → hot start
| + | |
- | *: → faster
| + | |
- | *: → elongation: 15 min
| + | |
- | *: → 20 cycles
| + | |
- | | + | |
- | * '''SOE1'''
| + | |
- | template A+B → 20 µL → <u>13.8 + 6.2</u> <u>5.3 + 14.7</u>
| + | |
- | {| class="wikitable"
| + | |
- | ! !!volume [µL]
| + | |
- | |-
| + | |
- | | '''HF'''||10
| + | |
- | |-
| + | |
- | | '''dNTP'''||4
| + | |
- | |-
| + | |
- | | '''template'''||20
| + | |
- | |-
| + | |
- | | '''Phusion'''||0.5
| + | |
- | |-
| + | |
- | | '''water'''||13.5
| + | |
- | |}
| + | |
- | * '''SOE2'''
| + | |
- | | + | |
- | = May =
| + | |
- | == 1st ==
| + | |
- | * Gel with M - full -full - REACh1 SOE3.2 - REACH2 SOE3.2 - M
| + | |
- | *: → 120 V, 30 min
| + | |
- | *: → cut out the bands
| + | |
- | | + | |
- | == 5th ==
| + | |
- | | + | |
- | * [[User:aschechtel|Anna]] made chemical competent DH5α and BL21 cells
| + | |
- | | + | |
- | == 8th ==
| + | |
- | * Test the efficiency of our competent cells
| + | |
- | *: → BL21: 6.6 x 10<sup>4</sup>
| + | |
- | *: → DH5α: 2.59 x 10<sup>7</sup>
| + | |
- | * SOE-PCR step 2 like on 30.04 ... → with template of SOE1 from 30.04
| + | |
- | * Run SOE2 product on gel for checking (5 µL)
| + | |
- | *: → restriction, (dephosphorylation of vector)
| + | |
- | *: → purify on gel with high pure kit
| + | |
- | | + | |
- | == 14th ==
| + | |
- | * [[User:fgohr|Florian]] made some LB agar plates with chloramphenicol and some with ampicillin
| + | |
- | * REACh2 purification on 1.2 % agarose gel
| + | |
- | * After that purification of the 778 bp fragment with High Pure PCR Product Purification Kit
| + | |
- | | + | |
- | == 19th ==
| + | |
- | * transformation of K131026 in DH5α and NEB
| + | |
- | * transformation of K731520 in DH5α
| + | |
- | | + | |
- | == 20th ==
| + | |
- | * [[User:StefanReinhold|Stefan]] made master plates on chloramphenicol (cam) → at least 6 clones on each plate
| + | |
- | * [[User:StefanReinhold|Stefan]] prepared 2x 5 mL LB + cam
| + | |
- | * [[User:aschechtel|Anna]] made sterile 50 % glycerol
| + | |
- | | + | |
- | == 21th ==
| + | |
- | * cryo stock of clones 1 & 2 of each BioBrick/ host
| + | |
- | * 15 mL cultures in 250 mL flasks, inoculated with 1.5 mL preculture (3 cultures A B C from clones 1; 1 + 2; 2)
| + | |
- | * add 35 mg/mL cam from stock
| + | |
- | * grow until OD<sub>600</sub>= 0.6, than induce one with IPTG
| + | |
- | {| class="wikitable"
| + | |
- | ! time !! info/ OD
| + | |
- | |-
| + | |
- | | '''11:10'''||A: inoculated ||B: inoculated ||C: inoculated
| + | |
- | |-
| + | |
- | | '''11:38'''||A: 0.482 ||B: 0.464 ||C: 0.466
| + | |
- | |-
| + | |
- | | '''12:28'''||A: 0.586; induced with 0.1 mM IPTG ||B: 0.576 ||C: 0.568
| + | |
- | |-
| + | |
- | | '''14:11'''||A: 0.93 ||B: 0.91 ||C: 0.942
| + | |
- | |}
| + | |
- | → no negativ control without plasmid
| + | |
- | | + | |
- | == 23rd ==
| + | |
- | * transformation of some BioBricks
| + | |
- | * colony PCR (s. picture below)
| + | |
- | *: → K131026: 1807 bp
| + | |
- | *: → K731520: 2123 bp
| + | |
- | *: → full length EYFP: 778 bp
| + | |
- | {{Team:Aachen/Figure|Aachen_14-05-23_COLONY-PCR.jpg|title=Colony PCR |subtitle=todo|width=300px}}
| + | |
- | | + | |
- | {{Team:Aachen/JumpUp}}
| + | |
- | | + | |
- | = June =
| + | |
- | == 3rd ==
| + | |
- | * transformation of 34 BioBricks
| + | |
- | | + | |
- | == 4th ==
| + | |
- | * made new 50 % glycerol
| + | |
- | * amde new LB plates with cam and with kanamycin (kan)
| + | |
- | * made master plates (6 clones per BioBrick)
| + | |
- | * made 60 steril glas tubes
| + | |
- | * made 2 L LB<sup>-</sup>
| + | |
- | * made 100 mL steril glas beads for plating
| + | |
- | | + | |
- | == 5th ==
| + | |
- | * did colony PCRs on all transformed BioBricks
| + | |
- | *: → pick 2 clones from each master plate
| + | |
- | * made 5 mL LB + cam over night cultures (make 250 mL LB + cam)
| + | |
- | *: → 1 culture per BioBrick
| + | |
- | | + | |
- | == 6th ==
| + | |
- | * made 2 glycerol stocks of each BioBrick
| + | |
- | | + | |
- | == 14th ==
| + | |
- | '''PCR of E0030 to K1319000'''
| + | |
- | * Q5 and Phusion polymerase are used
| + | |
- | {| class="wikitable"
| + | |
- | ! parameter !! duration !! temp [°C] | + | |
- | |-
| + | |
- | | denature||5:00||98
| + | |
- | |-
| + | |
- | | '''denature'''||00:30||98
| + | |
- | |-
| + | |
- | | '''anneal'''||00:30||55
| + | |
- | |-
| + | |
- | | '''elongate'''||00:50||72
| + | |
- | |-
| + | |
- | | elongate||05:00||72
| + | |
- | |}
| + | |
- | → 30 cycles
| + | |
- | | + | |
- | == 17th ==
| + | |
- | | + | |
- | == 20th ==
| + | |
- | * [[User:VeraA|Vera]] did colony PCR of K325108, K325218, C0062
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! parameter !! duration !! temp [°C]
| + | |
- | |-
| + | |
- | | denature||5:00||95
| + | |
- | |-
| + | |
- | | '''denature'''||00:30||95
| + | |
- | |-
| + | |
- | | '''anneal'''||00:30||49
| + | |
- | |-
| + | |
- | | '''elongate'''||03:15||72
| + | |
- | |-
| + | |
- | | elongate||05:00||72
| + | |
- | |}
| + | |
- | → 30 cycles
| + | |
- | * Results 30 min on 1.2 % gel at 110 V
| + | |
- | → weak bands in K325108 a & b: 4.5 kb, 9 kb
| + | |
- | | + | |
- | == 23rd ==
| + | |
- | * Repeat the colony PCR from yesterday
| + | |
- | * Inoculate preculture for plasmid prep
| + | |
- | ** K1319000 → sequencing
| + | |
- | ** K592100 → BFP
| + | |
- | ** S01022 → CFP
| + | |
- | ** J23101.E0240 → sequencing
| + | |
- | ** J23115.E0240 → sequencing
| + | |
- | * Plate K516132 and J23101.E0240 on LB + cam plates
| + | |
- | | + | |
- | == 24th ==
| + | |
- | * 8 plasmid prerps
| + | |
- | * Over night culture of K516132 and J23101.E0240
| + | |
- | | + | |
- | == 25th ==
| + | |
- | * Prepared a preculture for competent NEB10β cells
| + | |
- | * Submitted samples for sequencing
| + | |
- | * Made master plates of transformed BioBricks
| + | |
- | * Centrifuged and froze overnight expression culture of J23101.E0240 and K516132
| + | |
- | * Made new 50% glycerol
| + | |
- | | + | |
- | == 26th ==
| + | |
- | * Made competent NEB10β cells, however, several things went wrong. (For future reference: pre-cool centrifuge, always check if it's indeed spinning, frequently check OD of the culture)
| + | |
- | * Colony PCR on the transformed clones looked awful; there were too many cells in the 10 µL reaction volume. Some tubes were not fully sealed during the PCR. Basically ''only'' primers and smear, except for the positive control which contained a plasmid template instead of cells.
| + | |
- | * 2x 500 mL of fresh LB and three sterile flasks were prepared and autoclaved.
| + | |
- | | + | |
- | == 27th ==
| + | |
- | | + | |
- | == 30th ==
| + | |
- | | + | |
- | = July =
| + | |
- | == 3rd ==
| + | |
- | * [[User:Aschechtel|Anna]] made chips with K1319042 and K731520 in NA and M9 medium images were taken every 30 min with the Geldoc
| + | |
- | | + | |
- | | + | |
- | == 9th ==
| + | |
- | * [[User:Aschechtel|Anna]] made chips with K1319042 in M9, M9 + casamino acids, Hartmann medium (HM) images were taken every 30 min with the Geldoc
| + | |
- | | + | |
- | == 16th ==
| + | |
- | * did plasmid preps
| + | |
- | * transformation of different reporter strains
| + | |
- | ** NEB
| + | |
- | ***pSEVE641_BsFbFP
| + | |
- | ***pSEVA234_LasR
| + | |
- | ***pSEVE641_BsFbFP pSEVA234_LasR
| + | |
- | ***pSEVE641_BsFbFP pSB1C3_C0179
| + | |
- | **BL21
| + | |
- | ***pSEVE641_BsFbFP pSEVA234_LasR
| + | |
- | ***pSEVE641_BsFbFP pSB1C3_C0179
| + | |
- | * [[User:Aschechtel|Anna]] made chips with K1319042 in Hartmann, Hartman + 20 % glycerol, M9 medium images were taken every 30 min with the Geldoc
| + | |
- | | + | |
- | == 22nd ==
| + | |
- | * [[User:Pdemling|Philipp]] and [[User:mosthege|Michael]] made 100x stocks for Hartmans minimal medium.
| + | |
- | * [[User:mosthege|Michael]] and [[User:VeraA|Vera]] made about 25 HM+C plates without glucose.
| + | |
- | * K731520 iLOV was plated on a HM+C plate
| + | |
- | | + | |
- | == 23rd ==
| + | |
- | * [[User:mosthege|Michael]] made 25 new HM+C plates with 1 % agar and 4 g/L glucose
| + | |
- | * He also added 170 µL of the glucose stock (500 g/L) to the glucose-free HM+C-plates
| + | |
- | * 1 L of sterile HM+glucose was prepared
| + | |
- | * K731520 iLOV was plated on HM+C+Glucose and HM+C+Glucose drops, 3x 5 mL HM+C+Glucose precultures were inoculated (17:00)
| + | |
- | | + | |
- | == 24th ==
| + | |
- | * K731520 iLOV did not grow, neither on the plates, nor on in the liquid media. The most probable cause is that the ''E. coli'' is missing some vitamins
| + | |
- | * Based on the [http://openwetware.org/wiki/M9_medium/supplemented M9 recipes by the Knight and Endy labs on OpenWetWare], we made a 20 mL supplement stock solution that can be added to 1x HM media
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | |-
| + | |
- | ! Component !! supplement for 1x HM [g/L] !! final 1x concentration
| + | |
- | |-
| + | |
- | | Casamino acids || 2 || 2 g/L
| + | |
- | |-
| + | |
- | | Thiamine hydrochloride || 0.3 || 300 mg/L
| + | |
- | |-
| + | |
- | | MgSO{{sub|4}}/MgSO{{sub|4}}*7H{{sub|2}}O || 0.242 / 0.494 || 2 mmol/L
| + | |
- | |-
| + | |
- | | CaCl{{sub|2}} || 0.011 || 0.1 mmol/L
| + | |
- | |}
| + | |
- | The powders for 1 L of 1x HM were dissolved in 20 mL of a 10 % w/v Casamino acid stock solution and filter-sterilized (.22 µm PES). To make agar chips, we can add 1 mL to the hot agar mixture, together with the three 500 µL 100x stocks for the HM.
| + | |
- | | + | |
- | We made 250 mL of HM+C+Glucose+Supplements plates with 1.5 % agar.
| + | |
- | | + | |
- | Then we plated the following combinations:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | |-
| + | |
- | ! Construct !! HM+C+Glucose+Supplements !! LB+C
| + | |
- | |-
| + | |
- | | K731520 iLOV || - || +
| + | |
- | |-
| + | |
- | | J23101.E0240 || + || +
| + | |
- | |}
| + | |
- | | + | |
- | We also prepared a 150 mL HM+C+Glucose+Supplements culture with K731520 iLOV to hopefully make agar chips on Friday, July 25th.
| + | |
- | | + | |
- | Six of last weeks J23115.E0240 clones were plated on LB+C, and 5 mL LB+C precultures were inoculated for plasmid preparation.
| + | |
- | | + | |
- | == 25th ==
| + | |
- | The K731520 iLOV strain did not grow on the HM plate, while another strain with the J23101.E0240 construct did. Both have the pSB1C3 backbone. To confirm the plasmids and inserts, [[User:mosthege|Michael]] set up a colony PCR:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | |-
| + | |
- | ! ID !! Template !! Product Length !! Result
| + | |
- | |-
| + | |
- | | 1 || J23101.E0240 #5 || 1233 ||
| + | |
- | |-
| + | |
- | | 2 || J23101.E0240 #6 || 1233 ||
| + | |
- | |-
| + | |
- | | 3 || J23101.E0240 #5 plasmid || 1233 ||
| + | |
- | |-
| + | |
- | | 4 || K731520 iLOV LB colony || 2053 ||
| + | |
- | |-
| + | |
- | | 5 || K731520 iLOV plasmid || 2053 ||
| + | |
- | |-
| + | |
- | | 6 || K731520 GFP plasmid || 2437 ||
| + | |
- | |-
| + | |
- | | 7 || water || none ||
| + | |
- | |}
| + | |
- | | + | |
- | Reaction volume per tube was 15 µL. GoTaq Green Mastermix and the VF2 and VR primers were used. You can find the durations and temperatures the table below:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! parameter !! duration !! temp [°C]
| + | |
- | |-
| + | |
- | | denature||10:00||95
| + | |
- | |-
| + | |
- | | '''denature'''||00:30||95
| + | |
- | |-
| + | |
- | | '''anneal'''||00:30||49
| + | |
- | |-
| + | |
- | | '''elongate'''||02:36||72
| + | |
- | |-
| + | |
- | | elongate||05:00||72
| + | |
- | |-
| + | |
- | | store||forever||8
| + | |
- | |}
| + | |
- | | + | |
- | [[User:Fgohr|Florian]] mini-prepped the 6 overnight cultures of J23115.E0240 clones. He used 3 mL instead of 1.5 mL culture medium and eluted twice with 25 µL nuclease-free water. Everything else was according to the protocol of the [http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/de/GELifeSciences/28904269 illustra plasmidPrep Mini-Spin Kit].
| + | |
- | | + | |
- | The resulting DNA concentrations are listed in this table:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! clone # !! concentration [ng/µl]
| + | |
- | |-
| + | |
- | | 1 || 73.5
| + | |
- | |-
| + | |
- | | 2 || 94.5
| + | |
- | |-
| + | |
- | | 3 || 100.5
| + | |
- | |-
| + | |
- | | 4 || 53
| + | |
- | |-
| + | |
- | | 5 || 82
| + | |
- | |-
| + | |
- | | 6 || 138
| + | |
- | |}
| + | |
- | | + | |
- | In the evening, we plated some strains on the different media to investigate why the K731520 iLOV did not grow on the HM+suppl. plate. (Note: In the morning, [[User:mosthege|Michael]] re-inoculated the HM+C+suppl. shake flask with cells from the LB-plate and by afternoon the culture ''did'' grow to a high cell density.)
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! Construct !! Host strain !! LB+C !! HM+C+Glucose !! HM+C+Glucose+supplements
| + | |
- | |-
| + | |
- | | J23101.E0240 || NEB10β || ++ || - || ++
| + | |
- | |-
| + | |
- | | K731520 iLOV || DH5alpha || ++ || - || (+)
| + | |
- | |-
| + | |
- | | K131026 || NEB10β || ++ || - || -
| + | |
- | |-
| + | |
- | | K131026 || DH5alpha || ++ || - || +
| + | |
- | |}
| + | |
- | | + | |
- | [[User:Pdemling|Philipp]] inoculated J23101.E0240 in LB and HM+C+Glucose+supplements.
| + | |
- | | + | |
- | == 28th ==
| + | |
- | <!-- WICHTIG: Unterlagen für Zollkram heraussuchen und der Frau von der ZHV zurückschreiben!!!! -->
| + | |
- | | + | |
- | == 29th ==
| + | |
- | | + | |
- | * ...
| + | |
- | | + | |
- | <!-- | + | |
- | * inoculate 2x 150 ml cultures HM+Glucose+C
| + | |
- | * prepare 200 ml 1.5 % agar
| + | |
- | * pre-cool centrifuge
| + | |
- | * centrifuge 1x 50, 1x 100 and 1x 150 ml
| + | |
- | * make 3 kinds of chips - OOx1, ODx2, ODx3
| + | |
- | | + | |
- | -->
| + | |
- | | + | |
- | == 30th ==
| + | |
- | * [[User:Aschechtel|Anna]] made chips with K1319042, K131026 in HM medium images were taken every 30 min with the Geldoc
| + | |
- | | + | |
- | = August =
| + | |
- | == 1st ==
| + | |
- | * Stefan and [[User:VeraA|Vera]] made electrocompetent ''E.coli'' cells.
| + | |
- | * [[User:AZimmermann|Arne]] prepared cultures of [[User:R.hanke|Renés]] iLOV and K131026 for Saturday, August 2nd.
| + | |
- | | + | |
- | == 2nd ==
| + | |
- | * tested the OD measurement device and compared it to the spectrophotometer and the plate reader.
| + | |
- | * tested K131026 and K731520 iLOV for fluorescence in the plate reader
| + | |
- | * did a heat shock transformation of I746909 into NEB TOP 10 cells
| + | |
- | * did an electroshock transformation of pET17-Gal3 into ''E.coli'' rosetta
| + | |
- | | + | |
- | == 3rd ==
| + | |
- | * OD measurements of the iGEM device in comparison to the spectrophotometer were taken.
| + | |
- | * cryo cultures of K131026 and K731520 iLOV were prepared
| + | |
- | | + | |
- | == 4th ==
| + | |
- | * [[User:AZimmermann|Arne]] and [[User:mosthege|Michael]] made cryo stocks of K731520 iLOV and K131026 in NEB/BL21/DH5alpha, I746909 in BL21 and pET17-His-SNAP-YFP-Gal3 in ''E. coli'' rosetta (DE3), respectively.
| + | |
- | * [[User:mosthege|Michael]] did a plasmid prep, most of them using 1.5 mL culture medium, and eluted with 1x 50 µL of ddH{{sub|2}}O. The resulting DNA concentrations are shown below.
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! combination !! concentration [ng/µl]
| + | |
- | |-
| + | |
- | | I746909 BL21 #1 || 73.5
| + | |
- | |-
| + | |
- | | I746909 BL21 #2 || 45
| + | |
- | |-
| + | |
- | | I746909 BL21 #3 || 49
| + | |
- | |-
| + | |
- | | K731520 iLOV DH5alpha || 60
| + | |
- | |-
| + | |
- | | K131026 DH5alpha || 150
| + | |
- | |-
| + | |
- | | pET17-Gal3 #1 || 30.5
| + | |
- | |-
| + | |
- | | pET17-Gal3 #2 || 6.4
| + | |
- | |-
| + | |
- | | pET17-Gal3 #3 || 6.3
| + | |
- | |-
| + | |
- | | pET17-Gal3 #4 || 9.4
| + | |
- | |-
| + | |
- | | pET17-Gal3 #5 || 10.1
| + | |
- | |-
| + | |
- | | pET17-Gal3 #6 || 8.2
| + | |
- | |-
| + | |
- | | pET17-Gal3 #7 || 13.8
| + | |
- | |-
| + | |
- | | pET17-Gal3 #8 || 6.9
| + | |
- | |-
| + | |
- | | pET17-Gal3 #9 || 10.2
| + | |
- | |}
| + | |
- | | + | |
- | To confirm the quality of pET17-Gal3 transformations, the purified plasmids were tested by carrying out a digest. Results are shown in the below picture and table.
| + | |
- | | + | |
- | {{Team:Aachen/Figure|14-08-04_Test-Digest.png|title=Test digest|subtitle=clones were test-digested|width=200px}}
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! combination !! cut products[bp]
| + | |
- | |-
| + | |
- | | I746909 BL21 #1 || 2029, 947
| + | |
- | |-
| + | |
- | | K731520 iLOV DH5alpha || 2029, 1780
| + | |
- | |-
| + | |
- | | K131026 DH5alpha || 2029, 1848
| + | |
- | |-
| + | |
- | | pET17-Gal3 #1 || 3086, 923, 1262
| + | |
- | |}
| + | |
- | | + | |
- | All pET17-Gal3 clones were positive and clone #1 was selected for further experiments.
| + | |
- | | + | |
- | == 5th ==
| + | |
- | * [[User:StefanReinhold|Stefan]], [[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] assembled a V{{sub|R}}=2.5 L bioreactor for cultivation of a 1 L expression culture.
| + | |
- | * Two precultures of 20 mL LB+A were inoculated at 19:00
| + | |
- | * [[User:Aschechtel|Anna]] transformed K746909 into BL21 cells and K1319000 into NEB10β cells.
| + | |
- | * [[User:Aschechtel|Anna]] made Chips with K1319042 in HM. Images were taken every 30 min with the Geldoc
| + | |
- | | + | |
- | == 6th ==
| + | |
- | * [[User:Eshani.sood|Eshani]] and [[User:AZimmermann|Arne]] transformed J04450 in pSB1K3 and pSB1A3 in NEB10β cells.
| + | |
- | * They also did a plasmid prep of J04450 in pSB1C3 and Flo's vectors.
| + | |
- | * [[User:AZimmermann|Arne]] made precultures of NEB10βand DH5 alpha cells
| + | |
- | * [[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] inoculated the fermenter at 11:40, and induced the fermentation of pET17-Gal3. The fermentation is expected to run 24 h.
| + | |
- | | + | |
- | == 13th ==
| + | |
- | * [[User:Aschechtel|Anna]] made chips with
| + | |
- | ** K131026 and I746909 in LB and HM
| + | |
- | ** K1319042 and [[User:fgohr|Florians]] two plasmid construct in HM
| + | |
- | * Images were taken every 30 min with the Geldoc
| + | |
- | | + | |
- | == 19th ==
| + | |
- | * [[User:Aschechtel|Anna]] made Chips with K131026 and I746909 in HM. Images were taken every 30 min with the Geldoc
| + | |
- | | + | |
- | == 25th ==
| + | |
- | * did a plasmid restriction of I20260 (EcoRI,PstI), J23115 (EcoRI, SpeI), K516032 (XbaI,PstI), and J23101 (EcoRI, SpeI)
| + | |
- | * [[User:Nbailly|Nina]] tested the growth of ''Pseudomonas fluorescens'' in different liquid media for high OD and strong fluorescence. She tested Standard I medium, Cetrimide medium and Pseudomonas-F medium, and Pseudomonas-F medium supplemented with 300 µL Fe3+ in 500 mL flasks with a filling volume of 30 mL. The flasks were inoculated with ''P. fluorescens'' cells on Standard I agar, and incubated at 30 °C at 250 rpm.
| + | |
- | | + | |
- | == 26th ==
| + | |
- | * ligation of J23115 and K516032 to J23115.K516032, and J23101 and K516032 to J23101.K516032, respectively.
| + | |
- | * plasmid prep of I20260, K516032 and B0034
| + | |
- | * restriction of plasmids I20260, K516032, B0034 with EcoRI and PstI
| + | |
- | * A gel with restricted the I20260, K516032 and B0034 was run.
| + | |
- | * purification of vector backbones pSB1A2, pSB3K3 and pSB1C3
| + | |
- | * restriciton of synthesized TEV protease with EcoRI and PstI
| + | |
- | * [[User:Nbailly|Nina]] qualitatively tested the ''Pseudomonas fluorescens'' that had grown over night for OD and fluorescence. She determined that Pseudomonas-F medium is the most adequate for the cultivation of the strain we use, since both OD and fluorescence were best in the flask containing the respective medium. Growth in the Pseudomonas-F medium supplemented with 300 µg/L Fe3+ was weaker, however, fluorescence was also successfully suppressed.
| + | |
- | | + | |
- | == 27th ==
| + | |
- | * Ligation of J23101.K516032 into pSB3K3 and J23115.K516032 into pSB3K3 and K1319004 into pSB1C3
| + | |
- | * Transformation of K1319004 into pUC and pSB1C3, and J04450 into pSB1K3 and pSB1A3, respectively
| + | |
- | | + | |
- | = September =
| + | |
- | == 3rd ==
| + | |
- | [[User:Mosthege|Michael]], [[User:VeraA|Vera]] and [[User:Eshani.sood|Eshani]] prepared 50 mL LB+antibiotic overnight-cultures of pSBX-vectors that were sent in by team Heidelberg.
| + | |
- | | + | |
- | == 4th ==
| + | |
- | * In the morning, at 10:15, [[User:Aschechtel|Anna]] inoculated the precultures for the interlab study experiment.
| + | |
- | * [[User:Mosthege|Michael]] prepared cryo stocks of the pSBX-carrying ''E. coli'' from the overnight cultures. He also purified each pSBX-vector, eluting with 15+30 µL water, and resulting in the following DNA concentrations:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! vector !! concentration [ng/µL]
| + | |
- | |-
| + | |
- | | pSBX1A3 || 111
| + | |
- | |-
| + | |
- | | pSBX4A5 || 14.1
| + | |
- | |-
| + | |
- | | pSBX1C3 || 31
| + | |
- | |-
| + | |
- | | pSB4C5 || 98.5
| + | |
- | |-
| + | |
- | | pSBX1K3 || 18
| + | |
- | |-
| + | |
- | | pSBX4K5 || 30
| + | |
- | |-
| + | |
- | | pSBX1T3 || 39
| + | |
- | |-
| + | |
- | | constitutive expression plasmid || 73
| + | |
- | |}
| + | |
- | | + | |
- | | + | |
- | * [[User:Aschechtel|Anna]] did PCRs for Gibson assembly of K1319003 into pET17. Duplicates of 25 µL reaction volume (12.5 µL Q5 2x Master Mix, 1.25 µL per primer, 2 µL template)
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! PCR tube # !! components
| + | |
- | |-
| + | |
- | | 1 and 2 || pET17 + pET17_Gal3_Gib_F + pET17_Gal3_Gib_R
| + | |
- | |-
| + | |
- | | 3 and 4 || K1319003 + K1319003_Gib_F + K1319003_Gib_R
| + | |
- | |-
| + | |
- | |}
| + | |
- | | + | |
- | The PCR conditions:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! step !! temperature [°C] !! duration
| + | |
- | |-
| + | |
- | | denature || 98 || 30", 98 °C for 10", 55 °C for 30", 72 °C for 2'15"
| + | |
- | |-
| + | |
- | | denature || 98 || 10"
| + | |
- | |-
| + | |
- | | anneal || 50 (insert) 55 (backbone) || 30"
| + | |
- | |-
| + | |
- | | elongate || 72 || 0'30" (insert) 2'15" (backbone)
| + | |
- | |-
| + | |
- | | elongate || 72 || 2"
| + | |
- | |-
| + | |
- | | store || 8 || indefinite
| + | |
- | |}
| + | |
- | | + | |
- | * Finally, [[User:Fgohr|Florian]] did the Gibson assembly and a heat shock transformation into NEB10β cells.
| + | |
- | | + | |
- | * At 10:15, [[User:AZimmermann|Arne]] inoculated the primary cultures of the interlab study experiment and began with regular fluorescence measurements.
| + | |
- | | + | |
- | == 5th ==
| + | |
- | * [[User:Aschechtel|Anna]] made master plates of yesterday's transformed cells.
| + | |
- | | + | |
- | == 6th ==
| + | |
- | * [[User:Aschechtel|Anna]] made precultures of 3 clones from each prepared master palte and inoculated precultures for OD/F measurements as well as chip production on the 7th.
| + | |
- | | + | |
- | == 7th ==
| + | |
- | * [[User:Aschechtel|Anna]] made cryos stocks of the precultures.
| + | |
- | * [[User:Mosthege|Michael]] and [[User:AZimmermann|Arne]] purified the following plasmids:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! plasmid !! strain !! resistance !! vector !! # of clone picked !! concentration [ng/µl]
| + | |
- | |-
| + | |
- | |K1319000 in I20260 || NEB10ß || K || pSB3K3 || 1 ||
| + | |
- | |-
| + | |
- | |K1319000 in I20260 || NEB10ß || K || pSB3K3 || 3 ||
| + | |
- | |-
| + | |
- | |K1319000 in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |K1319001 in I20260 || NEB10ß || K || pSB3K3 || 1 ||
| + | |
- | |-
| + | |
- | |K1319001 in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |K1319001 in I20260 || NEB10ß || K || pSB3K3 || 6 ||
| + | |
- | |-
| + | |
- | |K1319002 in I20260 || NEB10ß || K || pSB3K3 || 1 ||
| + | |
- | |-
| + | |
- | |K1319002 in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |K1319002 in I20260 || NEB10ß || K || pSB3K3 || 6 ||
| + | |
- | |-
| + | |
- | |K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||
| + | |
- | |-
| + | |
- | |K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |K1319001_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 6 ||
| + | |
- | |-
| + | |
- | |K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 3 ||
| + | |
- | |-
| + | |
- | |K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 4 ||
| + | |
- | |-
| + | |
- | |K1319002_GFP Fusion in I20260 || NEB10ß || K || pSB3K3 || 5 ||
| + | |
- | |-
| + | |
- | |His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 3 ||
| + | |
- | |-
| + | |
- | |His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 4 ||
| + | |
- | |-
| + | |
- | |His-SNAP-YFP-K1319003 || NEB10ß || A || pET17 || 6 ||
| + | |
- | |}
| + | |
- | Elution was performed twice with 15 µL of nuclease free water each time.
| + | |
- | | + | |
- | == 15th ==
| + | |
- | [[User:AZimmermann|Arne]] and [[User:Mosthege|Michael]] were able to analyze the sequencing data from the clones of GFP_Reach 1, GFP_Reach 2 and K1319008.
| + | |
- | | + | |
- | GFP_Reach 2 clone #3 and #5 were fine, including the Leu to Ile mutation.
| + | |
- | GFP_Reach 1 clone #4 and #5 were fine and did not contain the Leu to Ile mutation. Clone #6 was fine but contained the Leu to Ile mutation from the Reach 1 quick change mutations.
| + | |
- | | + | |
- | For future experiments, we will use the GFP_Reach 1 clone #4 and the GFP_Reach 2 clone #4.
| + | |
- | | + | |
- | Transformation of GFP_Reach 1 clone #3 and GFP_Reach 2 clones #3 and #5 were performed together with the TEV protease to create two plasmid construct.
| + | |
- | | + | |
- | The GFP_Reach 1 and GFP_Reach 2 constructs were also restricted and ligated into the pSB1C3 vector from the pSB3K3 vector.
| + | |
- | | + | |
- | == 16th ==
| + | |
- | | + | |
- | * [[User:VeraA|Vera]] made master plates of the transformation from the day before.
| + | |
- |
| + | |
- | * Also PCRs were made from pSBXA3, I20260 and K131900 for a Gibson assembly. The PCRs were checked with a gel electrophoresis.
| + | |
- | | + | |
- | == 17th ==
| + | |
- | | + | |
- | * [[User:Nbailly|Nina]] prepped and autoclaved 33 500 mL shake flasks.
| + | |
- | | + | |
- | == 18th ==
| + | |
- | | + | |
- | * [[User:Nbailly|Nina]] tested ''Pseudomonas fluoresence'' if they are suitable for a growth experiment that is planned for our collaboration with the NEAnderLab next week. Therefore, she filled 2 500 mL flasks with 30 mL LB Pseudomonas-F medium, and inoculated each one with 1 mL culture medium of the overnight preculture. Flasks were inoculated at 30 °C at 250 rpm. However, after 5 hours no exponential growth could be shown (s. plot below). Thus, it was decided to use a ''E. coli'' K12 derivate strain in TB medium instead, and 30 mL of TB medium in a 500 mL flask were inoculated with ''E. coli'' DH5alpha cells and incubated at 37 °C at 300 rpm over night. According to the [https://www.dsmz.de/catalogues/catalogue-microorganisms/groups-of-organisms-and-their-applications/strains-for-schools-and-universities.html DSMZ] ''E . coli'' K12 strain derivates, such as DH5alpha, are adequate for the kind of school experiment we are planning with the NEAnderLab.
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_of_Pf_in_LB_iNB.png|title=Growth Curves|subtitle=Unfortunately, ''P. fluorescens'' did not show a nice exponential growth curve over the observed 5 hours.|width=1000px}}
| + | |
- | | + | |
- | == 19th ==
| + | |
- | * [[User:R.hanke|René]], [[User:AZimmermann|Arne]] and [[User:Pdemling|Philipp]] made flask cultures of K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 (negative control) and I20260 (positive control). iPTG was added at an OD of ~0.5. Inoculation was done via precultures in 500 ml shake flasks (50 ml filling volume). Media was always LB. Cultivation was done at 37 °C and 300 rpm. The starting OD was aimed to be 0.1. Inoculation occured directly from the precultures. Samples were taken every hour and checked for OD and fluorescence using a spectrophotometer and plate reader, respectively.
| + | |
- | | + | |
- | * [[User:VeraA|Vera]] did a plasmid preparation from the cultures of the day before (K1319013, K1319013 + K1319008, K1319013 + K1319008 + iPTG, K1319014, K1319014 + K1319008, K1319014 + K1319008 + iPTG, B0015 and I20260). The plasmid were then be cut with EcoRI and PstI, and the results were be put on an agarose gel in order to perform a restriction test. Also plasmids of K1319013 and K1319014 will be cut with EcoRi and SpeI. K1319008 will be cut with XbaI and PstI. These will then be ligated together and then ligated into a pSB1A3 vector via the 3A assembly (vector cut with EcoRI and PstI). These constructs will be transformed into BL21 (and NEB as a backup). The created construts will be known as K1319018 (K1319013.K1319008) and K1319019 (K1319014.K1319008).
| + | |
- | | + | |
- | * [[User:Fgohr|Florian]] made precultures of the master plates from the day before (K1319008, K1319013, K1319015 and pSBX1A3 with Gal3).
| + | |
- | | + | |
- | * [[User:AZimmermann|Arne]] also inoculated 4 cultures for the further testing of the OD/F device (the F part). The cultures are 2 shake flasks of I20260 and 2 shake flasks of B0015.
| + | |
- | | + | |
- | * Furthermore, [[User:Nbailly|Nina]] did a growth experiment with DH5alpha for the NEAnderLab school experiment. 3 500 mL shake flasks were filled with 50 mL TB medium, and inoculated to an OD of 1.5 with the overnight preculture. Samples were taken every 30 minutes and tested for OD using our own device as well as the spectrophotometer. The resulting growth curve is shown below. [[User:Nbailly|Nina]] concluded that the growth was fast enough for these growth conditions to be used for the school experiment on the 24th.
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-19_NEAnderLab_Test_Growth_Curves_in_TB_iNB.png|title=Growth Curves|subtitle=Growth under these conditions was sufficient for the school experiment to be carried in 5 hours. And our device did a good job measuring, too!|width=1000px}}
| + | |
- | | + | |
- | * [[User:Aschechtel|Anna]] also made chips with K1319013 + K1319008, K1319014 + K1319008, K1319013, K1319014, B0015 and K131026. These will be inocubated for an hour at 37 °C. Then they will be induced with iPTG/HSL and fotos will be made every 30 minutes to check for fluorescence (GFP).
| + | |
- | | + | |
- | * [[User:Fgohr|Florian]] tested our OD/F device with a dilution test. Samples were checked with the spectrophotometer (OD), our OD/F device (fluorescence) and platereader (fluorescence).
| + | |
- | | + | |
- | * [[User:Aschechtel|Anna]] and [[User:VeraA|Vera]] made SDS gels.
| + | |
- | | + | |
- | * [[User:User:StefanReinhold|Stefan]] inoculated a culture of K1319008, B0015 as well as I20260 to check whether the results from our construct are from a wrongly done Gibson assembly with a still functioning superfolded GFP (the TEV protease was inserted in a backbone that formely contained superfolded GFP.)
| + | |
- | | + | |
- | == 20th ==
| + | |
- | | + | |
- | | + | |
- | == 22nd ==
| + | |
- | | + | |
- | * [[User:Nbailly|Nina]] poured several Pseudomonas-F agar plates with 0, 150 and 300 µg/L for the NEAnderLab school experiment. She also autoclaved 12 500 mL shake flasks, partly to be used for the school collaboration on Wednesday.
| + | |
- | | + | |
- | == 26th ==
| + | |
- | * [[User:Mosthege|Michael]] did a check PCR on several cryo cultures. All samples with G00100_Alternative+K1319004_check_R combinations resulted in a strong band at ~2300 bp that we cannot explain. All G00100_Alternative+K1319004_check_R combinations resulted in a strong band at 900 bp that we cannot explain either. We concluded that the annealing temperatures were wrong and favored unspecific products. Therefore, we decided to do a gradient PCR to find out the optimal annealing temperatures for our new primers.
| + | |
- | | + | |
- | === Gradient PCR to test new primers ===
| + | |
- | [[User:Fgohr|Florian]] and [[User:Mosthege|Michael]] did gradient PCR with these new primers:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! name !! sequence
| + | |
- | |-
| + | |
- | | G00100_Alternative || GTGCCACCTGACGTCTAAGAAACCATTATTATC
| + | |
- | |-
| + | |
- | | G00101_Alternative || ATTACCGCCTTTGAGTGAGCTGATACCGCTCG
| + | |
- | |-
| + | |
- | | K1319004_check_R || ACGGAATTTCAGTTTCTGCGGGAACGGCGG
| + | |
- | |-
| + | |
- | | I746909_check_R || ATCTTTAGACAGAACGCTTTGCGTGCTCAG
| + | |
- | |}
| + | |
- | | + | |
- | Three PCRs with different primer combinations were run. In all of them the templates were K1319004 in pSB1C3, K1319008 in pSB1C3 and I746909 in pSB1C3.
| + | |
- | | + | |
- | The first gradient PCR tested the G00100_Alternative + G00101_Alternative combination:
| + | |
- | {| class="wikitable"
| + | |
- | ! primer_F !! primer_R !! template !! expected length !! best annealing temperature
| + | |
- | |-
| + | |
- | | G00100_Alternative || G00101_Alternative || K1319004 in pSB1C3 || 1057 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || G00101_Alternative || K1319008 in pSB1C3 || 1245 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || G00101_Alternative || I746909 in pSB1C3 || 1221 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || G00101_Alternative || water || --- || ???
| + | |
- | |}
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_1.png|title=Gradient PCR 1|subtitle=the primers were G00100_Alternative and G00101_Alternative and they worked well at all temperatures from 55-65 °C.|width=800px}}
| + | |
- | | + | |
- | The second gradient PCR tested the G00100_Alternative + I746916_check_R combination:
| + | |
- | {| class="wikitable"
| + | |
- | ! primer_F !! primer_R !! template !! expected length !! best annealing temperature
| + | |
- | |-
| + | |
- | | G00100_Alternative || I746916_check_R || K1319004 in pSB1C3 || none || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || I746916_check_R || K1319008 in pSB1C3 || none || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || I746916_check_R || I746909 in pSB1C3 || 820 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || I746916_check_R || water || --- || ???
| + | |
- | |}
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_2.png|title=Gradient PCR 2|subtitle=the primers were G00100_Alternative and I746916_check_R and they worked well at all temperatures from 55-65 °C. Apparently the K1319008 template contained I746916.|width=800px}}
| + | |
- | | + | |
- | The third gradient PCR tested the G00100_Alternative + K1319004_check_R combination:
| + | |
- | {| class="wikitable"
| + | |
- | ! primer_F !! primer_R !! template !! expected length !! best annealing temperature
| + | |
- | |-
| + | |
- | | G00100_Alternative || K1319004_check_R || K1319004 in pSB1C3 || 541 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || K1319004_check_R || K1319008 in pSB1C3 || 502 || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || K1319004_check_R || I746909 in pSB1C3 || none || ???
| + | |
- | |-
| + | |
- | | G00100_Alternative || K1319004_check_R || water || --- || ???
| + | |
- | |}
| + | |
- | {{Team:Aachen/Figure|Aachen_14-09-26_gradientPCR_3.png|title=Gradient PCR 3|subtitle=The primers were G00100_Alternative and K1319004_check_R and they worked well at all temperatures from 60-68.1 °C. To our disappointment, the K1319008 template did not contain K1319004. It is unclear why the 5 bands of K1319008 and I746916 look different.|width=800px}}
| + | |
- | | + | |
- | The results of these three PCRs are:
| + | |
- | # The KAPA2G Fast ReadyMix worked well
| + | |
- | # All three primers work well at >65 °C annealing temperature
| + | |
- | # The K1319008 template was contained I746916 instead of the intended K1319004 ORF
| + | |
- | | + | |
- | It was concluded that a similar check PCR with 65 °C annealing temperature will be done on all plasmids and cryos of K1319008.
| + | |
- | | + | |
- | == 27th ==
| + | |
- | * First [[User:Mosthege|Michael]] transformed K1319001, K1319002, K1319003 and K1319004 (all in pSB1C3) into NEB10β cells. He tested the PCR machine for semi-automated heat-shocking by splitting the 50 µL cells with the plasmid into 2x 25 µL. All 100 µL were plated for all construct/machine combinations.
| + | |
- | | + | |
- | * [[User:VeraA|Vera]] transformed several constructs into chemically competent BL21(DE3) cells.
| + | |
- | | + | |
- | * [[User:Pdemling|Philipp]] and [[User:Mosthege|Michael]] did colony-PCR on all plasmids, cryos and colonies that should contain the K1319004 sequence.
| + | |
- | | + | |
- | * [[User:VeraA|Vera]] also made check a PCR on galectin-constructs:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! label !! primer_F !! primer_R !! expected length !! result
| + | |
- | |-
| + | |
- | | Gal3 in pSBX1A3 #1 || G00100_Alternative || K1319003_R || 1684 || ???
| + | |
- | |-
| + | |
- | | Gal3 in pSBX1A3 #2 || G00100_Alternative || K1319003_R || 1684 || ???
| + | |
- | |-
| + | |
- | | Gal3 in pSBX1A3 #3 || G00100_Alternative || K1319003_R || 1684 || ???
| + | |
- | |-
| + | |
- | | Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???
| + | |
- | |-
| + | |
- | | Gal3 YFP #3 || pETGal3_seq_F || K1319003_R || 867 || ???
| + | |
- | |-
| + | |
- | | Gal3 YFP pet17 AmpR || pETGal3_seq_F || K1319003_R || 867 or none || ???
| + | |
- | |-
| + | |
- | | pET17 Gal3 #1 || pETGal3_seq_F || K1319003_R || none || ???
| + | |
- | |-
| + | |
- | | K1319003 in pSB1C3 || G00100_Alternative || K1319003_R || 930 || ???
| + | |
- | |}
| + | |
- | | + | |
- | == 28th ==
| + | |
- | * [[User:Mosthege|Michael]] made a restriction of BioBrick K1319020 and vector pSB1C3 with restriction enzymes EcoRI and PstI. Then [[User:VerA|Vera]] ligated the restricted parts and made a transformation using ''E. coli'' NEB 10ß cells.
| + | |
- | | + | |
- | == 29th ==
| + | |
- | | + | |
- | * [[User:Eshani.sood|Eshani]] made cryo cultures and plasmid preparation of K1319010, K1319011, K1319012, K1319021 and K1319042. [[User:VeraA|Vera]] determined the contentration of plasmids and made did a restriction digest of K1319010, K1319011, K1319012, pSB1C3, K1319021, K1319013 and K1319014, followed by a ligation in K1319010.pSB1C3, K1319011.pSB1C3, K1319012.pSB1C3, K1319021.K1319013.pSB1A3 and K1319021.K1319013.pSB1A3. All constructs were transformed into ''E. coli'' NEB 10ß.
| + | |
- | | + | |
- | * [[User:Nbailly|Nina]] prepared 3 500 mL flasks with 30 mL LB medium which were inoculated with a ''Pseudomonas putida'' strain. The cells were cultured over night at 28 °C and ~300 rpm. The cultures are supposed to be used to test our OD device.
| + | |
- | | + | |
- | == 30th ==
| + | |
- | | + | |
- | * Sequencing samples were sent in for K1319020 clone #2, 3 & 5 (in pSB1C3), K1319017 clone #1 (in pSB1C3), K1319010 clone #2 (in pSB3K3), K1319011 clone #1 (in pSB3K3), K1319012 clone #2 (in pSB3K3), K1319013 clone #1 (in pSB1C3), K1319014 clone #1 (in pSB1C3), K1319001 (in pSB1C3) and K1319002 (in pSB1C3).
| + | |
- | | + | |
- | * A plasmid prep of K1319013 and K1319014 was run.
| + | |
- | | + | |
- | * A Gibson assembly with the K1319015 from the I20260 backbone and the K1319000 insert, forming K3139015, was conducted. The product was subsequently transformed into NEB10β cells.
| + | |
- | | + | |
- | * The pSB1C3 plasmid backbones were amplified via PCR and purified.
| + | |
- | | + | |
- | * Colony-PCRs of K1319008 and K1319012 master plates were made to confirm the colony's identity. Subsequently, pre-cultures were inoculated.
| + | |
- | | + | |
- | * A transformation of K1319010 and K1319010 in pSB1C3 was conducted.
| + | |
- | | + | |
- | * Another plasmid prep of K1319010 clone #2, K1319011 clone #1, K1319012 clone #2 (all in pSB3K3), K1319013 clone #4, K1319014 #3, K139020 #2, 3, 5 (all in pSB1C3) was run.
| + | |
- | | + | |
- | * The OD device was tested with a dilution series of a ''Pseudomonas putida'' culture.
| + | |
- | | + | |
- | = October =
| + | |
- | == 1st ==
| + | |
- | * Prepartations for sensor-chip manufacturing the following day (2014-10-02):
| + | |
- | ** At 18:30 [[User:PatrickO|Patrick]] prepared over-night cultures from K1319042, B0015 and K131026 by inoculating 250 mL Erlenmeyer flasks each containing 50 mL LB medium . The flasks were incubated for ~12 hours at 37 °C on a shaker.
| + | |
- | | + | |
- | == 2nd ==
| + | |
- | | + | |
- | * At 8:30, [[User:NBailly|Nina]] and [[User:AZimmermann|Arne]] did a plasmid prep of dublicate samples of K1319011 clone #1 and #6. [[User:Fgohr|Florian]] measured the DNA yield, and the higher concentrated sample of clone #1 and #6, respectively, were sent in for sequencing.
| + | |
- | * [[User:NBailly|Nina]] made precultures and a master plate of 6 colonies of K3139008 in psB1C3 in NEB10β cells that had been plated at 5:30 this morning.
| + | |
- | | + | |
- | * Manufacturing of sensor-chips:
| + | |
- | ** At 10:00 [[User:PatrickO|Patrick]] prepared 150 mL LB medium containing 1.5 % (w/v) agarose, which will be referred to as LB+agarose hereafter. The LB+agarose solution was autoclaved and subsequently tempered to 45 °C. Precultures (50 mL each) of K1319042, B0015 and K131026 were spun down at 3000 rpm (?check?) for 10 min at 21 °C and re-suspended in 1 mL pretempered (21 °C) LB medium. The re-suspended cultures were mixed with 49 mL LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37 °C for 1 h.
| + | |
- | ** K1319042 and B0015 were induced with 0.2 µL IPTG (100 mM) subsequently to incubation and K131026 was induced with 0.2 µL homoserinlacton stock solution (50 µM) 30 minutes after induction of the K1319042 and B0015. The induced sensor-chips were read out every 30 minutes for 180 minutes in total. An additional readout was conducted 285 minutes post induction. The readout was done at 450 nm and 480 nm wavelength.
| + | |
- | | + | |
- | * Gibson assembly of K1319008
| + | |
- | ** Template Backbone: I746909, Insert: K1319004
| + | |
- | ** Transformation in ''E.coli'' NEB10β and BL21
| + | |
- | | + | |
- | * PCRs for Gibson assembly of K1319010 and K1319015
| + | |
- | ** Template Backbone: I20260 for K1319010 and K1319015
| + | |
- | ** Template Insert: K1319000 for K1319010 and K1319015 (but different primer)
| + | |
- | | + | |
- | * made precultures of K1319013 and K1319014 in pSB3K3
| + | |
- | | + | |
- | * K1319011 in pSB1C3 prepped for sequencing
| + | |
- | | + | |
- | * Gibson assembly of K1319017 (PCRs, Gibson assembly, restriction with DnpI, transformation into NEB10β)
| + | |
- | ** Template Backbone: B0015
| + | |
- | ** Template Insert 1: LasI synthesized gene
| + | |
- | ** Template Insert 2: K660004
| + | |
- | | + | |
- | ==3rd==
| + | |
- | | + | |
- | * made master plates of K1319008 in NEB10β and BL21 and precultures
| + | |
- | | + | |
- | * check PCR for K1319008 to validate the Gibson assembly check for potential I746909 residues
| + | |
- | | + | |
- | {{Team:Aachen/Figure|Aachen_14-10-03_K1319008_insert_colonyPCR.png|title=Check PCR K1319008|subtitle=K1319008 was checked with the Primers K1319008_Check_R and I746909_Check_R (both with G00100 Alternative as froward primer) for presence of K1319008 or I746909. All tested clones were positive for K1319008 and negative for I746909.|width=800px}}
| + | |
- | | + | |
- | * [[User:fgohr|Florian]] and [[User:StefanReinhold|Stefan]] did a plasmid prep and made cryo stocks of K1319008 in NEB (clones #1, #2, #3) and BL21 (clones #1, #2)
| + | |
- | | + | |
- | * Plasmid prep of K1319013 and K1319014 in pSB3K3
| + | |
- | | + | |
- | * Gibson assembly for K1319010 and transformation into NEB10β
| + | |
- | | + | |
- | * made cryo stocks of K1319011 clone #6
| + | |
- | | + | |
- | * restriction of K1319012, k1319013 and K1319014 with EcoRI and PstI. Restriction of linearized plasmid backbone pSB1C3 with EcoRI and PstI. Ligation of K1319012, K1319013 and K1319014 into pSB1C3. Transformation into NEB10β.
| + | |
- | | + | |
- | * Gibson assembly of K1319015 and transformation into NEB10β
| + | |
- | | + | |
- | * colony PCR of K1319017
| + | |
- | | + | |
- | {{Team:Aachen/Figure|Aachen_14-10-03_colony_PCR_K1319017.png|title=colony PCR K1319017|subtitle=K1319017 was checked with a colony PCR for the right insert length. Clones #2 and #4 were correct and used forthwith.|width=800px}}
| + | |
- | | + | |
- | * did plasmid prep and cryo of clones #2 and #4 of K1319017
| + | |
- | | + | |
- | * new plasmid backbone of pSB1C3 was made using the [http://parts.igem.org/Help:Protocols/Linearized_Plasmid_Backbones|standard protocol].
| + | |
- | | + | |
- | * transformation of K1319008 clone #1 (from BL21) and K1319013 into BL21 (two plasmids in one cell).
| + | |
- | | + | |
- | * transformation of K1319008 clone #1 (from BL21) and k1319014 into BL21 (two plasmids in one cell).
| + | |
- | | + | |
- | * OD measurements of three biological triplicates from ''E. coli'' BW21 113, ''P. putida'' and ''S. cerevisiae''. Measurement as an analytic triplicate in the spectrophotometer (absorbance and transmission) and our own OD/F device.
| + | |
- | | + | |
- | * Gibson assembly of K1319021
| + | |
- | ** Template Backbone: K1319008
| + | |
- | ** Template Insert: LasI gene synthesis
| + | |
- | | + | |
- | * At 19:00 [[User:PatrickO|Patrick]] and [[User:fgohr|Florian]] measured OD, absorption (spectrophotometer) and transmission for 19 diltuions in the range of 100-2.5 % from yeast (''Saccharomyces cerevisiae'') and ''P. putida'' liquid cultures. Measurements were conducted in biological as well as technical triplicates.
| + | |
- | | + | |
- | * prepartations for sensor-chip manufacturing the following day (2014-10-04):
| + | |
- | ** At 22:00 [[User:PatrickO|Patrick]] prepared over-night cultures from B0015, K1319017 and K131026 by inoculating 250 mL Erlenmeyer flasks each containing 50 mL LB medium for sensor-chip manufacturing the next day. The flasks were incubated for ~12 hours at 37 °C on a shaker.
| + | |
- | | + | |
- | ==4th ==
| + | |
- | | + | |
- | * colony PCR of K1319015 and Check PCR of K1319010
| + | |
- | ** K1319010: clone #1 was positive
| + | |
- | ** K1319015: in all clones the inserts were too short.
| + | |
- | | + | |
- | * new digestion of Gibson master mix of K1319015 with DnpI
| + | |
- | | + | |
- | * transformation of new Gibson master mix into NEB 10β
| + | |
- | | + | |
- | * restriction of K1319010,K1319012, K1319013 and K1319014 (all in pSB3K3) with EcoRI and PstI, cutting of pSB1C3 with EcoRI and PstI, and then ligation.
| + | |
- | | + | |
- | * made master plates and precultures of the transformations of K1319008 in BL21, K1319013 + K1319008 in BL21 and K1319014 + K1319008 in BL21
| + | |
- | | + | |
- | * colony PCR of the master plates with the double plasmid constructs K1319013 + K1319008 and K1319014 + K1319008
| + | |
- | | + | |
- | * Sending the first BioBricks to the iGEM headquarters:
| + | |
- | ** K1319000
| + | |
- | ** K1319001
| + | |
- | ** K1319002
| + | |
- | ** K1319003
| + | |
- | ** K1319004
| + | |
- | ** K1319008
| + | |
- | ** K1319011
| + | |
- | ** K1319017
| + | |
- | ** K1319020
| + | |
- | ** K1319042
| + | |
- | | + | |
- | * shake flask experiments with K1319008 (clone #1), K1319013 + K1319008 (clone #2) and K1319014 + K1319008 (clone #2) in LB (2 flasks each). Inoculation with 50 µL preculture and inducing with iPTG at OD of 1.5.
| + | |
- | | + | |
- | * Manufacturing of sensor-chips:
| + | |
- | ** At 13:30 [[User:PatrickO|Patrick]] prepared 150 mL LB+agarose medium (1.5 % (w/v) agarose). The LB+agarose solution was autoclaved and subsequently cooled to 45 °C. Precultures (50 mL filling volume) of B0015 and K1319017 and K131026 were spun down at 3000 rpm (?check?) for 10 min at 21 °C and re-suspended in 1 mL pretempered (21 °C) LB-medium. The re-suspended cultures were mixed with 49 mL LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37 °C for 1 h.
| + | |
- | ** B0015,K1319017and K131026 were induced with 0.2 µL homoserinlacton stock solution (50 µM). The induced sensor-chips were read out every 30 minutes for 240 minutes in total. Readout was conducted at 450 nm and 480 nm wavelength. An additional readout was conducted after 12 hours.
| + | |
- | | + | |
- | * At 17:00 [[User:PatrickO|Patrick]] prepared 4 liquid cultures from the K1319010_pSB3K3 master plate (clone#1) in 5 mL LB-medium, each. The liquid cultures were prepared in order to create cryo stocks from K1319010-pSB3K3. Kanamycin was added to the liquid cultures as antibiotic at an concentration of 1 µL/mL.
| + | |
- | | + | |
- | * At 18:00 [[User:PatrickO|Patrick]] prepared a master plate (LB+C) and corresonding liquid cultures from 6 clones of ''E.coli'' NEB10B k1319021-psB1C3. Liquid cultures and master plate were incubated at 37 °C.
| + | |
- | | + | |
- | * At 23:30 [[User:PatrickO|Patrick]] prepared liquid cultures from K1319015-pSB3K3 clones #7, #8 and #9 in 5 mL LB-medium. Kanamycin was used as antibiotic and the cultures were incubated at 37 °C. Purpose of the cultures was cryo stock preparation and plasmid prep.
| + | |
- | | + | |
- | ==5th ==
| + | |
- | | + | |
- | * At 11:45 [[User:PatrickO|Patrick]] and Anna prepred cryo stocks from NEB K1319010-pSB3k3 #1, K1319015-pSB3K3 #7, K1319015-pSB3K3 #8 and K1319015-pSB3K3 #9 by mixing 750 µl lquid culture with 750 µl 50% (v/v) Glycerol-solution in 26 ml eppis.
| + | |
- | **Plasmid prep was also done for the cultures mentioned above.
| + | |
- | | + | |
- | * At 12:00 [[User:PatrickO|Patrick]] prepared liquid cultures from K139010-pSB3K3, K139011-pSB3K3, K139012-pSB3K3, K139013-pSB3K3, K139014-pSB3K3, K139015-pSB3K3 in 5 ml LB-medium each. Kanamycin was used as antibiotic. Purpose for the cultures was the characterization of constituitive expression and an additional plasmid prep of K139013-pSB3K3 and K139014-pSB3K3.
| + | |
- | | + | |
- | * Manufacturing of sensor-chips:
| + | |
- | ** At 13:00 [[User:PatrickO|Patrick]] prepared 150 mL LB+agarose medium (1.5% (w/v) agarose). The LB+agarose solution was autoclaved and subsequently cooled to 45 °C. Precultures (50 mL each) of BL21 pSB1C3-K131900+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015 were spun down at 3000 rpm (?check?) for 10 min at 21 °C and re-suspended in 1 mL pretempered (21 °C) LB-medium. The re-suspended cultures were mixed with 49 mL LB+agarose and poured onto three sensor-chip-templates (one template per culture). Sensor chips were cut out from the template and incubated at 37 °C for 1 h.
| + | |
- | **BL21 pSB1C3-K131900+pSB3K3-K1319014, BL21 pSB1C3-K1319008+pSB3K3-K1319013 and NEB pSB1C3-B0015 were induced with 0.2 µL IPTG. The induced sensor-chips were read out every 30 minutes for 360 minutes in total. K1319013 was induced earlier and thus measurements were taken for 450 min in total. Readout was conducted at 480 nm wavelength. An additional readout was conducted after XX hours.
| + | |
- | | + | |
- | * At 15:30 [[User:PatrickO|Patrick]] prepared liquid cultures...
| + | |
- | ** I746909 in pSB1C3
| + | |
- | ** I20260 in pSB3K3
| + | |
- | ** K731520 in pSB1C3
| + | |
- | ** K1319008 in pSB1C3
| + | |
- | ** K1319013 in pSB3K3
| + | |
- | ** K1319014 in pSB3K3
| + | |
- | ** B0015 in pSB1C3
| + | |
- | ** K1319013 in pSB3K3 + K1319008 in pSB1C3
| + | |
- | ** B0015 in pSB1C3
| + | |
- | ** K1319014 in pSB3K3 + K1319008 in pSB1C3
| + | |
- | *:...as precultures for the characterization of ITPG inducible expression.
| + | |
- | | + | |
- | * [[User:fgohr|Florian]] and [[User:PatrickO|Patrick]] prepared a colony PCR from K1319014-pSB1C3 clones #3, #4, #5 and#6. H20 and K1319014-pSB3K3 were used as controls.
| + | |
- | | + | |
- | * At 22:20 [[User:Mosthege|Michael]] and [[User:VeraA|Vera]] prepared 1 L LB+C plates (2.5 g NaCl, 10 g Agar, 2.5 g yeast extract and 5 g Trypton). N-Z-amine (peptone from casein) was used instead of tryptone, because the tryptone stock was depleted.
| + | |
- |
| + | |
- | * [[User:Pdemling|Philipp]] and [[User:R.hanke|René]] prepped multiple cultures K1319013 in pSB3K3 and K1319014 in pSB3K3. Now we have sufficient amount of both plasmids.
| + | |
- | | + | |
- | * Plates were made by [[User:R.hanke|René]] and [[User:Mosthege|Michael]] for the following constructs:
| + | |
- | | + | |
- | {| class="wikitable"
| + | |
- | ! part in vector !! strain !! resistance
| + | |
- | |-
| + | |
- | | K1319008 in pSB1C3 || BL21(DE3) || C
| + | |
- | |-
| + | |
- | | K1319010 in pSB3K3 || NEB10β || K
| + | |
- | |-
| + | |
- | | K1319011 in pSB3K3 || NEB10β || K
| + | |
- | |-
| + | |
- | | K1319012 in pSB3K3 || NEB10β || K
| + | |
- | |-
| + | |
- | | K1319013 in pSB3K3 || NEB10β || K
| + | |
- | |-
| + | |
- | | K1319014 in pSB3K3 || NEB10β || K
| + | |
- | |-
| + | |
- | | K1319015 in pSB3K3 || NEB10β || K
| + | |
- | |-
| + | |
- | | K1319017 in pSB1C3 || NEB10β || C
| + | |
- | |-
| + | |
- | | K1319042 in pSB1C3 || BL21(DE3) || C
| + | |
- | |-
| + | |
- | | K1319008 in pSB1C3 + K1319013 in pSB3K3 || BL21(DE3) || C+K
| + | |
- | |-
| + | |
- | | K1319008 in pSB1C3 + K1319014 in pSB3K3 || BL21(DE3) || C+K
| + | |
- | |-
| + | |
- | | I746909 in pSB1C3 || BL21(DE3) || C
| + | |
- | |-
| + | |
- | | K731520 in pSB1C3 || DH5α || C
| + | |
- | |-
| + | |
- | | I20260 in pSB3K3 || NEB10β || K
| + | |
- | |-
| + | |
- | | B0015 in pSB1C3 || NEB10β || C
| + | |
- | |}
| + | |
- | | + | |
- | | + | |
- | * To determine whether the conducted Gibson assembly of K1319021 and subsequent transformation into ''E. coli'' NEB 10β were successful, a colony PCR on these cells was performed by [[User:R.hanke|René]]. Primers binding to each of the templates used for Gibson assembly were used: LasI_Insert_F binding in J23101.B0032.C0079.B0015.J64010.B0034 and K1319004_Check_R binding in pSB1C3-K1319008. Bands at 1341 bp would indicate the successful construction and transformation of K1319021.
| + | |
- | | + | |
- | {{Team:Aachen/Figure|Aachen_14-10-05_Check_PCR_on_K1319021.png|title=Check PCR on K1319021|subtitle=(Homoserinlactone-inducible expression of the TEV protease)|width=800px}}
| + | |
- | | + | |
- | Since Bands >2000 bp were observed, another PCR was performed by [[User.R.hanke|René]] using primers binding upstream and downstream of the insert in pSB1C3: G00100_alternative and G00101_alternative. Here, bands with a length of 2210 bp would verify the correct length of K1319021.
| + | |
| | | |
| {{Team:Aachen/Footer}} | | {{Team:Aachen/Footer}} |